LDB3 (LIM domain binding 3) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: LDB3 (LIM domain binding 3) Homo sapiens
Analyze
Symbol: LDB3
Name: LIM domain binding 3
RGD ID: 1351488
HGNC Page HGNC
Description: Exhibits cytoskeletal protein binding activity. Predicted to be involved in actin cytoskeleton organization; heart development; and muscle structure development. Localizes to Z disc and cytoskeleton. Implicated in dilated cardiomyopathy; dilated cardiomyopathy 1C; distal myopathy; and myofibrillar myopathy 4. Biomarker of myotonic dystrophy type 1.
Type: protein-coding
RefSeq Status: REVIEWED
Also known as: cardiomyopathy, dilated 1C (autosomal dominant); CMD1C; CMH24; CMPD3; CYPHER; FLJ35865; KIAA01613; KIAA0613; LDB3Z1; LDB3Z4; LIM domain-binding protein 3; LIM domain-binding protein 3 isoform; LVNC3; MFM4; ORACLE; PDLIM6; PDZ and LIM domain 6; Z-band alternatively spliced PDZ motif protein; Z-band alternatively spliced PDZ-motif protein; ZASP
RGD Orthologs
Mouse
Rat
Chinchilla
Bonobo
Dog
Squirrel
Pig
Green Monkey
Naked Mole-Rat
Alliance Genes
More Info more info ...
Allele / Splice: See ClinVar data
Latest Assembly: GRCh38 - Human Genome Assembly GRCh38
NCBI Annotation Information: Note: LDB3 (Gene ID: 11155) and ZASP (Gene ID: 101927655) share the ZASP alias/unofficial symbol in common. [01 Jun 2018]
Position:
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 Ensembl1086,668,507 - 86,736,072 (+)EnsemblGRCh38hg38GRCh38
GRCh381086,666,788 - 86,736,072 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh371088,426,545 - 88,495,829 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 361088,418,301 - 88,485,805 (+)NCBINCBI36hg18NCBI36
Build 341088,418,407 - 88,484,731NCBI
Celera1082,430,979 - 82,498,948 (+)NCBI
Cytogenetic Map10q23.2NCBI
HuRef1082,282,449 - 82,350,075 (+)NCBIHuRef
CHM1_11088,709,859 - 88,777,554 (+)NCBICHM1_1
JBrowse: View Region in Genome Browser (JBrowse)
Model


Gene Ontology Annotations     Click to see Annotation Detail View

Biological Process

Cellular Component

Molecular Function

Molecular Pathway Annotations     Click to see Annotation Detail View
Phenotype Annotations     Click to see Annotation Detail View

Human Phenotype
Abnormal left ventricular function  (IAGP)
Abnormality of neutrophils  (IAGP)
Ankle weakness  (IAGP)
Autophagic vacuoles  (IAGP)
Autosomal dominant inheritance  (IAGP)
Cardiomyopathy  (IAGP)
Congestive heart failure  (IAGP)
Decreased Achilles reflex  (IAGP)
Decreased patellar reflex  (IAGP)
Dilated cardiomyopathy  (IAGP)
Elevated circulating creatine kinase concentration  (IAGP)
EMG abnormality  (IAGP)
EMG: myopathic abnormalities  (IAGP)
EMG: neuropathic changes  (IAGP)
Endocardial fibrosis  (IAGP)
Fatigable weakness of distal limb muscles  (IAGP)
Foot dorsiflexor weakness  (IAGP)
Gait disturbance  (IAGP)
Generalized muscle weakness  (IAGP)
Heart block  (IAGP)
Hypertrophic cardiomyopathy  (IAGP)
Hyporeflexia of lower limbs  (IAGP)
Intrinsic hand muscle atrophy  (IAGP)
Late onset  (IAGP)
Left ventricular hypertrophy  (IAGP)
Left ventricular noncompaction  (IAGP)
Left ventricular noncompaction cardiomyopathy  (IAGP)
Leg muscle stiffness  (IAGP)
Limb-girdle muscle weakness  (IAGP)
Lipoatrophy  (IAGP)
Muscle fiber splitting  (IAGP)
Myofibrillar myopathy  (IAGP)
Myopathy  (IAGP)
Palmoplantar keratoderma  (IAGP)
Peripheral neuropathy  (IAGP)
Polyneuropathy  (IAGP)
Progressive distal muscle weakness  (IAGP)
Progressive muscle weakness  (IAGP)
Progressive proximal muscle weakness  (IAGP)
Prolonged QT interval  (IAGP)
Proximal muscle weakness in upper limbs  (IAGP)
Sensorineural hearing impairment  (IAGP)
Sudden cardiac death  (IAGP)
Ventricular arrhythmia  (IAGP)
Ventricular tachycardia  (IAGP)
Weakness of long finger extensor muscles  (IAGP)
Weakness of the intrinsic hand muscles  (IAGP)
Wrist drop  (IAGP)
References

Additional References at PubMed
PMID:8681137   PMID:8823300   PMID:9734811   PMID:10391924   PMID:10427098   PMID:10727866   PMID:11076863   PMID:11842093   PMID:12477932   PMID:14662268   PMID:14702039   PMID:15174051  
PMID:16344560   PMID:16385451   PMID:16476425   PMID:17394203   PMID:17987659   PMID:18513529   PMID:19377068   PMID:19472918   PMID:20066428   PMID:20201937   PMID:20301486   PMID:20301672  
PMID:20474083   PMID:21873635   PMID:22349865   PMID:22929165   PMID:23271734   PMID:23996002   PMID:24647531   PMID:24668811   PMID:25041374   PMID:26186194   PMID:26344197   PMID:26871637  
PMID:27546599   PMID:28349680   PMID:28514442   PMID:30948763   PMID:31379146  


Genomics

Comparative Map Data
LDB3
(Homo sapiens - human)
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 Ensembl1086,668,507 - 86,736,072 (+)EnsemblGRCh38hg38GRCh38
GRCh381086,666,788 - 86,736,072 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh371088,426,545 - 88,495,829 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 361088,418,301 - 88,485,805 (+)NCBINCBI36hg18NCBI36
Build 341088,418,407 - 88,484,731NCBI
Celera1082,430,979 - 82,498,948 (+)NCBI
Cytogenetic Map10q23.2NCBI
HuRef1082,282,449 - 82,350,075 (+)NCBIHuRef
CHM1_11088,709,859 - 88,777,554 (+)NCBICHM1_1
Ldb3
(Mus musculus - house mouse)
Mouse AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCm391434,248,656 - 34,312,276 (-)NCBIGRCm39mm39
GRCm39 Ensembl1434,248,560 - 34,310,639 (-)Ensembl
GRCm381434,526,699 - 34,590,314 (-)NCBIGRCm38GRCm38mm10GRCm38
GRCm38.p6 Ensembl1434,526,603 - 34,588,682 (-)EnsemblGRCm38mm10GRCm38
MGSCv371435,339,885 - 35,401,867 (-)NCBIGRCm37mm9NCBIm37
MGSCv361433,355,797 - 33,417,766 (-)NCBImm8
Celera1430,792,367 - 30,854,357 (-)NCBICelera
Cytogenetic Map14BNCBI
Ldb3
(Rattus norvegicus - Norway rat)
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
mRatBN7.2169,855,768 - 9,920,108 (-)NCBI
Rnor_6.0 Ensembl1610,878,334 - 10,941,501 (-)EnsemblRnor6.0rn6Rnor6.0
Rnor_6.01610,878,348 - 10,943,016 (-)NCBIRnor6.0Rnor_6.0rn6Rnor6.0
Rnor_5.0169,203,392 - 9,267,999 (-)NCBIRnor5.0Rnor_5.0rn5Rnor5.0
RGSC_v3.41610,221,362 - 10,247,798 (-)NCBIRGSC3.4rn4RGSC3.4
Celera165,298,641 - 5,360,715 (+)NCBICelera
Cytogenetic Map16p15NCBI
Ldb3
(Chinchilla lanigera - long-tailed chinchilla)
Chinchilla AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChiLan1.0 EnsemblNW_0049555105,738,041 - 5,790,557 (+)EnsemblChiLan1.0
ChiLan1.0NW_0049555105,738,254 - 5,793,643 (+)NCBIChiLan1.0ChiLan1.0
LDB3
(Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
PanPan1.11086,641,517 - 86,722,159 (+)NCBIpanpan1.1PanPan1.1panPan2
PanPan1.1 Ensembl1086,654,737 - 86,722,148 (+)Ensemblpanpan1.1panPan2
PanPan1.1 Ensembl1086,641,746 - 86,653,143 (+)Ensemblpanpan1.1panPan2
Mhudiblu_PPA_v01083,095,625 - 83,164,297 (+)NCBIMhudiblu_PPA_v0panPan3
LDB3
(Canis lupus familiaris - dog)
Dog AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
CanFam3.1434,367,155 - 34,421,992 (+)NCBICanFam3.1CanFam3.1canFam3CanFam3.1
CanFam3.1 Ensembl434,364,025 - 34,421,509 (+)EnsemblCanFam3.1canFam3CanFam3.1
Dog10K_Boxer_Tasha434,358,600 - 34,415,382 (+)NCBI
ROS_Cfam_1.0434,727,065 - 34,783,874 (+)NCBI
UMICH_Zoey_3.1434,573,067 - 34,629,852 (+)NCBI
UNSW_CanFamBas_1.0434,742,332 - 34,799,090 (+)NCBI
UU_Cfam_GSD_1.0435,247,342 - 35,304,143 (+)NCBI
Ldb3
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)
Squirrel AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HiC_Itri_2NW_02440721344,085,476 - 44,150,650 (-)NCBI
SpeTri2.0NW_004936804196,592 - 259,168 (-)NCBISpeTri2.0SpeTri2.0SpeTri2.0
LDB3
(Sus scrofa - pig)
Pig AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Sscrofa11.1 Ensembl1487,644,242 - 87,722,251 (+)EnsemblSscrofa11.1susScr11Sscrofa11.1
Sscrofa11.11487,660,961 - 87,722,249 (+)NCBISscrofa11.1Sscrofa11.1susScr11Sscrofa11.1
Sscrofa10.21494,915,388 - 94,976,712 (+)NCBISscrofa10.2Sscrofa10.2susScr3
LDB3
(Chlorocebus sabaeus - green monkey)
Green Monkey AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChlSab1.1945,130,015 - 45,199,585 (-)NCBI
ChlSab1.1 Ensembl945,128,134 - 45,198,106 (-)Ensembl
Vero_WHO_p1.0NW_0236660485,238,400 - 5,307,738 (-)NCBI
Ldb3
(Heterocephalus glaber - naked mole-rat)
Naked Mole-rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HetGla 1.0NW_004624841426,300 - 471,855 (-)NCBI

