MED12 (mediator complex subunit 12) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: MED12 (mediator complex subunit 12) Homo sapiens
Analyze
Symbol: MED12
Name: mediator complex subunit 12
RGD ID: 1350145
HGNC Page HGNC
Description: Exhibits several functions, including protein C-terminus binding activity; thyroid hormone receptor binding activity; and transcription coactivator activity. Involved in positive regulation of transcription initiation from RNA polymerase II promoter. Localizes to mediator complex. Implicated in FG syndrome; leiomyosarcoma; major depressive disorder; phobic disorder; and syndromic X-linked intellectual disability.
Type: protein-coding
RefSeq Status: REVIEWED
Also known as: activator-recruited cofactor 240 kDa component; ARC240; CAG repeat protein 45; CAGH45; FG syndrome 1; FGS1; HOPA; human opposite paired; KIAA0192; Kohtalo homolog; Kto; MED12S; mediator of RNA polymerase II transcription subunit 12; mediator of RNA polymerase II transcription, subunit 12 homolog; mediator of rna polymerase ii transcription, subunit 12 homolog (yeast); OHDOX; OKS; OPA-containing protein; OPA1; putative mediator subunit 12; thyroid hormone receptor-associated protein complex 230 kDa component; thyroid hormone receptor-associated protein, 230 kDa subunit; TNRC11; TRAP230; trinucleotide repeat containing 11 (THR-associated protein, 230 kDa subunit); trinucleotide repeat-containing gene 11 protein
RGD Orthologs
Mouse
Rat
Chinchilla
Bonobo
Dog
Squirrel
Pig
Green Monkey
Naked Mole-Rat
Alliance Genes
More Info more info ...
Allele / Splice: See ClinVar data
Latest Assembly: GRCh38 - Human Genome Assembly GRCh38
Position:
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 EnsemblX71,118,556 - 71,142,454 (+)EnsemblGRCh38hg38GRCh38
GRCh38X71,118,596 - 71,142,450 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh37X70,338,446 - 70,362,300 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 36X70,255,131 - 70,279,029 (+)NCBINCBI36hg18NCBI36
Build 34X70,121,593 - 70,145,168NCBI
CeleraX70,692,310 - 70,716,179 (+)NCBI
Cytogenetic MapXq13.1NCBI
HuRefX64,157,722 - 64,181,176 (+)NCBIHuRef
CHM1_1X70,231,161 - 70,255,024 (+)NCBICHM1_1
JBrowse: View Region in Genome Browser (JBrowse)
Model


Gene-Chemical Interaction Annotations     Click to see Annotation Detail View
Gene Ontology Annotations     Click to see Annotation Detail View

Cellular Component
mediator complex  (IBA,IDA,IEA)
membrane  (HDA)
nucleoplasm  (TAS)
nucleus  (IDA)
ubiquitin ligase complex  (IEA,ISO)

Molecular Pathway Annotations     Click to see Annotation Detail View
Phenotype Annotations     Click to see Annotation Detail View