Position Markers
RH48664  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371088,495,610 - 88,495,745UniSTSGRCh37
Build 361088,485,590 - 88,485,725RGDNCBI36
Celera1082,498,733 - 82,498,868RGD
Cytogenetic Map10q22.3-q23.2UniSTS
HuRef1082,349,860 - 82,349,995UniSTS
GeneMap99-GB4 RH Map10421.51UniSTS
NCBI RH Map101014.6UniSTS
SHGC-57810  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371088,486,015 - 88,486,111UniSTSGRCh37
Build 361088,475,995 - 88,476,091RGDNCBI36
Celera1082,489,309 - 82,489,405RGD
Cytogenetic Map10q22.3-q23.2UniSTS
HuRef1082,340,259 - 82,340,355UniSTS
RH122045  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371088,448,583 - 88,448,855UniSTSGRCh37
Build 361088,438,563 - 88,438,835RGDNCBI36
Celera1082,451,367 - 82,451,638RGD
Cytogenetic Map10q22.3-q23.2UniSTS
HuRef1082,302,849 - 82,303,120UniSTS
RH118568  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371088,451,943 - 88,452,140UniSTSGRCh37
Build 361088,441,923 - 88,442,120RGDNCBI36
Celera1082,454,726 - 82,454,923RGD
Cytogenetic Map10q22.3-q23.2UniSTS
HuRef1082,306,208 - 82,306,405UniSTS
D10S1290E  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371088,459,642 - 88,459,732UniSTSGRCh37
Build 361088,449,622 - 88,449,712RGDNCBI36
Celera1082,462,414 - 82,462,504RGD
Cytogenetic Map10q22.3-q23.2UniSTS
HuRef1082,313,891 - 82,313,981UniSTS
D10S1307E  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371088,494,578 - 88,494,708UniSTSGRCh37
Build 361088,484,558 - 88,484,688RGDNCBI36
Celera1082,497,797 - 82,497,927RGD
Cytogenetic Map10q22.3-q23.2UniSTS
HuRef1082,348,829 - 82,348,959UniSTS
SHGC-154028  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371088,433,083 - 88,433,409UniSTSGRCh37
Build 361088,423,063 - 88,423,389RGDNCBI36
Celera1082,435,861 - 82,436,187RGD
Cytogenetic Map10q22.3-q23.2UniSTS
HuRef1082,287,334 - 82,287,660UniSTS
RH41795  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371088,459,550 - 88,459,739UniSTSGRCh37
Build 361088,449,530 - 88,449,719RGDNCBI36
Celera1082,462,322 - 82,462,511RGD
Cytogenetic Map10q22.3-q23.2UniSTS
HuRef1082,313,799 - 82,313,988UniSTS
GeneMap99-GB4 RH Map10423.05UniSTS
NCBI RH Map101014.2UniSTS
D1S1423  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map10p12.1UniSTS
Cytogenetic Map10p12.1-p11.2UniSTS
Cytogenetic Map9q34.13UniSTS
Cytogenetic Map16q22.1UniSTS
Cytogenetic Map21q22.2UniSTS
Cytogenetic Map3p24.2UniSTS
Cytogenetic Map9q32UniSTS
Cytogenetic Map1q24UniSTS
Cytogenetic Map1q21UniSTS
Cytogenetic Map1p36.33UniSTS
Cytogenetic Map7p15.2UniSTS
Cytogenetic Map6p21UniSTS
Cytogenetic Map5q31UniSTS
Cytogenetic Map6p22.3-p21.32UniSTS
Cytogenetic Map6q22.33UniSTS
Cytogenetic Map3q29UniSTS
Cytogenetic Map17p11.2UniSTS
Cytogenetic Map19q13.3UniSTS
Cytogenetic Map1p36.13UniSTS
Cytogenetic Map5q33.3UniSTS
Cytogenetic Map22q11.22UniSTS
Cytogenetic Map11q13.2-q13.3UniSTS
Cytogenetic Map3q22-q24UniSTS
Cytogenetic Map8p21.3UniSTS
Cytogenetic Map7q32UniSTS
Cytogenetic Map1p32.3UniSTS
Cytogenetic Map19p13.12UniSTS
Cytogenetic Map4q21.1UniSTS
Cytogenetic Map12q13.13UniSTS
Cytogenetic Map7q11.2UniSTS
Cytogenetic Map1p22.1UniSTS
Cytogenetic Map2q32UniSTS
Cytogenetic MapXq13.1UniSTS
Cytogenetic Map9q12UniSTS
Cytogenetic Map3q26.2UniSTS
Cytogenetic Map22q11.21UniSTS
Cytogenetic Map10q23-q24UniSTS
Cytogenetic Map17q12UniSTS
Cytogenetic Map1p36.21UniSTS
Cytogenetic Map19p13.2UniSTS
Cytogenetic Map16q24.3UniSTS
Cytogenetic Map9q34.3UniSTS
Cytogenetic Map4p14UniSTS
Cytogenetic Map2p12UniSTS
Cytogenetic Map16p11.2UniSTS
Cytogenetic Map3q23UniSTS
Cytogenetic Map18q22.1UniSTS
Cytogenetic Map13q12UniSTS
Cytogenetic Map10p14-p13UniSTS
Cytogenetic Map12p13.31UniSTS
Cytogenetic Map14q24.3UniSTS
Cytogenetic Map22q13.2UniSTS
Cytogenetic Map19q13.11UniSTS
Cytogenetic Map11q23-q24UniSTS
Cytogenetic Map11q13.1UniSTS
Cytogenetic Map12q24.31UniSTS
Cytogenetic Map17q25UniSTS
Cytogenetic Map16q24.1UniSTS
Cytogenetic Map5q23.3UniSTS
Cytogenetic Map19q13.43UniSTS
Cytogenetic Map17q11.2UniSTS
Cytogenetic Map20q13.12UniSTS
Cytogenetic MapXp11.23UniSTS
Cytogenetic Map19q13.42UniSTS
Cytogenetic Map16q13UniSTS
Cytogenetic Map11q25UniSTS
Cytogenetic Map22cen-q12.3UniSTS
Cytogenetic Map10p13UniSTS
Cytogenetic Map2p11.2UniSTS
Cytogenetic Map15q11.2-q21.3UniSTS
Cytogenetic Map1p21.2UniSTS
Cytogenetic Map19p13UniSTS
Cytogenetic Map7q21.13UniSTS
Cytogenetic Map7q31.1UniSTS
Cytogenetic Map17p13.3UniSTS
Cytogenetic Map1p35.1UniSTS
Cytogenetic Map16q24UniSTS
Cytogenetic Map3q25UniSTS
Cytogenetic Map2q24.2UniSTS
Cytogenetic Map1p31.3UniSTS
Cytogenetic Map14q31.1UniSTS
Cytogenetic Map22q13.1UniSTS
Cytogenetic Map20q13.31UniSTS
Cytogenetic Map19p13.3UniSTS
Cytogenetic Map6p12.1UniSTS
Cytogenetic Map6q25.3UniSTS
Cytogenetic Map1q32.1UniSTS
Cytogenetic Map11q24.2UniSTS
Cytogenetic Map10p15.1UniSTS
Cytogenetic Map2p13.1UniSTS
Cytogenetic Map19q13.12UniSTS
Cytogenetic Map12p13.32UniSTS
Cytogenetic Map4q35.1UniSTS
Cytogenetic Map2p13.3UniSTS
Cytogenetic Map1p22UniSTS
Cytogenetic Map2q14UniSTS
Cytogenetic Map4q12UniSTS
Cytogenetic Map16p13.3UniSTS
Cytogenetic Map14q32.33UniSTS
Cytogenetic Map1p36.1UniSTS
Cytogenetic Map8p11.21UniSTS
Cytogenetic MapXq26.3UniSTS
Cytogenetic Map8q24.11UniSTS
Cytogenetic Map9q22.31UniSTS
Cytogenetic Map7q11.23UniSTS
Cytogenetic Map2p15UniSTS
Cytogenetic Map5q31.1UniSTS
Cytogenetic Map8q24.13UniSTS
Cytogenetic Map17p13UniSTS
Cytogenetic Map8p11.22UniSTS
Cytogenetic Map4q28UniSTS
Cytogenetic Map15q24.1UniSTS
Cytogenetic Map1q41-q42UniSTS
Cytogenetic Map10q22UniSTS
Cytogenetic Map5q35.3UniSTS
Cytogenetic Map20q11.21UniSTS
Cytogenetic Map8q24.3UniSTS
Cytogenetic Map12p13.1-p12.3UniSTS
Cytogenetic Map6p21.33UniSTS
Cytogenetic Map22q13.33UniSTS
Cytogenetic Map19p12UniSTS
Cytogenetic Map1p13.1UniSTS
Cytogenetic Map7q22.1UniSTS
Cytogenetic Map14q12UniSTS
Cytogenetic Map19q13.32UniSTS
Cytogenetic Map11q13.2UniSTS
Cytogenetic Map15q22.31UniSTS
Cytogenetic Map5q12.3UniSTS
Cytogenetic Map7q33UniSTS
Cytogenetic Map17q21.2UniSTS
Cytogenetic Map4q23UniSTS
Cytogenetic Map12q13.12UniSTS
Cytogenetic Map18p11.21UniSTS
Cytogenetic Map10q26.11UniSTS
Cytogenetic Map14q32.12UniSTS
Cytogenetic Map11q24.1UniSTS
Cytogenetic Map18q23UniSTS
Cytogenetic Map2q31.1UniSTS
Cytogenetic Map18p11.31UniSTS
Cytogenetic Map2q24.3UniSTS
Cytogenetic Map11q23UniSTS
Cytogenetic Map17q21.31UniSTS
Cytogenetic Map13q34UniSTS
Cytogenetic Map1p34.3UniSTS
Cytogenetic Map10p14UniSTS
Cytogenetic Map15q22.2UniSTS
Cytogenetic Map17q25.1UniSTS
Cytogenetic Map5q32UniSTS
Cytogenetic Map4p16.3UniSTS
Cytogenetic Map12q23.2UniSTS
Cytogenetic Map11q12.3UniSTS
Cytogenetic Map16q12.2UniSTS
Cytogenetic Map9q22.2UniSTS
Cytogenetic Map1q21.3UniSTS
Cytogenetic Map1p35.3UniSTS
Cytogenetic Map19q13.2UniSTS
Cytogenetic Map11p15.5UniSTS
Cytogenetic Map7q22UniSTS
Cytogenetic Map18p11.31-p11.21UniSTS
Cytogenetic Map3p25.3UniSTS
Cytogenetic Map3q13UniSTS
Cytogenetic Map21q22.3UniSTS
Cytogenetic Map1q43UniSTS
Cytogenetic Map19p13.11UniSTS
Cytogenetic Map19q13.41UniSTS
Cytogenetic Map7p21.2UniSTS
Cytogenetic Map12q21.1UniSTS
Cytogenetic Map15q15.1UniSTS
Cytogenetic Map15q13.1UniSTS
Cytogenetic Map1q42.1UniSTS
Cytogenetic Map5q31.2UniSTS
Cytogenetic Map1q21.2UniSTS
Cytogenetic Map17p13.1UniSTS
Cytogenetic Map1p34-p33UniSTS
Cytogenetic Map3q22.1UniSTS
Cytogenetic Map7p14UniSTS
Cytogenetic Map15q21UniSTS
Cytogenetic Map12q24.2UniSTS
Cytogenetic Map20q13UniSTS
Cytogenetic Map19q13.3-q13.4UniSTS
Cytogenetic Map17q21.32UniSTS
Cytogenetic Map15q11.2UniSTS
Cytogenetic Map8p23-p22UniSTS
Cytogenetic Map1p12UniSTS
Cytogenetic Map3q13.33UniSTS
Cytogenetic Map10p12.33UniSTS
Cytogenetic Map5q13.2UniSTS
Cytogenetic Map3q26UniSTS
Cytogenetic Map9p21.2UniSTS
Cytogenetic Map2p16.1UniSTS
Cytogenetic Map5q21.3UniSTS
Cytogenetic Map1p36.22UniSTS
Cytogenetic Map1p34.2UniSTS
Cytogenetic Map3q26.31UniSTS
Cytogenetic MapXp22.33UniSTS
Cytogenetic MapYp11.3UniSTS
Cytogenetic Map17q24.1UniSTS
Cytogenetic Map9q21.11UniSTS
Cytogenetic Map6q22.31UniSTS
Cytogenetic Map9q21.13UniSTS
Cytogenetic Map10q11.22UniSTS
Cytogenetic Map22q13.31UniSTS
Cytogenetic Map17p12UniSTS
Cytogenetic Map17q21.33UniSTS
Cytogenetic Map5p13.3UniSTS
Cytogenetic Map10q21.3UniSTS
Cytogenetic Map10q22.1UniSTS
Cytogenetic Map1p34UniSTS
Cytogenetic MapXp22UniSTS
Cytogenetic Map20p12.3-p11.21UniSTS
Cytogenetic Map2q37.1UniSTS
Cytogenetic Map6p25UniSTS
Cytogenetic MapXq27.2UniSTS
Cytogenetic Map4q31.1UniSTS
Cytogenetic Map4q31UniSTS
Cytogenetic Map22q13.1-q13.2UniSTS
Cytogenetic MapXq28UniSTS
Cytogenetic Map1p36.11UniSTS
Cytogenetic Map12q13.3UniSTS
Cytogenetic Map3q26.33UniSTS
Cytogenetic Map19q13.4UniSTS
Cytogenetic Map14q32UniSTS
Cytogenetic Map10q24.3UniSTS
Cytogenetic Map16q21UniSTS
Cytogenetic Map2p13UniSTS
Cytogenetic Map19q13.1UniSTS
Cytogenetic Map7q21-q22UniSTS
Cytogenetic Map2q11.2UniSTS
Cytogenetic Map17q25.3UniSTS
Cytogenetic Map4q22.1UniSTS
Cytogenetic Map11q22.1UniSTS
Cytogenetic Map12q14.2UniSTS
Cytogenetic Map20p13UniSTS
Cytogenetic Map7q36.3UniSTS
Cytogenetic Map20q11.21-q11.23UniSTS
Cytogenetic Map2q33.2UniSTS
Cytogenetic Map12q22UniSTS
Cytogenetic Map20q13.13UniSTS
Cytogenetic Map21p11.1UniSTS
Cytogenetic Map1p35-p34.3UniSTS
Cytogenetic Map7p11.2UniSTS
Cytogenetic Map13q14UniSTS
Cytogenetic Map7q36.1UniSTS
Cytogenetic Map12q24.31-q24.32UniSTS
Cytogenetic Map17q21.1UniSTS
Cytogenetic Map3q12.3UniSTS
Cytogenetic Map12qUniSTS
Cytogenetic Map11q13.5UniSTS
Cytogenetic Map2p14UniSTS
Cytogenetic Map2q14.3UniSTS
Cytogenetic Map7q34UniSTS
Cytogenetic Map14q32.1UniSTS
Cytogenetic Map21q22.11UniSTS
Cytogenetic Map3p14.1UniSTS
Cytogenetic Map16q23.2UniSTS
Cytogenetic Map7q32.1UniSTS
Cytogenetic Map17q22UniSTS
Cytogenetic Map4q31.23UniSTS
Cytogenetic Map11p15.3UniSTS
Cytogenetic Map3q27.1UniSTS
Cytogenetic Map2p22.3UniSTS
Cytogenetic Map22q13UniSTS
Cytogenetic Map1q32UniSTS
Cytogenetic Map11q14UniSTS
Cytogenetic MapXq13.2UniSTS
Cytogenetic Map16p13.12UniSTS
Cytogenetic MapXq22.3UniSTS
Cytogenetic Map9p12UniSTS
Cytogenetic Map4p16.1UniSTS
Cytogenetic Map11q23.1UniSTS
Cytogenetic Map3q27.3UniSTS
Cytogenetic Map16q23.1UniSTS
Cytogenetic Map15q15.2UniSTS
Cytogenetic Map2p21UniSTS
Cytogenetic Map13q33.3UniSTS
Cytogenetic Map15q22-q24UniSTS
Cytogenetic Map14q32.11UniSTS
Cytogenetic Map7p14.3UniSTS
Cytogenetic Map14q21.2UniSTS
Cytogenetic Map15q25.2UniSTS
Cytogenetic Map15q23UniSTS
Cytogenetic Map2p23.3UniSTS
Cytogenetic Map4p15.31UniSTS
Cytogenetic Map1q22UniSTS
Cytogenetic Map20q13.1UniSTS
Cytogenetic Map15q21.3UniSTS
Cytogenetic Map10q23.33UniSTS
Cytogenetic Map4q26UniSTS
Cytogenetic MapXq24UniSTS
Cytogenetic Map10q23.1UniSTS
Cytogenetic Map6p21.1UniSTS
Cytogenetic Map15q22.1-q22.31UniSTS
Cytogenetic Map1q31-q41UniSTS
Cytogenetic Map6q23.3UniSTS
Cytogenetic Map7q21.2UniSTS
Cytogenetic Map14q23UniSTS
Cytogenetic Map12q11-q12UniSTS
Cytogenetic Map17q23.3UniSTS
Cytogenetic Map4q24UniSTS
Cytogenetic Map1p32UniSTS
Cytogenetic Map3p21.1-p14.2UniSTS
Cytogenetic Map12q22-q23.1UniSTS
Cytogenetic Map6p22.1UniSTS
Cytogenetic Map6q24.2UniSTS
Cytogenetic Map9p13.3UniSTS
Cytogenetic Map6p24.1UniSTS
Cytogenetic Map19q13UniSTS
Cytogenetic Map20q11.22-q11.23UniSTS
Cytogenetic Map3p22.3UniSTS
Cytogenetic Map12q12UniSTS
Cytogenetic MapXq13-q21UniSTS
Cytogenetic Map9q34.11UniSTS
Cytogenetic Map16p13.13UniSTS
Cytogenetic Map10pter-q25.3UniSTS
Cytogenetic Map9p24.1UniSTS
Cytogenetic Map12p13.2UniSTS
Cytogenetic Map12q24UniSTS
Cytogenetic Map3q28-q29UniSTS
Cytogenetic Map10q26UniSTS
Cytogenetic Map6p22.2UniSTS
Cytogenetic Map2q13UniSTS
Cytogenetic Map12q24.2-q24.31UniSTS
Cytogenetic Map22q12.2UniSTS
Cytogenetic Map1q32.2-q41UniSTS
Cytogenetic Map11q22-q23UniSTS
Cytogenetic Map12p13.3UniSTS
Cytogenetic Map1p34.1UniSTS
Cytogenetic Map22q11UniSTS
Cytogenetic Map2q21.1UniSTS
Cytogenetic Map16p13.11UniSTS
Cytogenetic Map1q25.1UniSTS
Cytogenetic Map1p36.3UniSTS
Cytogenetic Map9p21UniSTS
Cytogenetic Map6p21.3UniSTS
Cytogenetic Map1q41UniSTS
Cytogenetic Map11q13.1-q13.3UniSTS
Cytogenetic Map16p13UniSTS
Cytogenetic Map15q26UniSTS
Cytogenetic Map18q21UniSTS
Cytogenetic Map4p15.1-p14UniSTS
Cytogenetic Map8q11.2UniSTS
Cytogenetic Map16q22UniSTS
Cytogenetic Map15q11-q13UniSTS
Cytogenetic Map7p12.3UniSTS
Cytogenetic Map7p13UniSTS
Cytogenetic Map15q26.1UniSTS
Cytogenetic Map14q22.1UniSTS
Cytogenetic Map2q12.3UniSTS
Cytogenetic MapXp22.12UniSTS
Cytogenetic Map20q11.23UniSTS
Cytogenetic Map1q21.1UniSTS
Cytogenetic Map1p36.31UniSTS
Cytogenetic Map16q11.2UniSTS
Cytogenetic Map14q32.2UniSTS
Cytogenetic Map11p15.4UniSTS
Cytogenetic Map22q11.1UniSTS
Cytogenetic Map5q33.2UniSTS
Cytogenetic Map14q23.1UniSTS
Cytogenetic Map7q32.3UniSTS
Cytogenetic Map20q13.3UniSTS
Cytogenetic Map10q26.13UniSTS
Cytogenetic Map1p31.1UniSTS
Cytogenetic Map11q13.4UniSTS
Cytogenetic Map11q23.3UniSTS
Cytogenetic Map15q25.1UniSTS
Cytogenetic Map9p13UniSTS
Cytogenetic Map2p24.2UniSTS
Cytogenetic Map9q33.3UniSTS
Cytogenetic Map19q13.31UniSTS
Cytogenetic Map11q12.2UniSTS
Cytogenetic Map7p15.3UniSTS
Cytogenetic Map6p25.2UniSTS
Cytogenetic Map6q25.1UniSTS
Cytogenetic Map3p21.31UniSTS
Cytogenetic Map17q23.2UniSTS
Cytogenetic MapXq25UniSTS
Cytogenetic Map2p25.1UniSTS
Cytogenetic Map1q25.3UniSTS
Cytogenetic Map6p24-p22.3UniSTS
Cytogenetic Map6q21UniSTS
Cytogenetic Map16p12.2UniSTS
Cytogenetic Map3q21-q24UniSTS
Cytogenetic Map4q13UniSTS
Cytogenetic Map11p13UniSTS
Cytogenetic Map9q34UniSTS
Cytogenetic Map8q13.1UniSTS
Cytogenetic Map5q21.2UniSTS
Cytogenetic Map4q34.3UniSTS
Cytogenetic Map3p22.1UniSTS
Cytogenetic Map2q37.3UniSTS
Cytogenetic Map8p23.1UniSTS
Cytogenetic Map1p13.3UniSTS
Cytogenetic Map15q14UniSTS
Cytogenetic Map13q13.3UniSTS
Cytogenetic Map12q13.2UniSTS
Cytogenetic Map1q31UniSTS
Cytogenetic Map7q11.21UniSTS
Cytogenetic Map10q26.3UniSTS
Cytogenetic Map15q15UniSTS
Cytogenetic MapXp11.4UniSTS
Cytogenetic Map8q24.12UniSTS
Cytogenetic Map15q22UniSTS
Cytogenetic Map1q25.2UniSTS
Cytogenetic Map13q11-q12UniSTS
Cytogenetic Map10q24.2UniSTS
Cytogenetic Map15q21.1UniSTS
Cytogenetic Map15q13.2UniSTS
Cytogenetic Map6q25.2UniSTS
Cytogenetic Map14q11.2UniSTS
Cytogenetic Map2q33.1UniSTS
Cytogenetic Map6q14.1UniSTS
Cytogenetic Map3q23-q24UniSTS
Cytogenetic Map2p25.1-p24.1UniSTS
Cytogenetic Map12q14.3UniSTS
Cytogenetic Map6q16.1UniSTS
Cytogenetic Map5p13.1UniSTS
Cytogenetic Map5q13UniSTS
Cytogenetic Map20pter-p12UniSTS
Cytogenetic MapXp22.11UniSTS
Cytogenetic Map16p13.2UniSTS
Cytogenetic Map16q22.3UniSTS
Cytogenetic Map7q31.3UniSTS
Cytogenetic Map21q22.13UniSTS
Cytogenetic Map1p21UniSTS
Cytogenetic Map8p11UniSTS
Cytogenetic Map7p14.2UniSTS
Cytogenetic Map8p11.23UniSTS
Cytogenetic Map18p11.22UniSTS
Cytogenetic Map18q21.33UniSTS
Cytogenetic Map9p24.3UniSTS
Cytogenetic Map11q22.3UniSTS
Cytogenetic Map14q22.2UniSTS
Cytogenetic Map20p11.22-p11.1UniSTS
Cytogenetic Map6p21.31UniSTS
Cytogenetic Map14q22.3UniSTS
Cytogenetic Map12q15UniSTS
Cytogenetic Map7q31UniSTS
Cytogenetic Map2q12.2UniSTS
Cytogenetic Map8p12UniSTS
Cytogenetic Map7p22.1UniSTS
Cytogenetic Map6p12.3UniSTS
Cytogenetic Map11q12-q13UniSTS
Cytogenetic Map18q21.1UniSTS
Cytogenetic Map10p11.21UniSTS
Cytogenetic Map6p22-p21UniSTS
Cytogenetic Map17q21.1-q21.3UniSTS
Cytogenetic Map12q24.33UniSTS
Cytogenetic Map4p15.32UniSTS
Cytogenetic Map1q42.13UniSTS
Cytogenetic Map19q12UniSTS
Cytogenetic Map3p14.3UniSTS
Cytogenetic Map12p13.2-p12.3UniSTS
Cytogenetic Map9q22.32UniSTS
Cytogenetic Map1p36.3-p36.2UniSTS
Cytogenetic Map5q22.2UniSTS
Cytogenetic Map4p15.2UniSTS
Cytogenetic Map4p15.3UniSTS
Cytogenetic Map4q28.1UniSTS
Cytogenetic Map12q13.1-q13.2UniSTS
Cytogenetic Map19q13.33UniSTS
Cytogenetic Map1p31UniSTS
Cytogenetic Map17p13.2UniSTS
Cytogenetic Map15q15.3UniSTS
Cytogenetic Map13q14.11UniSTS
Cytogenetic Map9p22.3UniSTS
Cytogenetic Map8q22.2UniSTS
Cytogenetic Map8q21.11UniSTS
Cytogenetic Map22q12.1UniSTS
Cytogenetic Map3q13.2UniSTS
Cytogenetic Map2q35UniSTS
Cytogenetic Map2q33.3UniSTS
Cytogenetic Map8p22UniSTS
Cytogenetic Map10q22.2UniSTS
Cytogenetic Map20p12.1UniSTS
Cytogenetic Map6q13UniSTS
Cytogenetic Map6q22.32UniSTS
Cytogenetic Map5q34UniSTS
Cytogenetic Map5p15.2UniSTS
Cytogenetic Map5q11.2UniSTS
Cytogenetic Map2q36.1UniSTS
Cytogenetic Map18q11.2UniSTS
Cytogenetic Map18q12.2UniSTS
Cytogenetic Map14q21.3UniSTS
Cytogenetic Map13q33.1UniSTS
Cytogenetic Map12p11.21UniSTS
Cytogenetic Map12q23.1UniSTS
Cytogenetic Map16p12.1UniSTS
Cytogenetic Map2q33UniSTS
Cytogenetic Map5q12.1UniSTS
Cytogenetic Map12q24.13UniSTS
Cytogenetic Map13q14.2UniSTS
Cytogenetic Map7q36UniSTS
Cytogenetic Map10q22.3-q23.2UniSTS
Cytogenetic Map7p15UniSTS
Cytogenetic Map14q32.31UniSTS
Cytogenetic Map11q21UniSTS
Cytogenetic Map4q21.3UniSTS
Cytogenetic Map7p13-p12UniSTS
Cytogenetic Map8p21.2UniSTS
Cytogenetic Map4q22UniSTS
Cytogenetic Map11q13UniSTS
Cytogenetic Map3q12.1UniSTS
Cytogenetic Map7q21.1-q22UniSTS
Cytogenetic Map17q21UniSTS
Cytogenetic Map3q13.13-q13.2UniSTS
Cytogenetic Map3p21.3UniSTS
Cytogenetic Map13q32.2UniSTS
Cytogenetic Map3q26.32UniSTS
Cytogenetic Map15qUniSTS
Cytogenetic Map2p13.2UniSTS
Cytogenetic Map3p12.3UniSTS
Cytogenetic Map10q11.23UniSTS
Cytogenetic Map3q11.2UniSTS
Cytogenetic Map12q13.11UniSTS
Cytogenetic Map13q14.13UniSTS
Cytogenetic Map10q23UniSTS
Cytogenetic Map11p11.2UniSTS
Cytogenetic Map6q16.2UniSTS
Cytogenetic Map3q21.1UniSTS
Cytogenetic Map10q11.21UniSTS
Cytogenetic Map1p13.2UniSTS
Cytogenetic Map6p24.2UniSTS
Cytogenetic Map20q13.33UniSTS
LDB3  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371088,439,220 - 88,439,870UniSTSGRCh37
Celera1082,441,998 - 82,442,648UniSTS
HuRef1082,293,472 - 82,294,122UniSTS
D11S3430  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map22q11.21UniSTS
Cytogenetic Map6q23.3UniSTS
Cytogenetic Map13q34UniSTS
Cytogenetic Map11q13UniSTS
Cytogenetic Map17p12-p11.2UniSTS
Cytogenetic MapXp22UniSTS
Cytogenetic Map6p25UniSTS
Cytogenetic Map21q21.2UniSTS
Cytogenetic Map7q21-q22UniSTS
Cytogenetic Map2q33.2UniSTS
Cytogenetic Map14q13.2UniSTS
Cytogenetic Map12q13.13UniSTS
Cytogenetic Map19q13.12UniSTS
Cytogenetic Map17q21.31UniSTS
Cytogenetic Map6q21UniSTS
Cytogenetic MapXq12UniSTS
Cytogenetic Map1p32.3UniSTS
Cytogenetic Map9q34UniSTS
Cytogenetic Map6q25UniSTS
Cytogenetic Map16p13.3UniSTS
Cytogenetic Map9p11.1UniSTS
Cytogenetic Map9q34.11UniSTS
Cytogenetic Map7q34UniSTS
Cytogenetic Map14q24.3UniSTS
Cytogenetic Map11p15.4UniSTS
Cytogenetic Map19q13.31UniSTS
Cytogenetic Map14q12UniSTS
Cytogenetic Map10q22.3-q23.2UniSTS
Cytogenetic Map8q24.3UniSTS