Human Phenotype
2-3 toe syndactyly  (IAGP)
Abnormal cerebellum morphology  (IAGP)
Abnormal emotion/affect behavior  (IAGP)
Abnormal facial shape  (IAGP)
Abnormal heart morphology  (IAGP)
Abnormal nasopharynx morphology  (IAGP)
Abnormal rib cage morphology  (IAGP)
Abnormal social behavior  (IAGP)
Abnormal sternum morphology  (IAGP)
Abnormal thumb morphology  (IAGP)
Abnormality of the genitourinary system  (IAGP)
Abnormally folded helix  (IAGP)
Agenesis of corpus callosum  (IAGP)
Aggressive behavior  (IAGP)
Anal atresia  (IAGP)
Anal stenosis  (IAGP)
Angiosarcoma  (IAGP)
Anteriorly placed anus  (IAGP)
Aplasia/Hypoplasia of the corpus callosum  (IAGP)
Arachnodactyly  (IAGP)
Ascending tubular aorta aneurysm  (IAGP)
Atrial septal defect  (IAGP)
Attention deficit hyperactivity disorder  (IAGP)
Autism  (IAGP)
Autistic behavior  (IAGP)
Babinski sign  (IAGP)
Behavioral abnormality  (IAGP)
Bilateral tonic-clonic seizure  (IAGP)
Blepharophimosis  (IAGP)
Brachycephaly  (IAGP)
Brachydactyly  (IAGP)
Broad hallux  (IAGP)
Broad nasal tip  (IAGP)
Broad neck  (IAGP)
Broad thumb  (IAGP)
Broad toe  (IAGP)
Broad-based gait  (IAGP)
Bulbous nose  (IAGP)
Cafe-au-lait spot  (IAGP)
Camptodactyly  (IAGP)
Camptodactyly of finger  (IAGP)
Choanal atresia  (IAGP)
Cleft palate  (IAGP)
Cleft upper lip  (IAGP)
Clinodactyly  (IAGP)
Clinodactyly of the 2nd finger  (IAGP)
Clinodactyly of the 2nd toe  (IAGP)
Coarctation of aorta  (IAGP)
Coarse facial features  (IAGP)
Cognitive impairment  (IAGP)
Constipation  (IAGP)
Craniosynostosis  (IAGP)
Cryptorchidism  (IAGP)
Cupped ear  (IAGP)
Decreased body weight  (IAGP)
Deep philtrum  (IAGP)
Delayed closure of the anterior fontanelle  (IAGP)
Delayed eruption of teeth  (IAGP)
Delayed speech and language development  (IAGP)
Dental crowding  (IAGP)
Depressed nasal bridge  (IAGP)
Disproportionate tall stature  (IAGP)
Downslanted palpebral fissures  (IAGP)
Drooling  (IAGP)
Emotional lability  (IAGP)
Epicanthus  (IAGP)
Facial palsy  (IAGP)
Facial wrinkling  (IAGP)
Feeding difficulties  (IAGP)
Fine hair  (IAGP)
Finger syndactyly  (IAGP)
Flexion contracture  (IAGP)
Frontal bossing  (IAGP)
Frontal upsweep of hair  (IAGP)
Fused teeth  (IAGP)
Gastroesophageal reflux  (IAGP)
Generalized hypotonia  (IAGP)
Generalized joint laxity  (IAGP)
Generalized neonatal hypotonia  (IAGP)
Generalized non-motor (absence) seizure  (IAGP)
Glioblastoma multiforme  (IAGP)
Global developmental delay  (IAGP)
Gray matter heterotopia  (IAGP)
Hallucinations  (IAGP)
Hearing impairment  (IAGP)
High forehead  (IAGP)
High palate  (IAGP)
High pitched voice  (IAGP)
Hydrocephalus  (IAGP)
Hyperactivity  (IAGP)
Hypertelorism  (IAGP)
Hypoplasia of the maxilla  (IAGP)
Hypospadias  (IAGP)
Hypotonia  (IAGP)
Impaired social interactions  (IAGP)
Infantile muscular hypotonia  (IAGP)
Inguinal hernia  (IAGP)
Intellectual disability  (IAGP)
Intellectual disability, moderate  (IAGP)
Intellectual disability, profound  (IAGP)
Intellectual disability, severe  (IAGP)
Intestinal malrotation  (IAGP)
Joint contracture of the hand  (IAGP)
Joint hyperflexibility  (IAGP)
Joint hypermobility  (IAGP)
Joint laxity  (IAGP)
Language impairment  (IAGP)
Limited elbow extension and supination  (IAGP)
Long face  (IAGP)
Long nose  (IAGP)
Long palpebral fissure  (IAGP)
Long philtrum  (IAGP)
Low frustration tolerance  (IAGP)
Low-set ears  (IAGP)
Lumbar hyperlordosis  (IAGP)
Macrocephaly  (IAGP)
Macroorchidism  (IAGP)
Malar flattening  (IAGP)
Malrotation of colon  (IAGP)
Meckel diverticulum  (IAGP)
Micrognathia  (IAGP)
Microtia  (IAGP)
Microtia, first degree  (IAGP)
Midface retrusion  (IAGP)
Mild neurosensory hearing impairment  (IAGP)
Mitral valve prolapse  (IAGP)
Moderate sensorineural hearing impairment  (IAGP)
Motor delay  (IAGP)
Multiple joint contractures  (IAGP)
Narrow face  (IAGP)
Narrow mouth  (IAGP)
Narrow nasal bridge  (IAGP)
Narrow palate  (IAGP)
Nasal speech  (IAGP)
Neonatal hypotonia  (IAGP)
Neoplasm of the breast  (IAGP)
Nephroblastoma  (IAGP)
Neurological speech impairment  (IAGP)
Obesity  (IAGP)
Obsessive-compulsive behavior  (IAGP)
Open mouth  (IAGP)
Optic nerve hypoplasia  (IAGP)
Pancreatic adenocarcinoma  (IAGP)
Partial agenesis of the corpus callosum  (IAGP)
Pectus excavatum  (IAGP)
Periorbital fullness  (IAGP)
Pes planus  (IAGP)
Plagiocephaly  (IAGP)
Poor speech  (IAGP)
Postnatal macrocephaly  (IAGP)
Premature birth  (IAGP)
Progressive flexion contractures  (IAGP)
Prominent fingertip pads  (IAGP)
Prominent forehead  (IAGP)
Prominent nasal bridge  (IAGP)
Prominent nose  (IAGP)
Prominent occiput  (IAGP)
Protruding ear  (IAGP)
Psychosis  (IAGP)
Ptosis  (IAGP)
Pulmonary arterial hypertension  (IAGP)
Pyloric stenosis  (IAGP)
Radial deviation of finger  (IAGP)
Relative macrocephaly  (IAGP)
Sacral dimple  (IAGP)
Schizophrenia  (IAGP)
Scoliosis  (IAGP)
Scrotal hypoplasia  (IAGP)
Seizure  (IAGP)
Sensorineural hearing impairment  (IAGP)
Short chin  (IAGP)
Short neck  (IAGP)
Short philtrum  (IAGP)
Short stature  (IAGP)
Shortening of all distal phalanges of the fingers  (IAGP)
Single transverse palmar crease  (IAGP)
Skin tags  (IAGP)
Slender build  (IAGP)
Small for gestational age  (IAGP)
Small pituitary gland  (IAGP)
Smooth philtrum  (IAGP)
Sparse hair  (IAGP)
Split hand  (IAGP)
Squamous cell lung carcinoma  (IAGP)
Stenosis of the external auditory canal  (IAGP)
Strabismus  (IAGP)
Syndactyly  (IAGP)
Thick lower lip vermilion  (IAGP)
Thick nasal alae  (IAGP)
Thick vermilion border  (IAGP)
Thin upper lip vermilion  (IAGP)
Thin vermilion border  (IAGP)
Triangular face  (IAGP)
Umbilical hernia  (IAGP)
Urinary incontinence  (IAGP)
Uterine leiomyoma  (IAGP)
Ventricular septal defect  (IAGP)
Ventriculomegaly  (IAGP)
Wide anterior fontanel  (IAGP)
Wide mouth  (IAGP)
Wide nasal bridge  (IAGP)
Widely patent fontanelles and sutures  (IAGP)
Widened subarachnoid space  (IAGP)
X-linked recessive inheritance  (IAGP)
References

Additional References at PubMed
PMID:8710870   PMID:8724849   PMID:8781769   PMID:8889548   PMID:9225980   PMID:9375929   PMID:9702738   PMID:10198638   PMID:10235266   PMID:10235267   PMID:10480376   PMID:10882111  
PMID:11424983   PMID:11524702   PMID:11834832   PMID:11840515   PMID:11867769   PMID:11984006   PMID:12037571   PMID:12136106   PMID:12218053   PMID:12477932   PMID:12584197   PMID:12612078  
PMID:12627458   PMID:12777533   PMID:12860370   PMID:14636573   PMID:14638676   PMID:14657022   PMID:15108174   PMID:15175163   PMID:15717329   PMID:15989967   PMID:16109376   PMID:16344560  
PMID:16538184   PMID:16565090   PMID:16799563   PMID:17000779   PMID:17081983   PMID:17088561   PMID:17110338   PMID:17299734   PMID:17716226   PMID:17967894   PMID:18029348   PMID:18418385  
PMID:18691967   PMID:18973276   PMID:19036726   PMID:19047373   PMID:19240132   PMID:19946888   PMID:20098423   PMID:20133760   PMID:20301719   PMID:20508642   PMID:20720539   PMID:21293490  
PMID:21729782   PMID:21868628   PMID:21873635   PMID:22182697   PMID:22223266   PMID:22428002   PMID:22532225   PMID:22586326   PMID:22768200   PMID:22939629   PMID:23091001   PMID:23132392  
PMID:23178117   PMID:23222489   PMID:23225304   PMID:23275444   PMID:23322298   PMID:23347103   PMID:23443020   PMID:23517922   PMID:23563140   PMID:23602568   PMID:23635816   PMID:23661306  
PMID:23746844   PMID:23749998   PMID:23836153   PMID:23913526   PMID:24163370   PMID:24196187   PMID:24390224   PMID:24457600   PMID:24746821   PMID:24938407   PMID:24980722   PMID:25015674  
PMID:25038752   PMID:25108465   PMID:25281560   PMID:25325994   PMID:25363374   PMID:25593300   PMID:25595892   PMID:25615570   PMID:25720964   PMID:25839987   PMID:25855048   PMID:25865354  
PMID:25921289   PMID:25931199   PMID:25964426   PMID:26018969   PMID:26037152   PMID:26093648   PMID:26109290   PMID:26182352   PMID:26186194   PMID:26193636   PMID:26298726   PMID:26318153  
PMID:26338144   PMID:26344197   PMID:26355235   PMID:26358559   PMID:26383637   PMID:26487511   PMID:26496610   PMID:26630226   PMID:26673895   PMID:26813965   PMID:26856273   PMID:26860948  
PMID:26924278   PMID:26949251   PMID:27056456   PMID:27187686   PMID:27602765   PMID:27684187   PMID:27806318   PMID:27889101   PMID:27967206   PMID:28002623   PMID:28054750   PMID:28055980  
PMID:28183795   PMID:28369444   PMID:28432313   PMID:28481362   PMID:28514442   PMID:28533407   PMID:28544239   PMID:28634282   PMID:28771672   PMID:28813667   PMID:28944423   PMID:29117863  
PMID:29180619   PMID:29315289   PMID:29333096   PMID:29440396   PMID:29467282   PMID:29507755   PMID:29568061   PMID:29628309   PMID:29656893   PMID:29666002   PMID:29735544   PMID:29790226  
PMID:30006928   PMID:30017537   PMID:30021884   PMID:30099503   PMID:30230586   PMID:30467240   PMID:30538295   PMID:30647905   PMID:30695077   PMID:30729724   PMID:31010829   PMID:31072327  
PMID:31091453   PMID:31527615   PMID:31988137   PMID:32094355   PMID:32240666   PMID:32416067   PMID:32694731   PMID:32752274   PMID:33025089  