miRNA Target Status

Predicted Target Of
Summary Value
Count of predictions:9014
Count of miRNA genes:1111
Interacting mature miRNAs:1364
Transcripts:ENST00000263066, ENST00000310944, ENST00000352360, ENST00000361373, ENST00000372056, ENST00000372066, ENST00000429277, ENST00000458213, ENST00000477489, ENST00000542786
Prediction methods:Microtar, Miranda, Rnahybrid, Targetscan
Result types:miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.


Expression


RNA-SEQ Expression
High: > 1000 TPM value   Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM   Below Cutoff: < 0.5 TPM

alimentary part of gastrointestinal system circulatory system endocrine system exocrine system hemolymphoid system hepatobiliary system integumental system musculoskeletal system nervous system renal system reproductive system respiratory system sensory system visual system adipose tissue appendage entire extraembryonic component pharyngeal arch
High 75 77 75
Medium 1589 2214 120 26 70 2172 2026 904 7 444 198 28 437 1803
Low 685 126 1057 212 440 82 2012 52 2741 240 878 1237 132 767 910 2 2
Below cutoff 136 635 513 353 1291 350 95 36 69 166 128 169 14 1 2

Sequence

Nucleotide Sequences
RefSeq Transcripts NG_008876 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001080114 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001080115 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001080116 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001171610 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001171611 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001368063 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001368064 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001368065 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001368066 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001368067 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001368068 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_007078 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AA180065 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB014513 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC067750 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF086263 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF276807 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF276808 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF276809 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ133766 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ133767 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ133768 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK093184 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK294696 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK297871 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK300692 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK304760 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL601484 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC010929 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC023609 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471142 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DA762127 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DA898241 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DC357269 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  EF179181 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  F33274 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KF772970 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KU178543 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KU178544 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KU178545 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  MF547541 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  MF796215 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  MF796216 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  MF796228 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles

Reference Sequences
RefSeq Acc Id: ENST00000263066   ⟹   ENSP00000263066
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1086,668,692 - 86,734,995 (+)Ensembl
RefSeq Acc Id: ENST00000361373   ⟹   ENSP00000355296
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1086,668,671 - 86,736,068 (+)Ensembl
RefSeq Acc Id: ENST00000372056   ⟹   ENSP00000361126
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1086,668,692 - 86,700,045 (+)Ensembl
RefSeq Acc Id: ENST00000372066   ⟹   ENSP00000361136
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1086,668,613 - 86,700,041 (+)Ensembl
RefSeq Acc Id: ENST00000429277   ⟹   ENSP00000401437
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1086,668,449 - 86,736,068 (+)Ensembl
RefSeq Acc Id: ENST00000477489   ⟹   ENSP00000485538
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1086,718,730 - 86,726,451 (+)Ensembl
RefSeq Acc Id: ENST00000542786   ⟹   ENSP00000438866
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1086,668,692 - 86,700,043 (+)Ensembl
RefSeq Acc Id: ENST00000623007   ⟹   ENSP00000485389
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1086,668,692 - 86,700,045 (+)Ensembl
RefSeq Acc Id: ENST00000623056   ⟹   ENSP00000485500
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1086,668,507 - 86,733,001 (+)Ensembl
RefSeq Acc Id: NM_001080114   ⟹   NP_001073583
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,668,511 - 86,736,072 (+)NCBI
GRCh371088,426,542 - 88,495,829 (+)NCBI
Build 361088,418,406 - 88,485,805 (+)NCBI Archive
HuRef1082,282,449 - 82,350,075 (+)ENTREZGENE
CHM1_11088,710,079 - 88,777,554 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001080115   ⟹   NP_001073584
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,668,511 - 86,700,050 (+)NCBI
GRCh371088,426,542 - 88,495,829 (+)NCBI
Build 361088,418,406 - 88,449,790 (+)NCBI Archive
HuRef1082,282,449 - 82,350,075 (+)ENTREZGENE
CHM1_11088,710,079 - 88,741,459 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001080116   ⟹   NP_001073585
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,668,564 - 86,700,053 (+)NCBI
GRCh371088,426,542 - 88,495,829 (+)NCBI
Build 361088,418,301 - 88,449,790 (+)NCBI Archive
HuRef1082,282,449 - 82,350,075 (+)ENTREZGENE
CHM1_11088,709,974 - 88,741,459 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001171610   ⟹   NP_001165081
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,668,511 - 86,736,072 (+)NCBI
GRCh371088,426,542 - 88,495,829 (+)NCBI
HuRef1082,282,449 - 82,350,075 (+)ENTREZGENE
CHM1_11088,709,859 - 88,777,554 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001171611   ⟹   NP_001165082
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,668,511 - 86,700,050 (+)NCBI
GRCh371088,426,542 - 88,495,829 (+)NCBI
HuRef1082,282,449 - 82,350,075 (+)ENTREZGENE
CHM1_11088,710,079 - 88,741,459 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001368063   ⟹   NP_001354992
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,666,788 - 86,700,050 (+)NCBI
RefSeq Acc Id: NM_001368064   ⟹   NP_001354993
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,666,788 - 86,736,072 (+)NCBI
RefSeq Acc Id: NM_001368065   ⟹   NP_001354994
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,668,511 - 86,736,072 (+)NCBI
RefSeq Acc Id: NM_001368066   ⟹   NP_001354995
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,668,511 - 86,736,072 (+)NCBI
RefSeq Acc Id: NM_001368067   ⟹   NP_001354996
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,668,511 - 86,700,050 (+)NCBI
RefSeq Acc Id: NM_001368068   ⟹   NP_001354997
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,666,788 - 86,700,050 (+)NCBI
RefSeq Acc Id: NM_007078   ⟹   NP_009009
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,668,511 - 86,736,072 (+)NCBI
GRCh371088,426,542 - 88,495,829 (+)NCBI
Build 361088,418,406 - 88,485,805 (+)NCBI Archive
HuRef1082,282,449 - 82,350,075 (+)ENTREZGENE
CHM1_11088,710,079 - 88,777,554 (+)NCBI
Sequence:
Protein Sequences
Protein RefSeqs NP_001073583 (Get FASTA)   NCBI Sequence Viewer  
  NP_001073584 (Get FASTA)   NCBI Sequence Viewer  
  NP_001073585 (Get FASTA)   NCBI Sequence Viewer  
  NP_001165081 (Get FASTA)   NCBI Sequence Viewer  
  NP_001165082 (Get FASTA)   NCBI Sequence Viewer  
  NP_001354992 (Get FASTA)   NCBI Sequence Viewer  
  NP_001354993 (Get FASTA)   NCBI Sequence Viewer  
  NP_001354994 (Get FASTA)   NCBI Sequence Viewer  
  NP_001354995 (Get FASTA)   NCBI Sequence Viewer  
  NP_001354996 (Get FASTA)   NCBI Sequence Viewer  
  NP_001354997 (Get FASTA)   NCBI Sequence Viewer  
  NP_009009 (Get FASTA)   NCBI Sequence Viewer  
GenBank Protein AAH10929 (Get FASTA)   NCBI Sequence Viewer  
  AAQ14316 (Get FASTA)   NCBI Sequence Viewer  
  AAQ14317 (Get FASTA)   NCBI Sequence Viewer  
  AAQ14318 (Get FASTA)   NCBI Sequence Viewer  
  ABN05284 (Get FASTA)   NCBI Sequence Viewer  
  AHB60054 (Get FASTA)   NCBI Sequence Viewer  
  ALQ34001 (Get FASTA)   NCBI Sequence Viewer  
  ALQ34002 (Get FASTA)   NCBI Sequence Viewer  
  ALQ34003 (Get FASTA)   NCBI Sequence Viewer  
  AXU40267 (Get FASTA)   NCBI Sequence Viewer  
  AXU41060 (Get FASTA)   NCBI Sequence Viewer  
  AXU41061 (Get FASTA)   NCBI Sequence Viewer  
  AXU41072 (Get FASTA)   NCBI Sequence Viewer  
  BAA31588 (Get FASTA)   NCBI Sequence Viewer  
  BAG57855 (Get FASTA)   NCBI Sequence Viewer  
  BAG60197 (Get FASTA)   NCBI Sequence Viewer  
  BAG62375 (Get FASTA)   NCBI Sequence Viewer  
  BAG65515 (Get FASTA)   NCBI Sequence Viewer  
  CAB46727 (Get FASTA)   NCBI Sequence Viewer  
  CAB46728 (Get FASTA)   NCBI Sequence Viewer  
  CAB46729 (Get FASTA)   NCBI Sequence Viewer  
  EAW80322 (Get FASTA)   NCBI Sequence Viewer  
  EAW80323 (Get FASTA)   NCBI Sequence Viewer  
  EAW80324 (Get FASTA)   NCBI Sequence Viewer  
  EAW80325 (Get FASTA)   NCBI Sequence Viewer  
  EAW80326 (Get FASTA)   NCBI Sequence Viewer  
  EAW80327 (Get FASTA)   NCBI Sequence Viewer  
  EAW80328 (Get FASTA)   NCBI Sequence Viewer  
  EAW80329 (Get FASTA)   NCBI Sequence Viewer  
  O75112 (Get FASTA)   NCBI Sequence Viewer  
Reference Sequences
RefSeq Acc Id: NP_001165081   ⟸   NM_001171610
- Peptide Label: isoform 5
- UniProtKB: O75112 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: NP_001073585   ⟸   NM_001080116
- Peptide Label: isoform 4
- UniProtKB: O75112 (UniProtKB/Swiss-Prot),   A0A0S2Z530 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: NP_009009   ⟸   NM_007078
- Peptide Label: isoform 1
- UniProtKB: O75112 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: NP_001073583   ⟸   NM_001080114
- Peptide Label: isoform 2
- UniProtKB: O75112 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: NP_001165082   ⟸   NM_001171611
- Peptide Label: isoform 6
- UniProtKB: O75112 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: NP_001073584   ⟸   NM_001080115
- Peptide Label: isoform 3
- UniProtKB: O75112 (UniProtKB/Swiss-Prot),   A0A0S2Z501 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: NP_001354993   ⟸   NM_001368064
- Peptide Label: isoform 7
RefSeq Acc Id: NP_001354992   ⟸   NM_001368063
- Peptide Label: isoform 3
RefSeq Acc Id: NP_001354997   ⟸   NM_001368068
- Peptide Label: isoform 4
RefSeq Acc Id: NP_001354994   ⟸   NM_001368065
- Peptide Label: isoform 7
RefSeq Acc Id: NP_001354995   ⟸   NM_001368066
- Peptide Label: isoform 8
RefSeq Acc Id: NP_001354996   ⟸   NM_001368067
- Peptide Label: isoform 4
RefSeq Acc Id: ENSP00000485538   ⟸   ENST00000477489
RefSeq Acc Id: ENSP00000438866   ⟸   ENST00000542786
RefSeq Acc Id: ENSP00000361136   ⟸   ENST00000372066
RefSeq Acc Id: ENSP00000361126   ⟸   ENST00000372056
RefSeq Acc Id: ENSP00000485389   ⟸   ENST00000623007
RefSeq Acc Id: ENSP00000485500   ⟸   ENST00000623056
RefSeq Acc Id: ENSP00000355296   ⟸   ENST00000361373
RefSeq Acc Id: ENSP00000401437   ⟸   ENST00000429277
RefSeq Acc Id: ENSP00000263066   ⟸   ENST00000263066
Protein Domains
LIM zinc-binding   PDZ

Promoters
RGD ID:7218019
Promoter ID:EPDNEW_H14755
Type:multiple initiation site
Name:LDB3_2
Description:LIM domain binding 3
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Alternative Promoters:null; see alsoEPDNEW_H14756  
Experiment Methods:Single-end sequencing.; Paired-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,666,792 - 86,666,852EPDNEW
RGD ID:7218021
Promoter ID:EPDNEW_H14756
Type:initiation region
Name:LDB3_1
Description:LIM domain binding 3
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Alternative Promoters:null; see alsoEPDNEW_H14755  
Experiment Methods:Single-end sequencing.; Paired-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh381086,668,511 - 86,668,571EPDNEW
RGD ID:6787595
Promoter ID:HG_KWN:10388
Type:Non-CpG
SO ACC ID:SO:0000170
Source:MPROMDB
Tissues & Cell Lines:HeLa_S3,   NB4
Transcripts:ENST00000310944,   ENST00000352360,   NM_001080116,   NM_001171610,   OTTHUMT00000049163,   UC001KDS.1,   UC001KDT.1,   UC001KDU.1,   UC001KDV.1,   UC009XSY.1,   UC009XSZ.1
Position:
Human AssemblyChrPosition (strand)Source
Build 361088,417,874 - 88,418,374 (+)MPROMDB