Genomics

Comparative Map Data
MED12
(Homo sapiens - human)
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 EnsemblX71,118,556 - 71,142,454 (+)EnsemblGRCh38hg38GRCh38
GRCh38X71,118,596 - 71,142,450 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh37X70,338,446 - 70,362,300 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 36X70,255,131 - 70,279,029 (+)NCBINCBI36hg18NCBI36
Build 34X70,121,593 - 70,145,168NCBI
CeleraX70,692,310 - 70,716,179 (+)NCBI
Cytogenetic MapXq13.1NCBI
HuRefX64,157,722 - 64,181,176 (+)NCBIHuRef
CHM1_1X70,231,161 - 70,255,024 (+)NCBICHM1_1
Med12
(Mus musculus - house mouse)
Mouse AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCm39X100,317,697 - 100,342,540 (+)NCBIGRCm39mm39
GRCm39 EnsemblX100,317,636 - 100,341,071 (+)Ensembl
GRCm38X101,274,091 - 101,298,934 (+)NCBIGRCm38GRCm38mm10GRCm38
GRCm38.p6 EnsemblX101,274,030 - 101,297,465 (+)EnsemblGRCm38mm10GRCm38
MGSCv37X98,469,430 - 98,494,273 (+)NCBIGRCm37mm9NCBIm37
MGSCv36X97,477,613 - 97,499,990 (+)NCBImm8
CeleraX88,190,265 - 88,214,981 (+)NCBICelera
Cytogenetic MapXDNCBI
Med12
(Rattus norvegicus - Norway rat)
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
mRatBN7.2X66,404,622 - 66,427,772 (+)NCBI
Rnor_6.0 EnsemblX71,174,699 - 71,197,812 (+)EnsemblRnor6.0rn6Rnor6.0
Rnor_6.0X71,174,653 - 71,197,812 (+)NCBIRnor6.0Rnor_6.0rn6Rnor6.0
Rnor_5.0X72,027,135 - 72,050,293 (+)NCBIRnor5.0Rnor_5.0rn5Rnor5.0
RGSC_v3.4X89,351,546 - 89,374,489 (+)NCBIRGSC3.4rn4RGSC3.4
CeleraX66,760,730 - 66,783,673 (+)NCBICelera
Cytogenetic MapXq22NCBI
Med12
(Chinchilla lanigera - long-tailed chinchilla)
Chinchilla AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChiLan1.0 EnsemblNW_00495547510,687,367 - 10,710,053 (+)EnsemblChiLan1.0
ChiLan1.0NW_00495547510,687,168 - 10,710,286 (+)NCBIChiLan1.0ChiLan1.0
MED12
(Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
PanPan1.1X70,443,467 - 70,467,178 (+)NCBIpanpan1.1PanPan1.1panPan2
PanPan1.1 EnsemblX70,443,667 - 70,466,942 (+)Ensemblpanpan1.1panPan2
Mhudiblu_PPA_v0X60,386,820 - 60,410,730 (+)NCBIMhudiblu_PPA_v0panPan3
MED12
(Canis lupus familiaris - dog)
Dog AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
CanFam3.1X55,487,629 - 55,508,941 (+)NCBICanFam3.1CanFam3.1canFam3CanFam3.1
CanFam3.1 EnsemblX55,482,013 - 55,509,992 (+)EnsemblCanFam3.1canFam3CanFam3.1
Dog10K_Boxer_TashaX46,314,714 - 46,337,057 (+)NCBI
ROS_Cfam_1.0X56,456,534 - 56,465,517 (+)NCBI
UMICH_Zoey_3.1X54,424,767 - 54,447,085 (+)NCBI
UNSW_CanFamBas_1.0X55,756,191 - 55,778,506 (+)NCBI
UU_Cfam_GSD_1.0X55,683,336 - 55,705,668 (+)NCBI
Med12
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)
Squirrel AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HiC_Itri_2X46,697,933 - 46,721,139 (-)NCBI
SpeTri2.0NW_004936762460,342 - 483,264 (-)NCBISpeTri2.0SpeTri2.0SpeTri2.0
MED12
(Sus scrofa - pig)
Pig AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Sscrofa11.1 EnsemblX57,150,578 - 57,175,352 (+)EnsemblSscrofa11.1susScr11Sscrofa11.1
Sscrofa11.1X57,150,884 - 57,174,367 (+)NCBISscrofa11.1Sscrofa11.1susScr11Sscrofa11.1
Sscrofa10.2X64,681,038 - 64,704,523 (+)NCBISscrofa10.2Sscrofa10.2susScr3
MED12
(Chlorocebus sabaeus - African green monkey)
Vervet AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChlSab1.1X60,915,796 - 60,939,220 (+)NCBI
ChlSab1.1 EnsemblX60,915,703 - 60,937,677 (+)Ensembl
Med12
(Heterocephalus glaber - naked mole-rat)
Molerat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HetGla 1.0NW_0046249031,412,346 - 1,436,474 (+)NCBI