Clinical Variants
Name Type Condition(s) Position(s) Clinical significance
NM_007078.3(LDB3):c.690-4627G>A single nucleotide variant not provided [RCV000521351] Chr10:86687269 [GRCh38]
Chr10:88447026 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.2073C>T (p.His691=) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000546877] Chr10:86726231 [GRCh38]
Chr10:88485988 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.718G>A (p.Asp240Asn) single nucleotide variant Dilated cardiomyopathy 1C [RCV001293337] Chr10:86691924 [GRCh38]
Chr10:88451681 [GRCh37]
Chr10:10q23.2
likely pathogenic
NM_007078.3(LDB3):c.2146C>T (p.Pro716Ser) single nucleotide variant Dilated cardiomyopathy 1C [RCV001293344] Chr10:86732938 [GRCh38]
Chr10:88492695 [GRCh37]
Chr10:10q23.2
pathogenic
NM_007078.3(LDB3):c.896+11G>A single nucleotide variant Dilated cardiomyopathy 1C [RCV001293349] Chr10:86692582 [GRCh38]
Chr10:88452339 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.782A>C (p.Asp261Ala) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000550202] Chr10:86691988 [GRCh38]
Chr10:88451745 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1421C>T (p.Ser474Leu) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000552036] Chr10:86716516 [GRCh38]
Chr10:88476273 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1121C>T (p.Ala374Val) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000527115] Chr10:86709940 [GRCh38]
Chr10:88469697 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) single nucleotide variant Cardiomyopathy [RCV000769285]|Cardiovascular phenotype [RCV000618275]|Dilated cardiomyopathy 1A [RCV001256803]|Hypertrophic cardiomyopathy [RCV000853422]|Myofibrillar myopathy, ZASP-related [RCV001081104]|Primary dilated cardiomyopathy [RCV000030617]|not provided [RCV000656853]|not specified [RCV000038717] Chr10:86706685 [GRCh38]
Chr10:88466442 [GRCh37]
Chr10:10q23.2
likely pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_007078.3(LDB3):c.690-4732C>T single nucleotide variant Cardiomyopathy [RCV000769277]|Myofibrillar myopathy, ZASP-related [RCV000033938] Chr10:86687164 [GRCh38]
Chr10:88446921 [GRCh37]
Chr10:10q23.2
pathogenic|uncertain significance
NM_007078.3(LDB3):c.1041C>A (p.Ser347=) single nucleotide variant Cardiomyopathy [RCV000030114]|Cardiovascular phenotype [RCV000620203]|Dilated cardiomyopathy 1C [RCV001293332]|Myofibrillar myopathy, ZASP-related [RCV000456667]|not specified [RCV000038715] Chr10:86706675 [GRCh38]
Chr10:88466432 [GRCh37]
Chr10:10q23.2
benign|uncertain significance
NM_007078.3(LDB3):c.1074C>T (p.Ala358=) single nucleotide variant Cardiomyopathy [RCV000030115]|Cardiovascular phenotype [RCV000618888]|Dilated cardiomyopathy 1C [RCV001293333]|Myofibrillar myopathy, ZASP-related [RCV000457081]|not provided [RCV000712209]|not specified [RCV000038718] Chr10:86706708 [GRCh38]
Chr10:88466465 [GRCh37]
Chr10:10q23.2
benign|uncertain significance
NM_007078.3(LDB3):c.1422G>A (p.Ser474=) single nucleotide variant Cardiomyopathy [RCV001170177]|Cardiovascular phenotype [RCV000619945]|Myofibrillar myopathy, ZASP-related [RCV000231484]|not provided [RCV000860874]|not specified [RCV000038726] Chr10:86716517 [GRCh38]
Chr10:88476274 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.1903G>A (p.Val635Ile) single nucleotide variant Cardiomyopathy [RCV000030117]|Cardiovascular phenotype [RCV000621020]|Myofibrillar myopathy, ZASP-related [RCV000471539]|none provided [RCV001282603]|not specified [RCV000038744] Chr10:86718772 [GRCh38]
Chr10:88478529 [GRCh37]
Chr10:10q23.2
benign|likely benign
NM_007078.3(LDB3):c.2092G>A (p.Ala698Thr) single nucleotide variant Cardiomyopathy [RCV000770300]|Cardiovascular phenotype [RCV000617552]|Myofibrillar myopathy, ZASP-related [RCV000463936]|Primary dilated cardiomyopathy [RCV000030118]|not provided [RCV000767131]|not specified [RCV000038750] Chr10:86726250 [GRCh38]
Chr10:88486007 [GRCh37]
Chr10:10q23.2
likely pathogenic|likely benign|uncertain significance
NM_007078.3(LDB3):c.302C>T (p.Pro101Leu) single nucleotide variant Cardiomyopathy [RCV000030119]|Cardiomyopathy, left ventricular noncompaction [RCV000338341]|Cardiovascular phenotype [RCV000621945]|Dilated Cardiomyopathy, Dominant [RCV000396844]|Myofibrillar Myopathy, Dominant [RCV000396879]|Myofibrillar myopathy, ZASP-related [RCV000229889]|none provided [RCV001282731]|not specified [RCV000038754] Chr10:86680138 [GRCh38]
Chr10:88439895 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.690-4A>G single nucleotide variant Cardiomyopathy [RCV000030120]|Cardiomyopathy, left ventricular noncompaction [RCV000347861]|Cardiovascular phenotype [RCV000619569]|Dilated Cardiomyopathy, Dominant [RCV000288174]|Myofibrillar Myopathy, Dominant [RCV000393351]|Myofibrillar myopathy, ZASP-related [RCV000405139]|none provided [RCV001285140]|not specified [RCV000154455] Chr10:86691892 [GRCh38]
Chr10:88451649 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_007078.3(LDB3):c.752A>G (p.Lys251Arg) single nucleotide variant Cardiomyopathy [RCV000030121]|Cardiomyopathy, left ventricular noncompaction [RCV000354520]|Cardiovascular phenotype [RCV000618811]|Dilated Cardiomyopathy, Dominant [RCV000259558]|Dilated cardiomyopathy 1C [RCV001293338]|Myofibrillar Myopathy, Dominant [RCV000319367]|Myofibrillar myopathy, ZASP-related [RCV000205724]|none provided [RCV001282923]|not provided [RCV000513959]|not specified [RCV000038768] Chr10:86691958 [GRCh38]
Chr10:88451715 [GRCh37]
Chr10:10q23.2
likely pathogenic|benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.690-4733G>A single nucleotide variant Cardiomyopathy [RCV000770149]|Myofibrillar myopathy, ZASP-related [RCV000004992]|not provided [RCV000255980] Chr10:86687163 [GRCh38]
Chr10:88446920 [GRCh37]
Chr10:10q23.2
pathogenic|uncertain significance
NM_007078.3(LDB3):c.690-4678C>T single nucleotide variant Cardiomyopathy [RCV000769278]|Myofibrillar myopathy [RCV000239669]|Myofibrillar myopathy, ZASP-related [RCV000004993]|Neuromuscular disease [RCV000036847]|not provided [RCV000493600] Chr10:86687218 [GRCh38]
Chr10:88446975 [GRCh37]
Chr10:10q23.2
pathogenic|uncertain significance
NM_007078.3(LDB3):c.896+6753C>T single nucleotide variant Cardiomyopathy [RCV000769280]|Cardiovascular phenotype [RCV000620537]|Dilated cardiomyopathy 1C [RCV000770982]|Myofibrillar myopathy, ZASP-related [RCV000004994]|Primary familial dilated cardiomyopathy [RCV000845475]|not specified [RCV000154745] Chr10:86699324 [GRCh38]
Chr10:88459081 [GRCh37]
Chr10:10q23.2
pathogenic|uncertain significance
NM_007078.3(LDB3):c.1035C>G (p.Ile345Met) single nucleotide variant Dilated cardiomyopathy 1C [RCV000004995] Chr10:86706669 [GRCh38]
Chr10:88466426 [GRCh37]
Chr10:10q23.2
pathogenic
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) single nucleotide variant Cardiovascular phenotype [RCV000618756]|Dilated cardiomyopathy 1A [RCV001256801]|Dilated cardiomyopathy 1C [RCV000004996]|Familial hypertrophic cardiomyopathy 24 [RCV000170300]|Myofibrillar myopathy, ZASP-related [RCV000234541]|none provided [RCV001286422]|not provided [RCV000172555]|not specified [RCV000038759] Chr10:86681680 [GRCh38]
Chr10:88441437 [GRCh37]
Chr10:10q23.2
pathogenic|benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided
NM_007078.3(LDB3):c.617C>T (p.Thr206Ile) single nucleotide variant Dilated cardiomyopathy 1C [RCV000004997] Chr10:86681731 [GRCh38]
Chr10:88441488 [GRCh37]
Chr10:10q23.2
pathogenic
NM_007078.3(LDB3):c.690-4823G>A single nucleotide variant Cardiovascular phenotype [RCV000618022]|Dilated cardiomyopathy 1C [RCV000004998]|Myofibrillar myopathy, ZASP-related [RCV000234167]|Primary dilated cardiomyopathy [RCV000172755]|none provided [RCV001285152]|not provided [RCV000224167]|not specified [RCV000036845] Chr10:86687073 [GRCh38]
Chr10:88446830 [GRCh37]
Chr10:10q23.2
pathogenic|benign|likely benign|uncertain significance
NM_007078.3(LDB3):c.690-4789A>T single nucleotide variant Cardiomyopathy [RCV000770148]|Dilated cardiomyopathy 1C [RCV000004999] Chr10:86687107 [GRCh38]
Chr10:88446864 [GRCh37]
Chr10:10q23.2
pathogenic|uncertain significance
NM_007078.3(LDB3):c.2017G>A (p.Asp673Asn) single nucleotide variant Dilated cardiomyopathy 1C [RCV000005000]|Left ventricular noncompaction 3 [RCV000005001]|Myofibrillar myopathy, ZASP-related [RCV000639879]|not provided [RCV000414354] Chr10:86726175 [GRCh38]
Chr10:88485932 [GRCh37]
Chr10:10q23.2
pathogenic|uncertain significance
NM_007078.3(LDB3):c.689+3877G>A single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000639868] Chr10:86685680 [GRCh38]
Chr10:88445437 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.896+6768G>A single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000639871] Chr10:86699339 [GRCh38]
Chr10:88459096 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.690-4653G>A single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000525293] Chr10:86687243 [GRCh38]
Chr10:88447000 [GRCh37]
Chr10:10q23.2
benign
NM_007078.3(LDB3):c.689+3899T>C single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000543839] Chr10:86685702 [GRCh38]
Chr10:88445459 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.79C>T (p.Leu27Phe) single nucleotide variant not provided [RCV000521458] Chr10:86668770 [GRCh38]
Chr10:88428527 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.529del (p.Ala177fs) deletion Myofibrillar myopathy, ZASP-related [RCV000559443] Chr10:86681639 [GRCh38]
Chr10:88441396 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.690-4705C>T single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000549451] Chr10:86687191 [GRCh38]
Chr10:88446948 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1150T>A (p.Tyr384Asn) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000547959] Chr10:86709969 [GRCh38]
Chr10:88469726 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1675C>T (p.Arg559Trp) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000545064]|not provided [RCV001091336] Chr10:86716770 [GRCh38]
Chr10:88476527 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.560C>T (p.Pro187Leu) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000542903] Chr10:86681674 [GRCh38]
Chr10:88441431 [GRCh37]
Chr10:10q23.2
benign
NM_007078.3(LDB3):c.*13G>T single nucleotide variant not specified [RCV000038713] Chr10:86732989 [GRCh38]
Chr10:88492746 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1014A>G (p.Thr338=) single nucleotide variant Cardiomyopathy [RCV000769283]|Cardiovascular phenotype [RCV000620086]|Myofibrillar myopathy, ZASP-related [RCV001085854]|not provided [RCV000712208]|not specified [RCV000038714] Chr10:86706648 [GRCh38]
Chr10:88466405 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.1041C>T (p.Ser347=) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV001439816]|not provided [RCV000827129]|not specified [RCV000038716] Chr10:86706675 [GRCh38]
Chr10:88466432 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.1111G>A (p.Ala371Thr) single nucleotide variant Cardiomyopathy [RCV000769287]|Cardiovascular phenotype [RCV000619589]|Myofibrillar myopathy, ZASP-related [RCV001079419]|not provided [RCV000172556]|not specified [RCV000038719] Chr10:86709930 [GRCh38]
Chr10:88469687 [GRCh37]
Chr10:10q23.2
likely benign|uncertain significance
NM_007078.3(LDB3):c.1263G>A (p.Gly421=) single nucleotide variant Cardiovascular phenotype [RCV000621718]|Myofibrillar myopathy, ZASP-related [RCV000226780]|none provided [RCV001285116]|not specified [RCV000038720] Chr10:86716358 [GRCh38]
Chr10:88476115 [GRCh37]
Chr10:10q23.2
benign
NM_007078.3(LDB3):c.1317C>T (p.Pro439=) single nucleotide variant not specified [RCV000038721] Chr10:86716412 [GRCh38]
Chr10:88476169 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1]) microsatellite Myofibrillar myopathy, ZASP-related [RCV000474477]|not provided [RCV000786342]|not specified [RCV000038722] Chr10:86716378..86716401 [GRCh38]
Chr10:88476135..88476158 [GRCh37]
Chr10:10q23.2
conflicting interpretations of pathogenicity|uncertain significance
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[3] (p.434APAYTPSP[3]) microsatellite Myofibrillar myopathy, ZASP-related [RCV000639865]|not specified [RCV000038723] Chr10:86716377..86716378 [GRCh38]
Chr10:88476134..88476135 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1339C>G (p.Pro447Ala) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000811808]|not specified [RCV000038724] Chr10:86716434 [GRCh38]
Chr10:88476191 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.139G>A (p.Asp47Asn) single nucleotide variant Cardiomyopathy [RCV001171119]|Myofibrillar myopathy, ZASP-related [RCV000811533]|not specified [RCV000038725] Chr10:86679412 [GRCh38]
Chr10:88439169 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.144C>T (p.Leu48=) single nucleotide variant not provided [RCV000869600]|not specified [RCV000038727] Chr10:86679417 [GRCh38]
Chr10:88439174 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.1453G>T (p.Ala485Ser) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000794637]|not specified [RCV000038728] Chr10:86716548 [GRCh38]
Chr10:88476305 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1460G>A (p.Arg487His) single nucleotide variant Cardiovascular phenotype [RCV000619942]|Myofibrillar myopathy, ZASP-related [RCV001085776]|Primary dilated cardiomyopathy [RCV000852621]|not provided [RCV000126608]|not specified [RCV000038729] Chr10:86716555 [GRCh38]
Chr10:88476312 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.1471G>T (p.Val491Leu) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV001369095]|not specified [RCV000038730] Chr10:86716566 [GRCh38]
Chr10:88476323 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1472T>A (p.Val491Glu) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV001345111]|not provided [RCV000171996]|not specified [RCV000038731] Chr10:86716567 [GRCh38]
Chr10:88476324 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1475C>T (p.Thr492Ile) single nucleotide variant not specified [RCV000038732] Chr10:86716570 [GRCh38]
Chr10:88476327 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.147G>A (p.Val49=) single nucleotide variant Cardiomyopathy [RCV000770136]|Cardiovascular phenotype [RCV000620196]|Myofibrillar myopathy, ZASP-related [RCV001079909]|not provided [RCV000845347]|not specified [RCV000038733] Chr10:86679420 [GRCh38]
Chr10:88439177 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.1503C>T (p.Ala501=) single nucleotide variant Cardiovascular phenotype [RCV000622047]|not specified [RCV000038734] Chr10:86716598 [GRCh38]
Chr10:88476355 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.1506G>A (p.Pro502=) single nucleotide variant Cardiomyopathy [RCV000769288]|Cardiovascular phenotype [RCV000620864]|Myofibrillar myopathy, ZASP-related [RCV000477463]|none provided [RCV001281884]|not specified [RCV000038735] Chr10:86716601 [GRCh38]
Chr10:88476358 [GRCh37]
Chr10:10q23.2
benign
NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) single nucleotide variant Cardiomyopathy [RCV001170178]|Cardiovascular phenotype [RCV000619692]|Dilated cardiomyopathy 1C [RCV001293341]|Myofibrillar myopathy, ZASP-related [RCV000988403]|Primary familial dilated cardiomyopathy [RCV000623075]|not provided [RCV000171997]|not specified [RCV000038736] Chr10:86716630 [GRCh38]
Chr10:88476387 [GRCh37]
Chr10:10q23.2
pathogenic|benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_007078.3(LDB3):c.1572G>A (p.Ala524=) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000639885]|not specified [RCV000038737] Chr10:86716667 [GRCh38]
Chr10:88476424 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.1586C>G (p.Pro529Arg) single nucleotide variant not specified [RCV000038738] Chr10:86716681 [GRCh38]
Chr10:88476438 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.163G>A (p.Val55Ile) single nucleotide variant Cardiomyopathy [RCV000770137]|Cardiovascular phenotype [RCV000620161]|Dilated Cardiomyopathy, Dominant [RCV000382414]|Dilated cardiomyopathy 1C [RCV000348704]|Myofibrillar Myopathy, Dominant [RCV000295142]|Myofibrillar myopathy, ZASP-related [RCV000344271]|not provided [RCV000712210]|not specified [RCV000038739] Chr10:86679436 [GRCh38]
Chr10:88439193 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.1653C>T (p.Cys551=) single nucleotide variant Cardiomyopathy [RCV000770297]|Cardiovascular phenotype [RCV000619334]|Myofibrillar myopathy, ZASP-related [RCV000463163]|not specified [RCV000038740] Chr10:86716748 [GRCh38]
Chr10:88476505 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.1672A>G (p.Ile558Val) single nucleotide variant Arrhythmogenic right ventricular cardiomyopathy [RCV000852622]|Cardiomyopathy [RCV001170179]|Myofibrillar myopathy, ZASP-related [RCV000988404]|not provided [RCV000171998]|not specified [RCV000038741] Chr10:86716767 [GRCh38]
Chr10:88476524 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_007078.3(LDB3):c.1823C>T (p.Pro608Leu) single nucleotide variant Familial hypertrophic cardiomyopathy 24 [RCV000170304]|Myofibrillar myopathy, ZASP-related [RCV000558390]|not provided [RCV000767179]|not specified [RCV000038742] Chr10:86718110 [GRCh38]
Chr10:88477867 [GRCh37]
Chr10:10q23.2
pathogenic|uncertain significance
NM_007078.3(LDB3):c.1858-10T>C single nucleotide variant not specified [RCV000038743] Chr10:86718717 [GRCh38]
Chr10:88478474 [GRCh37]
Chr10:10q23.2
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_007078.3(LDB3):c.1907G>A (p.Cys636Tyr) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000814258]|not specified [RCV000038745] Chr10:86718776 [GRCh38]
Chr10:88478533 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) single nucleotide variant Cardiovascular phenotype [RCV000619404]|Myofibrillar myopathy, ZASP-related [RCV000685509]|not provided [RCV000767130]|not specified [RCV000038746] Chr10:86718779 [GRCh38]
Chr10:88478536 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1971C>T (p.Cys657=) single nucleotide variant Cardiovascular phenotype [RCV000618465]|Myofibrillar myopathy, ZASP-related [RCV000233347]|not provided [RCV000867236]|not specified [RCV000038747] Chr10:86718840 [GRCh38]
Chr10:88478597 [GRCh37]
Chr10:10q23.2
likely benign|uncertain significance
NM_007078.3(LDB3):c.2016C>T (p.Cys672=) single nucleotide variant Cardiovascular phenotype [RCV000619718]|Myofibrillar myopathy, ZASP-related [RCV001081462]|none provided [RCV001286144]|not provided [RCV000590797]|not specified [RCV000038748] Chr10:86726174 [GRCh38]
Chr10:88485931 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.2078C>A (p.Thr693Asn) single nucleotide variant not specified [RCV000038749] Chr10:86726236 [GRCh38]
Chr10:88485993 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.2155A>G (p.Lys719Glu) single nucleotide variant not specified [RCV000038751] Chr10:86732947 [GRCh38]
Chr10:88492704 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.236C>G (p.Thr79Ser) single nucleotide variant not specified [RCV000038752] Chr10:86679509 [GRCh38]
Chr10:88439266 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.273G>A (p.Thr91=) single nucleotide variant Cardiovascular phenotype [RCV000618355]|Dilated cardiomyopathy 1C [RCV001293329]|Myofibrillar myopathy, ZASP-related [RCV001084139]|not provided [RCV000845362]|not specified [RCV000038753] Chr10:86680109 [GRCh38]
Chr10:88439866 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.343G>A (p.Gly115Ser) single nucleotide variant not specified [RCV000038755] Chr10:86681457 [GRCh38]
Chr10:88441214 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.352G>A (p.Val118Met) single nucleotide variant Cardiomyopathy [RCV000770140]|Cardiovascular phenotype [RCV000621725]|Myofibrillar myopathy, ZASP-related [RCV000232676]|not specified [RCV000038756] Chr10:86681466 [GRCh38]
Chr10:88441223 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.356C>T (p.Ala119Val) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000807856]|not provided [RCV000767123]|not specified [RCV000038757] Chr10:86681470 [GRCh38]
Chr10:88441227 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.530C>A (p.Ala177Asp) single nucleotide variant not specified [RCV000038758] Chr10:86681644 [GRCh38]
Chr10:88441401 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.576G>A (p.Pro192=) single nucleotide variant Cardiomyopathy [RCV000770144]|Cardiovascular phenotype [RCV000621522]|Myofibrillar myopathy, ZASP-related [RCV001083453]|none provided [RCV001287191]|not provided [RCV000586641]|not specified [RCV000038760] Chr10:86681690 [GRCh38]
Chr10:88441447 [GRCh37]
Chr10:10q23.2
benign|likely benign
NM_007078.3(LDB3):c.576G>T (p.Pro192=) single nucleotide variant Cardiomyopathy [RCV000770145]|Cardiovascular phenotype [RCV000619480]|Myofibrillar myopathy, ZASP-related [RCV001080146]|none provided [RCV001285351]|not provided [RCV000588670]|not specified [RCV000038761] Chr10:86681690 [GRCh38]
Chr10:88441447 [GRCh37]
Chr10:10q23.2
benign
NM_007078.3(LDB3):c.600C>T (p.Gly200=) single nucleotide variant not specified [RCV000038762] Chr10:86681714 [GRCh38]
Chr10:88441471 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.609G>A (p.Ser203=) single nucleotide variant Cardiomyopathy [RCV000770146]|Cardiovascular phenotype [RCV000621639]|Myofibrillar myopathy, ZASP-related [RCV000227191]|none provided [RCV001283031]|not specified [RCV000038763] Chr10:86681723 [GRCh38]
Chr10:88441480 [GRCh37]
Chr10:10q23.2
benign
NM_007078.3(LDB3):c.664G>A (p.Ala222Thr) single nucleotide variant Cardiovascular phenotype [RCV000617985]|Dilated cardiomyopathy 1C [RCV000763673]|Myofibrillar myopathy, ZASP-related [RCV001079636]|none provided [RCV001287897]|not provided [RCV000767125]|not specified [RCV000038764] Chr10:86681778 [GRCh38]
Chr10:88441535 [GRCh37]
Chr10:10q23.2
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_007078.3(LDB3):c.689+10G>A single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000231371]|not specified [RCV000038765] Chr10:86681813 [GRCh38]
Chr10:88441570 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.689+15T>C single nucleotide variant not specified [RCV000038766] Chr10:86681818 [GRCh38]
Chr10:88441575 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.732C>T (p.Pro244=) single nucleotide variant Cardiovascular phenotype [RCV000617861]|Myofibrillar myopathy, ZASP-related [RCV001079371]|not provided [RCV000477176]|not specified [RCV000038767] Chr10:86691938 [GRCh38]
Chr10:88451695 [GRCh37]
Chr10:10q23.2
benign|likely benign
NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000806776]|not provided [RCV000171994]|not specified [RCV000038769] Chr10:86691999 [GRCh38]
Chr10:88451756 [GRCh37]
Chr10:10q23.2
conflicting interpretations of pathogenicity|uncertain significance
NM_007078.3(LDB3):c.826C>T (p.Arg276Cys) single nucleotide variant Dilated cardiomyopathy 1C [RCV001293339]|Hypertrophic cardiomyopathy [RCV000991353]|Myofibrillar myopathy, ZASP-related [RCV000639877]|not specified [RCV000038770] Chr10:86692032 [GRCh38]
Chr10:88451789 [GRCh37]
Chr10:10q23.2
pathogenic|uncertain significance
NM_007078.3(LDB3):c.867C>T (p.Asp289=) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000862068]|not specified [RCV000038771] Chr10:86692542 [GRCh38]
Chr10:88452299 [GRCh37]
Chr10:10q23.2
benign|likely benign
NM_007078.3(LDB3):c.899C>A (p.Thr300Asn) single nucleotide variant not specified [RCV000038772] Chr10:86706533 [GRCh38]
Chr10:88466290 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.93+7G>T single nucleotide variant not specified [RCV000038773] Chr10:86668791 [GRCh38]