Position Markers
RH79662  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X70,362,056 - 70,362,238UniSTSGRCh37
Build 36X70,278,781 - 70,278,963RGDNCBI36
CeleraX70,715,931 - 70,716,113RGD
Cytogenetic MapXq13UniSTS
HuRefX64,180,942 - 64,181,124UniSTS
GeneMap99-GB4 RH MapX238.5UniSTS
DXS441  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X75,356,696 - 75,356,869UniSTSGRCh37
GRCh37X75,356,627 - 75,356,831UniSTSGRCh37
GRCh37X75,356,690 - 75,356,792UniSTSGRCh37
Build 36X75,273,081 - 75,273,195RGDNCBI36
CeleraX75,639,619 - 75,639,835UniSTS
CeleraX75,639,682 - 75,639,796RGD
CeleraX75,639,688 - 75,639,873UniSTS
Cytogenetic MapXq13UniSTS
Cytogenetic MapXp11.22UniSTS
HuRefX68,989,527 - 68,989,712UniSTS
HuRefX68,989,521 - 68,989,635UniSTS
HuRefX68,989,458 - 68,989,674UniSTS
Whitehead-YAC Contig MapX UniSTS
RH25405  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X70,339,575 - 70,339,725UniSTSGRCh37
Build 36X70,256,300 - 70,256,450RGDNCBI36
CeleraX70,693,479 - 70,693,629RGD
Cytogenetic MapXq13UniSTS
GeneMap99-GB4 RH MapX231.7UniSTS
NCBI RH MapX365.4UniSTS
DXS7537  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic MapXq13UniSTS

miRNA Target Status

Predicted Target Of
Summary Value
Count of predictions:1958
Count of miRNA genes:820
Interacting mature miRNAs:917
Transcripts:ENST00000333646, ENST00000374080, ENST00000374102, ENST00000429213, ENST00000444034, ENST00000460771, ENST00000462984, ENST00000471663, ENST00000489199
Prediction methods:Miranda, Pita, Rnahybrid
Result types:miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.


Expression


RNA-SEQ Expression
High: > 1000 TPM value   Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM   Below Cutoff: < 0.5 TPM

alimentary part of gastrointestinal system circulatory system endocrine system exocrine system hemolymphoid system hepatobiliary system integumental system musculoskeletal system nervous system renal system reproductive system respiratory system sensory system visual system adipose tissue appendage entire extraembryonic component pharyngeal arch
High
Medium 2332 1998 1353 254 1665 104 3805 1250 1767 269 1427 1582 161 1191 2260 4
Low 107 993 373 370 286 361 551 947 1967 150 33 31 14 1 13 528 2 2
Below cutoff

Sequence

Nucleotide Sequences
RefSeq Transcripts NG_012808 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_005120 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AB102551 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102552 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102553 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102554 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102555 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102556 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102557 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102558 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102559 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102560 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102561 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102562 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102563 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102564 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102565 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102566 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102567 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102568 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102569 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102570 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102581 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102582 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102583 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102584 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102585 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102586 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102587 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102588 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102589 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102590 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102591 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102592 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102593 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102594 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102595 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102596 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102597 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102598 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102599 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102600 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102611 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102612 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102613 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102614 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102615 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102616 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102617 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102618 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102619 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102620 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102621 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102622 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102623 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102624 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102625 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102626 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102627 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102628 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102629 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102630 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB102668 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF071309 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF132033 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ306428 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK302543 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL590764 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC127264 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BM662470 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471132 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D83783 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DB069668 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FN430679 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U23863 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U80742 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles

Reference Sequences
RefSeq Acc Id: ENST00000333646   ⟹   ENSP00000333125
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX71,118,556 - 71,142,453 (+)Ensembl
RefSeq Acc Id: ENST00000374080   ⟹   ENSP00000363193
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX71,118,596 - 71,142,450 (+)Ensembl
RefSeq Acc Id: ENST00000374102   ⟹   ENSP00000363215
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX71,118,695 - 71,142,454 (+)Ensembl
RefSeq Acc Id: ENST00000429213   ⟹   ENSP00000399084
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX71,118,835 - 71,120,052 (+)Ensembl
RefSeq Acc Id: ENST00000444034   ⟹   ENSP00000404373
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX71,136,594 - 71,140,755 (+)Ensembl
RefSeq Acc Id: ENST00000460771
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX71,129,183 - 71,129,862 (+)Ensembl
RefSeq Acc Id: ENST00000462984
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX71,126,374 - 71,127,691 (+)Ensembl
RefSeq Acc Id: ENST00000471663
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX71,126,261 - 71,127,386 (+)Ensembl
RefSeq Acc Id: ENST00000489199
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX71,128,315 - 71,128,820 (+)Ensembl
RefSeq Acc Id: NM_005120   ⟹   NP_005111
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38X71,118,596 - 71,142,450 (+)NCBI
GRCh37X70,338,406 - 70,362,304 (+)ENTREZGENE
Build 36X70,255,131 - 70,279,029 (+)NCBI Archive
HuRefX64,157,722 - 64,181,176 (+)ENTREZGENE
CHM1_1X70,231,161 - 70,255,024 (+)NCBI
Sequence:
Protein Sequences
Protein RefSeqs NP_005111 (Get FASTA)   NCBI Sequence Viewer  
GenBank Protein AAB91440 (Get FASTA)   NCBI Sequence Viewer  
  AAC83163 (Get FASTA)   NCBI Sequence Viewer  
  AAD44162 (Get FASTA)   NCBI Sequence Viewer  
  BAA12112 (Get FASTA)   NCBI Sequence Viewer  
  BAC81020 (Get FASTA)   NCBI Sequence Viewer  
  BAC81021 (Get FASTA)   NCBI Sequence Viewer  
  BAC81022 (Get FASTA)   NCBI Sequence Viewer  
  BAC81023 (Get FASTA)   NCBI Sequence Viewer  
  BAC81024 (Get FASTA)   NCBI Sequence Viewer  
  BAC81025 (Get FASTA)   NCBI Sequence Viewer  
  BAC81026 (Get FASTA)   NCBI Sequence Viewer  
  BAC81027 (Get FASTA)   NCBI Sequence Viewer  
  BAC81028 (Get FASTA)   NCBI Sequence Viewer  
  BAC81029 (Get FASTA)   NCBI Sequence Viewer  
  BAC81030 (Get FASTA)   NCBI Sequence Viewer  
  BAC81031 (Get FASTA)   NCBI Sequence Viewer  
  BAC81032 (Get FASTA)   NCBI Sequence Viewer  
  BAC81033 (Get FASTA)   NCBI Sequence Viewer  
  BAC81034 (Get FASTA)   NCBI Sequence Viewer  
  BAC81035 (Get FASTA)   NCBI Sequence Viewer  
  BAC81036 (Get FASTA)   NCBI Sequence Viewer  
  BAC81037 (Get FASTA)   NCBI Sequence Viewer  
  BAC81038 (Get FASTA)   NCBI Sequence Viewer  
  BAC81039 (Get FASTA)   NCBI Sequence Viewer  
  BAC81050 (Get FASTA)   NCBI Sequence Viewer  
  BAC81051 (Get FASTA)   NCBI Sequence Viewer  
  BAC81052 (Get FASTA)   NCBI Sequence Viewer  
  BAC81053 (Get FASTA)   NCBI Sequence Viewer  
  BAC81054 (Get FASTA)   NCBI Sequence Viewer  
  BAC81055 (Get FASTA)   NCBI Sequence Viewer  
  BAC81056 (Get FASTA)   NCBI Sequence Viewer  
  BAC81057 (Get FASTA)   NCBI Sequence Viewer  
  BAC81058 (Get FASTA)   NCBI Sequence Viewer  
  BAC81059 (Get FASTA)   NCBI Sequence Viewer  
  BAC81060 (Get FASTA)   NCBI Sequence Viewer  
  BAC81061 (Get FASTA)   NCBI Sequence Viewer  
  BAC81062 (Get FASTA)   NCBI Sequence Viewer  
  BAC81063 (Get FASTA)   NCBI Sequence Viewer  
  BAC81064 (Get FASTA)   NCBI Sequence Viewer  
  BAC81065 (Get FASTA)   NCBI Sequence Viewer  
  BAC81066 (Get FASTA)   NCBI Sequence Viewer  
  BAC81067 (Get FASTA)   NCBI Sequence Viewer  
  BAC81068 (Get FASTA)   NCBI Sequence Viewer  
  BAC81069 (Get FASTA)   NCBI Sequence Viewer  
  BAC81080 (Get FASTA)   NCBI Sequence Viewer  
  BAC81081 (Get FASTA)   NCBI Sequence Viewer  
  BAC81082 (Get FASTA)   NCBI Sequence Viewer  
  BAC81083 (Get FASTA)   NCBI Sequence Viewer  
  BAC81084 (Get FASTA)   NCBI Sequence Viewer  
  BAC81085 (Get FASTA)   NCBI Sequence Viewer  
  BAC81086 (Get FASTA)   NCBI Sequence Viewer  
  BAC81087 (Get FASTA)   NCBI Sequence Viewer  
  BAC81088 (Get FASTA)   NCBI Sequence Viewer  
  BAC81089 (Get FASTA)   NCBI Sequence Viewer  
  BAC81090 (Get FASTA)   NCBI Sequence Viewer  
  BAC81091 (Get FASTA)   NCBI Sequence Viewer  
  BAC81092 (Get FASTA)   NCBI Sequence Viewer  
  BAC81093 (Get FASTA)   NCBI Sequence Viewer  
  BAC81094 (Get FASTA)   NCBI Sequence Viewer  
  BAC81095 (Get FASTA)   NCBI Sequence Viewer  
  BAC81096 (Get FASTA)   NCBI Sequence Viewer  
  BAC81097 (Get FASTA)   NCBI Sequence Viewer  
  BAC81098 (Get FASTA)   NCBI Sequence Viewer  
  BAC81099 (Get FASTA)   NCBI Sequence Viewer  
  BAC81137 (Get FASTA)   NCBI Sequence Viewer  
  BAG63815 (Get FASTA)   NCBI Sequence Viewer  
  CAC84084 (Get FASTA)   NCBI Sequence Viewer  
  CAZ90628 (Get FASTA)   NCBI Sequence Viewer  
  EAX05314 (Get FASTA)   NCBI Sequence Viewer  
  EAX05315 (Get FASTA)   NCBI Sequence Viewer  
  EAX05316 (Get FASTA)   NCBI Sequence Viewer  
  EAX05317 (Get FASTA)   NCBI Sequence Viewer  
  EAX05318 (Get FASTA)   NCBI Sequence Viewer  
  Q93074 (Get FASTA)   NCBI Sequence Viewer  
Reference Sequences
RefSeq Acc Id: NP_005111   ⟸   NM_005120
- UniProtKB: Q93074 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: ENSP00000333125   ⟸   ENST00000333646
RefSeq Acc Id: ENSP00000363193   ⟸   ENST00000374080
RefSeq Acc Id: ENSP00000363215   ⟸   ENST00000374102
RefSeq Acc Id: ENSP00000399084   ⟸   ENST00000429213
RefSeq Acc Id: ENSP00000404373   ⟸   ENST00000444034
Protein Domains
Med12   Med12-LCEWAV   Med12-PQL

Promoters
RGD ID:6809037
Promoter ID:HG_KWN:67160
Type:CpG-Island
SO ACC ID:SO:0000170
Source:MPROMDB
Tissues & Cell Lines:CD4+TCell,   CD4+TCell_12Hour,   HeLa_S3,   Jurkat,   K562,   Lymphoblastoid,   NB4
Transcripts:ENST00000333646,   NM_005120,   OTTHUMT00000057107,   OTTHUMT00000057108,   UC004DYZ.1
Position:
Human AssemblyChrPosition (strand)Source
Build 36X70,254,821 - 70,255,482 (+)MPROMDB
RGD ID:6809041
Promoter ID:HG_KWN:67161
Type:CpG-Island
SO ACC ID:SO:0000170
Source:MPROMDB
Tissues & Cell Lines:Lymphoblastoid
Transcripts:UC004DZA.1
Position:
Human AssemblyChrPosition (strand)Source
Build 36X70,255,741 - 70,256,627 (+)MPROMDB
RGD ID:6809039
Promoter ID:HG_KWN:67162
Type:Non-CpG
SO ACC ID:SO:0000170
Source:MPROMDB
Tissues & Cell Lines:K562,   Lymphoblastoid
Transcripts:OTTHUMT00000057110
Position:
Human AssemblyChrPosition (strand)Source
Build 36X70,262,276 - 70,263,272 (+)MPROMDB
RGD ID:6809040
Promoter ID:HG_KWN:67163
Type:Non-CpG
SO ACC ID:SO:0000170
Source:MPROMDB
Tissues & Cell Lines:Lymphoblastoid
Transcripts:OTTHUMT00000057111
Position:
Human AssemblyChrPosition (strand)Source
Build 36X70,263,926 - 70,264,997 (+)MPROMDB
RGD ID:6809352
Promoter ID:HG_KWN:67164
Type:Non-CpG
SO ACC ID:SO:0000170
Source:MPROMDB
Tissues & Cell Lines:CD4+TCell,   CD4+TCell_12Hour,   HeLa_S3,   K562,   Lymphoblastoid,   NB4
Transcripts:OTTHUMT00000057106,   OTTHUMT00000057112,   OTTHUMT00000057114,   UC010NLA.1
Position:
Human AssemblyChrPosition (strand)Source
Build 36X70,264,776 - 70,266,327 (+)MPROMDB
RGD ID:13627398
Promoter ID:EPDNEW_H28974
Type:initiation region
Name:MED12_1
Description:mediator complex subunit 12
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Alternative Promoters:null; see alsoEPDNEW_H28975  
Experiment Methods:Single-end sequencing.; Paired-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh38X71,118,596 - 71,118,656EPDNEW
RGD ID:13627400
Promoter ID:EPDNEW_H28975
Type:initiation region
Name:MED12_2
Description:mediator complex subunit 12
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Alternative Promoters:null; see alsoEPDNEW_H28974  
Experiment Methods:Single-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh38X71,118,729 - 71,118,789EPDNEW