Chr10:88428548 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.954C>T (p.Pro318=) single nucleotide variant Cardiovascular phenotype [RCV000619611]|not specified [RCV000038774] Chr10:86706588 [GRCh38]
Chr10:88466345 [GRCh37]
Chr10:10q23.2
benign|likely benign
NM_007078.3(LDB3):c.993G>A (p.Ala331=) single nucleotide variant Cardiomyopathy [RCV000769282]|Cardiovascular phenotype [RCV000618353]|Myofibrillar myopathy, ZASP-related [RCV001084670]|none provided [RCV001286993]|not provided [RCV000712211]|not specified [RCV000038775] Chr10:86706627 [GRCh38]
Chr10:88466384 [GRCh37]
Chr10:10q23.2
benign|likely benign
NM_007078.3(LDB3):c.689+3877G>T single nucleotide variant not specified [RCV000036841] Chr10:86685680 [GRCh38]
Chr10:88445437 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.690-4842G>A single nucleotide variant Cardiomyopathy, left ventricular noncompaction [RCV000380869]|Dilated cardiomyopathy 1C [RCV000328491]|Myofibrillar Myopathy, Dominant [RCV000271123]|Myofibrillar myopathy, ZASP-related [RCV000358782]|not specified [RCV000036842] Chr10:86687054 [GRCh38]
Chr10:88446811 [GRCh37]
Chr10:10q23.2
benign|likely benign
NM_007078.3(LDB3):c.690-4842G>T single nucleotide variant not specified [RCV000036843] Chr10:86687054 [GRCh38]
Chr10:88446811 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.690-4824C>T single nucleotide variant not specified [RCV000036844] Chr10:86687072 [GRCh38]
Chr10:88446829 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.690-4716G>T single nucleotide variant Cardiomyopathy, left ventricular noncompaction [RCV000374491]|Dilated Cardiomyopathy, Dominant [RCV000334935]|Myofibrillar Myopathy, Dominant [RCV000282359]|Myofibrillar myopathy, ZASP-related [RCV000350220]|not specified [RCV000036846] Chr10:86687180 [GRCh38]
Chr10:88446937 [GRCh37]
Chr10:10q23.2
likely benign|uncertain significance
NM_007078.3(LDB3):c.690-4668T>C single nucleotide variant Cardiovascular phenotype [RCV000618498]|Dilated Cardiomyopathy, Dominant [RCV000343074]|Dilated cardiomyopathy 1C [RCV000304611]|Myofibrillar Myopathy, Dominant [RCV000395286]|Myofibrillar myopathy, ZASP-related [RCV000403084]|not specified [RCV000036848] Chr10:86687228 [GRCh38]
Chr10:88446985 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.690-4626T>C single nucleotide variant Cardiomyopathy, left ventricular noncompaction [RCV000365510]|Cardiovascular phenotype [RCV000618735]|Dilated Cardiomyopathy, Dominant [RCV000303793]|Dilated cardiomyopathy 1C [RCV001293331]|Myofibrillar Myopathy, Dominant [RCV000307366]|Myofibrillar myopathy, ZASP-related [RCV000273098]|none provided [RCV001285602]|not specified [RCV000036849] Chr10:86687270 [GRCh38]
Chr10:88447027 [GRCh37]
Chr10:10q23.2
benign|conflicting interpretations of pathogenicity|uncertain significance
NM_007078.3(LDB3):c.896+6669TC[13] microsatellite not specified [RCV000036850] Chr10:86699240..86699241 [GRCh38]
Chr10:88458997..88458998 [GRCh37]
Chr10:10q23.2
likely benign|not provided
NM_007078.3(LDB3):c.896+6669TC[12] microsatellite not specified [RCV000036851] Chr10:86699240..86699243 [GRCh38]
Chr10:88458997..88459000 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.896+6669TC[11] microsatellite not specified [RCV000036852] Chr10:86699240..86699245 [GRCh38]
Chr10:88458997..88459002 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.896+6722G>A single nucleotide variant Cardiovascular phenotype [RCV000617888]|Myofibrillar myopathy, ZASP-related [RCV001084996]|not provided [RCV000726618]|not specified [RCV000036853] Chr10:86699293 [GRCh38]
Chr10:88459050 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_007078.3(LDB3):c.896+6726C>G single nucleotide variant not specified [RCV000036854] Chr10:86699297 [GRCh38]
Chr10:88459054 [GRCh37]
Chr10:10q23.2
uncertain significance
GRCh38/hg38 10q22.3-23.2(chr10:79719429-87358394)x1 copy number loss See cases [RCV000052534] Chr10:79719429..87358394 [GRCh38]
Chr10:81479185..89118151 [GRCh37]
Chr10:81149191..89108131 [NCBI36]
Chr10:10q22.3-23.2
pathogenic
GRCh38/hg38 10q22.3-23.2(chr10:79802022-87358394)x1 copy number loss See cases [RCV000052537] Chr10:79802022..87358394 [GRCh38]
Chr10:81561459..89118151 [GRCh37]
Chr10:81541288..89108131 [NCBI36]
Chr10:10q22.3-23.2
pathogenic
GRCh38/hg38 10q22.3-23.2(chr10:79882162-87068261)x1 copy number loss See cases [RCV000052539] Chr10:79882162..87068261 [GRCh38]
Chr10:81641918..88828018 [GRCh37]
Chr10:81631898..88817998 [NCBI36]
Chr10:10q22.3-23.2
pathogenic|conflicting data from submitters
GRCh38/hg38 10q22.3-23.2(chr10:79898516-86964367)x1 copy number loss See cases [RCV000052541] Chr10:79898516..86964367 [GRCh38]
Chr10:81658272..88724124 [GRCh37]
Chr10:81648252..88714104 [NCBI36]
Chr10:10q22.3-23.2
pathogenic
GRCh38/hg38 10q22.3-23.2(chr10:79898516-87358394)x1 copy number loss See cases [RCV000052542] Chr10:79898516..87358394 [GRCh38]
Chr10:81658272..89118151 [GRCh37]
Chr10:81648252..89108131 [NCBI36]
Chr10:10q22.3-23.2
pathogenic
GRCh38/hg38 10q22.3-23.2(chr10:79898516-87109827)x1 copy number loss See cases [RCV000052544] Chr10:79898516..87109827 [GRCh38]
Chr10:81658272..88869584 [GRCh37]
Chr10:81648252..88859564 [NCBI36]
Chr10:10q22.3-23.2
pathogenic
GRCh38/hg38 10q23.1-23.31(chr10:84925492-88002064)x1 copy number loss Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052546]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052546]|See cases [RCV000052546] Chr10:84925492..88002064 [GRCh38]
Chr10:86685248..89761821 [GRCh37]
Chr10:86675228..89751801 [NCBI36]
Chr10:10q23.1-23.31
pathogenic
GRCh38/hg38 10q23.2-23.31(chr10:86727432-89201768)x1 copy number loss Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052561]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052561]|See cases [RCV000052561] Chr10:86727432..89201768 [GRCh38]
Chr10:88487189..90961525 [GRCh37]
Chr10:88477169..90951505 [NCBI36]
Chr10:10q23.2-23.31
pathogenic
GRCh38/hg38 10q22.3-23.2(chr10:79881238-87182117)x3 copy number gain See cases [RCV000053558] Chr10:79881238..87182117 [GRCh38]
Chr10:81640994..88941874 [GRCh37]
Chr10:81630974..88931854 [NCBI36]
Chr10:10q22.3-23.2
pathogenic
GRCh38/hg38 10q23.1-23.31(chr10:84434981-89150802)x3 copy number gain See cases [RCV000053559] Chr10:84434981..89150802 [GRCh38]
Chr10:86194737..90910559 [GRCh37]
Chr10:86184717..90900539 [NCBI36]
Chr10:10q23.1-23.31
pathogenic
NM_007078.3(LDB3):c.160G>A (p.Gly54Ser) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000706758]|not provided [RCV000079441] Chr10:86679433 [GRCh38]
Chr10:88439190 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1294del (p.Ser432fs) deletion Myofibrillar myopathy, ZASP-related [RCV001367709] Chr10:86716389 [GRCh38]
Chr10:88476146 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.465C>T (p.Leu155=) single nucleotide variant Cardiomyopathy [RCV000770142]|Cardiovascular phenotype [RCV000617229]|Myofibrillar myopathy, ZASP-related [RCV000230615]|not specified [RCV000150917] Chr10:86681579 [GRCh38]
Chr10:88441336 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_007078.3(LDB3):c.896+6731C>T single nucleotide variant Cardiovascular phenotype [RCV000621208]|Myofibrillar myopathy, ZASP-related [RCV001084072]|not provided [RCV000476412]|not specified [RCV000154747] Chr10:86699302 [GRCh38]
Chr10:88459059 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.1035C>T (p.Ile345=) single nucleotide variant none provided [RCV001285092]|not provided [RCV000996134]|not specified [RCV000150924] Chr10:86706669 [GRCh38]
Chr10:88466426 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.1335C>T (p.Tyr445=) single nucleotide variant Cardiovascular phenotype [RCV000621803]|Myofibrillar myopathy, ZASP-related [RCV000457257]|not specified [RCV000156759] Chr10:86716430 [GRCh38]
Chr10:88476187 [GRCh37]
Chr10:10q23.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_007078.3(LDB3):c.-48G>A single nucleotide variant not specified [RCV000126610] Chr10:86668546 [GRCh38]
Chr10:88428303 [GRCh37]
Chr10:10q23.2
benign
NM_007078.3(LDB3):c.-36A>G single nucleotide variant not specified [RCV000126611] Chr10:86668558 [GRCh38]
Chr10:88428315 [GRCh37]
Chr10:10q23.2
benign
NM_007078.3(LDB3):c.-24+8T>C single nucleotide variant Cardiomyopathy, left ventricular noncompaction [RCV000393181]|Dilated cardiomyopathy 1C [RCV000308499]|Myofibrillar Myopathy, Dominant [RCV000393189]|Myofibrillar myopathy, ZASP-related [RCV000370149]|not specified [RCV000126612] Chr10:86668578 [GRCh38]
Chr10:88428335 [GRCh37]
Chr10:10q23.2
benign|likely benign
NM_007078.3(LDB3):c.1799G>C (p.Arg600Pro) single nucleotide variant not provided [RCV000171181] Chr10:86718086 [GRCh38]
Chr10:88477843 [GRCh37]
Chr10:10q23.2
likely pathogenic
NM_007078.3(LDB3):c.859+81G>A single nucleotide variant Dilated cardiomyopathy 1C [RCV001293348] Chr10:86692146 [GRCh38]
Chr10:88451903 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.692G>T (p.Ser231Ile) single nucleotide variant Dilated cardiomyopathy 1C [RCV001293335] Chr10:86691898 [GRCh38]
Chr10:88451655 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.*30C>G single nucleotide variant Dilated cardiomyopathy 1C [RCV001293351] Chr10:86733006 [GRCh38]
Chr10:88492763 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.896+86G>A single nucleotide variant Dilated cardiomyopathy 1C [RCV001293350] Chr10:86692657 [GRCh38]
Chr10:88452414 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.358C>A (p.Pro120Thr) single nucleotide variant Primary familial hypertrophic cardiomyopathy [RCV000143909] Chr10:86681472 [GRCh38]
Chr10:88441229 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1344A>C (p.Ser448=) single nucleotide variant not specified [RCV001194320] Chr10:86716439 [GRCh38]
Chr10:88476196 [GRCh37]
Chr10:10q23.2
likely benign
NM_007078.3(LDB3):c.254G>A (p.Arg85His) single nucleotide variant not provided [RCV000171988] Chr10:86680090 [GRCh38]
Chr10:88439847 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.443G>A (p.Arg148Gln) single nucleotide variant not provided [RCV000171989] Chr10:86681557 [GRCh38]
Chr10:88441314 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.690-4826G>A single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV001324560]|not provided [RCV000171990] Chr10:86687070 [GRCh38]
Chr10:88446827 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.715G>A (p.Val239Ile) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV001217126]|not provided [RCV000171992] Chr10:86691921 [GRCh38]
Chr10:88451678 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.764A>G (p.Lys255Arg) single nucleotide variant not provided [RCV000171993] Chr10:86691970 [GRCh38]
Chr10:88451727 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.887G>A (p.Arg296Gln) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV001066233]|not provided [RCV000171995] Chr10:86692562 [GRCh38]
Chr10:88452319 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1736A>G (p.Tyr579Cys) single nucleotide variant Myofibrillar myopathy, ZASP-related [RCV000702324]|not provided [RCV000171999] Chr10:86718023 [GRCh38]
Chr10:88477780 [GRCh37]
Chr10:10q23.2
uncertain significance
NM_007078.3(LDB3):c.1325C>T (p.Ala442Val) single nucleotide variant not specified [RCV000172756] Chr10:86716420 [GRCh38]
Chr10:88476177 [GRCh37]
Chr10:10q23.2
benign
NM_007078.3(LDB3):c.1330G>A (p.Ala444Thr) single nucleotide variant not specified [RCV000172757] Chr10:86716425 [GRCh38]
Chr10:88476182 [GRCh37]
Chr10:10q23.2
benign
GRCh38/hg38 10q22.3-23.2(chr10:79925613-86951708)x1 copy number loss See cases [RCV000135348] Chr10:79925613..86951708 [GRCh38]
Chr10:81685369..88711465 [GRCh37]
Chr10:81675349..88701445 [NCBI36]
Chr10:10q22.3-23.2
pathogenic
GRCh38/hg38 10q22.3-23.2(chr10:79802022-87068261)x1 copy number loss See cases [RCV000136565] Chr10:79802022..87068261 [GRCh38]
Chr10:81561459..88828018 [GRCh37]
Chr10:81263385..88817998 [NCBI36]
Chr10:10q22.3-23.2
pathogenic