Clinical Variants
Name Type Condition(s) Position(s) Clinical significance
NM_005120.3(MED12):c.6294G>A (p.Gln2098=) single nucleotide variant FG syndrome 1 [RCV000549501] ChrX:71141256 [GRCh38]
ChrX:70361106 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3745C>T (p.Leu1249Phe) single nucleotide variant FG syndrome 1 [RCV000552501] ChrX:71129733 [GRCh38]
ChrX:70349583 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5989G>T (p.Gly1997Cys) single nucleotide variant FG syndrome 1 [RCV000559892] ChrX:71137888 [GRCh38]
ChrX:70357738 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.845G>A (p.Arg282Gln) single nucleotide variant not specified [RCV000523199] ChrX:71121436 [GRCh38]
ChrX:70341286 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6288_6290GCA[5] (p.Gln2114_Gln2115del) microsatellite Cardiovascular phenotype [RCV000621534]|FG syndrome 1 [RCV000550260]|History of neurodevelopmental disorder [RCV000721080] ChrX:71141248..71141253 [GRCh38]
ChrX:70361098..70361103 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4425A>G (p.Leu1475=) single nucleotide variant FG syndrome 1 [RCV000553828] ChrX:71132854 [GRCh38]
ChrX:70352704 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.6273G>A (p.Gln2091=) single nucleotide variant FG syndrome 1 [RCV000560661] ChrX:71141235 [GRCh38]
ChrX:70361085 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1416C>T (p.Asp472=) single nucleotide variant not provided [RCV000729051] ChrX:71122805 [GRCh38]
ChrX:70342655 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5253G>A (p.Pro1751=) single nucleotide variant not provided [RCV000546591] ChrX:71136508 [GRCh38]
ChrX:70356358 [GRCh37]
ChrX:Xq13.1
likely benign
GRCh38/hg38 Xp22.33-q28(chrX:10701-156003242)x3 copy number gain See cases [RCV000133911] ChrX:10701..156003242 [GRCh38]
ChrX:60701..155232907 [GRCh37]
ChrX:701..154886101 [NCBI36]
ChrX:Xp22.33-q28
pathogenic|likely pathogenic|conflicting data from submitters
NM_005120.3(MED12):c.6422G>A (p.Gly2141Glu) single nucleotide variant not provided [RCV000522221] ChrX:71141896 [GRCh38]
ChrX:70361746 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1671C>T (p.Ser557=) single nucleotide variant FG syndrome 1 [RCV000551580] ChrX:71123647 [GRCh38]
ChrX:70343497 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1547G>A (p.Arg516His) single nucleotide variant not provided [RCV000520254] ChrX:71123156 [GRCh38]
ChrX:70343006 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.3(MED12):c.2881C>T (p.Arg961Trp) single nucleotide variant Corpus callosum, agenesis of [RCV000415294]|FG syndrome 1 [RCV000012276]|Inborn genetic diseases [RCV001266857]|Intellectual disability [RCV001261368]|Ohdo syndrome, X-linked [RCV001330015]|X-linked mental retardation with marfanoid habitus syndrome [RCV000763632] ChrX:71127367 [GRCh38]
ChrX:70347217 [GRCh37]
ChrX:Xq13.1
pathogenic|likely pathogenic
NM_005120.3(MED12):c.3020A>G (p.Asn1007Ser) single nucleotide variant X-linked mental retardation with marfanoid habitus syndrome [RCV000012277] ChrX:71127931 [GRCh38]
ChrX:70347781 [GRCh37]
ChrX:Xq13.1
pathogenic
NM_005120.3(MED12):c.3443G>A (p.Arg1148His) single nucleotide variant Ohdo syndrome, X-linked [RCV000043499]|not provided [RCV001268310] ChrX:71128686 [GRCh38]
ChrX:70348536 [GRCh37]
ChrX:Xq13.1
pathogenic
NM_005120.3(MED12):c.3493T>C (p.Ser1165Pro) single nucleotide variant Ohdo syndrome, X-linked [RCV000043500] ChrX:71129131 [GRCh38]
ChrX:70348981 [GRCh37]
ChrX:Xq13.1
pathogenic
NM_005120.3(MED12):c.5185C>A (p.His1729Asn) single nucleotide variant Ohdo syndrome, X-linked [RCV000043501] ChrX:71136440 [GRCh38]
ChrX:70356290 [GRCh37]
ChrX:Xq13.1
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:3092486-155699618)x2 copy number gain See cases [RCV000050889] ChrX:3092486..155699618 [GRCh38]
ChrX:3010527..154929279 [GRCh37]
ChrX:3020527..154582473 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:20140-155699618)x3 copy number gain See cases [RCV000050810] ChrX:20140..155699618 [GRCh38]
ChrX:70140..154929279 [GRCh37]
ChrX:10140..154582473 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:20140-155699618)x1 copy number loss See cases [RCV000050811] ChrX:20140..155699618 [GRCh38]
ChrX:70140..154929279 [GRCh37]
ChrX:10140..154582473 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156013167)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000050385]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000050385]|See cases [RCV000050385] ChrX:10679..156013167 [GRCh38]
ChrX:60679..155242832 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022206)x1 copy number loss See cases [RCV000050699] ChrX:10679..156022206 [GRCh38]
ChrX:60679..155251871 [GRCh37]
ChrX:679..154905065 [NCBI36]
ChrX:Xp22.33-q28
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 Xp22.33-q28(chrX:10679-156013167)x1 copy number loss Global developmental delay [RCV000050386]|See cases [RCV000050386] ChrX:10679..156013167 [GRCh38]
ChrX:60679..155242832 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022206)x3 copy number gain See cases [RCV000050697] ChrX:10679..156022206 [GRCh38]
ChrX:60679..155251871 [GRCh37]
ChrX:679..154905065 [NCBI36]
ChrX:Xp22.33-q28
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 Xp11.21-q28(chrX:57372584-155996431)x1 copy number loss See cases [RCV000051665] ChrX:57372584..155996431 [GRCh38]
ChrX:57399017..155226096 [GRCh37]
ChrX:57415742..154879290 [NCBI36]
ChrX:Xp11.21-q28
pathogenic
GRCh38/hg38 Xq11.1-28(chrX:63279794-155939524)x1 copy number loss See cases [RCV000051666] ChrX:63279794..155939524 [GRCh38]
ChrX:62499671..155169188 [GRCh37]
ChrX:62416396..154822382 [NCBI36]
ChrX:Xq11.1-28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26101-155999293)x3 copy number gain See cases [RCV000052322] ChrX:26101..155999293 [GRCh38]
ChrX:76101..155228958 [GRCh37]
ChrX:16101..154882152 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:2790845-155699618)x3 copy number gain See cases [RCV000052359] ChrX:2790845..155699618 [GRCh38]
ChrX:2708886..154929279 [GRCh37]
ChrX:2718886..154582473 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:237659-156022362)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052327]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052327]|See cases [RCV000052327] ChrX:237659..156022362 [GRCh38]
ChrX:154326..155252027 [GRCh37]
ChrX:94326..154905221 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:27245-155996431)x3 copy number gain See cases [RCV000052324] ChrX:27245..155996431 [GRCh38]
ChrX:77245..155226096 [GRCh37]
ChrX:17245..154879290 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xq11.1-13.1(chrX:62712219-71136309)x2 copy number gain See cases [RCV000052415] ChrX:62712219..71136309 [GRCh38]
ChrX:61931689..70356159 [GRCh37]
ChrX:61848414..70272884 [NCBI36]
ChrX:Xq11.1-13.1
pathogenic
GRCh38/hg38 Xq12-21.1(chrX:67621041-76868590)x2 copy number gain See cases [RCV000052416] ChrX:67621041..76868590 [GRCh38]
ChrX:66840883..76009501 [GRCh37]
ChrX:66757608..76005403 [NCBI36]
ChrX:Xq12-21.1
pathogenic
GRCh38/hg38 Xq12-13.3(chrX:68382004-75243150)x2 copy number gain See cases [RCV000052417] ChrX:68382004..75243150 [GRCh38]
ChrX:67601846..74462985 [GRCh37]
ChrX:67518571..74379710 [NCBI36]
ChrX:Xq12-13.3
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:40704-156022362)x3 copy number gain See cases [RCV000052325] ChrX:40704..156022362 [GRCh38]
ChrX:90704..155252027 [GRCh37]
ChrX:30704..154905221 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26102-155996431)x1 copy number loss Global developmental delay [RCV000052986]|Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052987]|Intellectual functioning disability [RCV000052988]|Global developmental delay [RCV000052989]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052987]|See cases [RCV000052986] ChrX:26102..155996431 [GRCh38]
ChrX:76102..155226096 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q22.1(chrX:675360-100368517)x1 copy number loss See cases [RCV000053005] ChrX:675360..100368517 [GRCh38]
ChrX:636095..99623515 [GRCh37]
ChrX:556095..99510171 [NCBI36]
ChrX:Xp22.33-q22.1
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:14245-155999293)x1 copy number loss Hypoplastic left heart [RCV000052982]|See cases [RCV000052982] ChrX:14245..155999293 [GRCh38]
ChrX:64245..155228958 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26102-155996431)x3 copy number gain Global developmental delay [RCV000052984]|Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052985]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052985]|See cases [RCV000052984] ChrX:26102..155996431 [GRCh38]
ChrX:76102..155226096 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.2873G>A (p.Gly958Glu) single nucleotide variant FG syndrome 1 [RCV000055909] ChrX:71127359 [GRCh38]
ChrX:70347209 [GRCh37]
ChrX:Xq13.1
pathogenic
NM_005120.3(MED12):c.100-1_139del deletion Uterine leiomyoma [RCV000077816] ChrX:71119371..71119411 [GRCh38]
ChrX:70339221..70339261 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.100_141del (p.Asp34_Asn47del) deletion Uterine leiomyoma [RCV000077817] ChrX:71119373..71119414 [GRCh38]
ChrX:70339223..70339264 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.100-8T>A single nucleotide variant Uterine leiomyoma [RCV000077818] ChrX:71119365 [GRCh38]
ChrX:70339215 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.103_138del (p.Glu35_Asn46del) deletion Uterine leiomyoma [RCV000077819] ChrX:71119374..71119409 [GRCh38]
ChrX:70339224..70339259 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.107T>G (p.Leu36Arg) single nucleotide variant Uterine leiomyoma [RCV000077820] ChrX:71119380 [GRCh38]
ChrX:70339230 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.107_111delinsGC (p.Leu36_Thr37delinsArg) indel Uterine leiomyoma [RCV000077821] ChrX:71119380..71119384 [GRCh38]
ChrX:70339230..70339234 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.111_155del (p.Ala38_Ser52del) deletion Uterine leiomyoma [RCV000077822] ChrX:71119383..71119427 [GRCh38]
ChrX:70339233..70339277 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.113_121del (p.Ala38_Asn40del) deletion Uterine leiomyoma [RCV000077823] ChrX:71119385..71119393 [GRCh38]
ChrX:70339235..70339243 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.117_122del (p.Asn40_Val41del) deletion Uterine leiomyoma [RCV000077824] ChrX:71119389..71119394 [GRCh38]
ChrX:70339239..70339244 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.118_132del (p.Asn40_Gly44del) deletion Uterine leiomyoma [RCV000077825] ChrX:71119391..71119405 [GRCh38]
ChrX:70339241..70339255 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.118_134delinsTA (p.Asn40_Phe45delinsTyr) indel Uterine leiomyoma [RCV000077826] ChrX:71119391..71119407 [GRCh38]
ChrX:70339241..70339257 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.118_146delinsTT (p.Asn40_Pro49delinsPhe) indel Uterine leiomyoma [RCV000077827] ChrX:71119391..71119419 [GRCh38]
ChrX:70339241..70339269 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.122_148del (p.Val41_Pro49del) deletion Uterine leiomyoma [RCV000077828] ChrX:71119393..71119419 [GRCh38]
ChrX:70339243..70339269 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.122_163del (p.Val41_Asp54del) deletion Uterine leiomyoma [RCV000077829] ChrX:71119392..71119433 [GRCh38]
ChrX:70339242..70339283 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.123_152del (p.Lys42_Val51del) deletion Uterine leiomyoma [RCV000077830] ChrX:71119393..71119422 [GRCh38]
ChrX:70339243..70339272 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.126_131del (p.Lys42_Gly44delinsAsn) deletion Uterine leiomyoma [RCV000077831] ChrX:71119399..71119404 [GRCh38]
ChrX:70339249..70339254 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.126_140del (p.Lys42_Asn46del) deletion Uterine leiomyoma [RCV000077832] ChrX:71119397..71119411 [GRCh38]
ChrX:70339247..70339261 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.128A>C (p.Gln43Pro) single nucleotide variant Uterine leiomyoma [RCV000077833] ChrX:71119401 [GRCh38]
ChrX:70339251 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.129_137del (p.Gln43_Asn46delinsHis) deletion Uterine leiomyoma [RCV000077834] ChrX:71119401..71119409 [GRCh38]
ChrX:70339251..70339259 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.129_143del (p.Gly44_Gln48del) deletion Uterine leiomyoma [RCV000077835] ChrX:71119400..71119414 [GRCh38]
ChrX:70339250..70339264 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.130G>A (p.Gly44Ser) single nucleotide variant Angiosarcoma [RCV000505562]|Uterine leiomyoma [RCV000077836] ChrX:71119403 [GRCh38]
ChrX:70339253 [GRCh37]
ChrX:Xq13.1
other|not provided
NM_005120.3(MED12):c.130G>C (p.Gly44Arg) single nucleotide variant Uterine leiomyoma [RCV000077837] ChrX:71119403 [GRCh38]
ChrX:70339253 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.130G>T (p.Gly44Cys) single nucleotide variant Uterine leiomyoma [RCV000077838] ChrX:71119403 [GRCh38]
ChrX:70339253 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.131G>A (p.Gly44Asp) single nucleotide variant Nephroblastoma [RCV000505615]|Uterine leiomyoma [RCV000077839] ChrX:71119404 [GRCh38]
ChrX:70339254 [GRCh37]
ChrX:Xq13.1
other|not provided
NM_005120.3(MED12):c.131G>C (p.Gly44Ala) single nucleotide variant Uterine leiomyoma [RCV000077840] ChrX:71119404 [GRCh38]
ChrX:70339254 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.131G>T (p.Gly44Val) single nucleotide variant Uterine leiomyoma [RCV000077841] ChrX:71119404 [GRCh38]
ChrX:70339254 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.133_144del (p.Phe45_Gln48del) deletion Uterine leiomyoma [RCV000077842] ChrX:71119406..71119417 [GRCh38]
ChrX:70339256..70339267 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.149_163del (p.Ala50_Asp54del) deletion Uterine leiomyoma [RCV000077843] ChrX:71119420..71119434 [GRCh38]
ChrX:70339270..70339284 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.2849+14C>T single nucleotide variant not provided [RCV000081259] ChrX:71127146 [GRCh38]
ChrX:70346996 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3844G>A (p.Val1282Met) single nucleotide variant not provided [RCV000494139] ChrX:71129832 [GRCh38]
ChrX:70349682 [GRCh37]
ChrX:Xq13.1
likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.3930A>C (p.Pro1310=) single nucleotide variant Cardiovascular phenotype [RCV000621594]|FG syndrome 1 [RCV000860367]|History of neurodevelopmental disorder [RCV000715259]|not specified [RCV000081261] ChrX:71130097 [GRCh38]
ChrX:70349947 [GRCh37]
ChrX:Xq13.1
benign|conflicting interpretations of pathogenicity|conflicting data from submitters
NM_005120.3(MED12):c.4416-77CTCTT[11] microsatellite not specified [RCV000081262] ChrX:71132768..71132772 [GRCh38]
ChrX:70352618..70352622 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.4416-77CTCTT[13] microsatellite not provided [RCV000081263] ChrX:71132767..71132768 [GRCh38]
ChrX:70352617..70352618 [GRCh37]
ChrX:Xq13.1
benign|uncertain significance
NM_005120.3(MED12):c.4416-77CTCTT[6] microsatellite not specified [RCV000081264] ChrX:71132768..71132797 [GRCh38]
ChrX:70352618..70352647 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.4971T>C (p.Leu1657=) single nucleotide variant not provided [RCV000081265] ChrX:71135199 [GRCh38]
ChrX:70355049 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5316G>A (p.Pro1772=) single nucleotide variant not provided [RCV000081266] ChrX:71136571 [GRCh38]
ChrX:70356421 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5535C>T (p.Asn1845=) single nucleotide variant Cardiovascular phenotype [RCV000243489]|FG syndrome 1 [RCV000460000]|History of neurodevelopmental disorder [RCV000716061]|not specified [RCV000081267] ChrX:71137013 [GRCh38]
ChrX:70356863 [GRCh37]
ChrX:Xq13.1
benign|conflicting interpretations of pathogenicity|conflicting data from submitters
NM_005120.3(MED12):c.5711C>T (p.Ala1904Val) single nucleotide variant Cardiovascular phenotype [RCV000248528]|FG syndrome 1 [RCV001086459]|not provided [RCV000081268]|not specified [RCV000121331] ChrX:71137346 [GRCh38]
ChrX:70357196 [GRCh37]
ChrX:Xq13.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided
NM_005120.3(MED12):c.6348_6359dup (p.His2116_Gln2119dup) duplication Cardiovascular phenotype [RCV000620099]|FG syndrome 1 [RCV000225918]|History of neurodevelopmental disorder [RCV000715884]|not specified [RCV000081269] ChrX:71141301..71141302 [GRCh38]
ChrX:70361151..70361152 [GRCh37]
ChrX:Xq13.1
benign|likely benign|conflicting interpretations of pathogenicity
NM_005120.3(MED12):c.736-8A>C single nucleotide variant FG syndrome 1 [RCV000860366]|not specified [RCV000081270] ChrX:71121319 [GRCh38]
ChrX:70341169 [GRCh37]
ChrX:Xq13.1
benign|conflicting interpretations of pathogenicity|conflicting data from submitters
NM_005120.3(MED12):c.3785G>A (p.Arg1262Lys) single nucleotide variant not provided [RCV000117596] ChrX:71129773 [GRCh38]
ChrX:70349623 [GRCh37]
ChrX:Xq13.1
conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.934G>C (p.Val312Leu) single nucleotide variant Cardiovascular phenotype [RCV000246879]|FG syndrome 1 [RCV000862608]|X-linked mental retardation with marfanoid habitus syndrome [RCV001196895]|not specified [RCV000117597] ChrX:71121649 [GRCh38]
ChrX:70341499 [GRCh37]
ChrX:Xq13.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.2259G>A (p.Arg753=) single nucleotide variant Cardiovascular phenotype [RCV000243503]|FG syndrome 1 [RCV000457091]|History of neurodevelopmental disorder [RCV000715801]|not specified [RCV000117598] ChrX:71125383 [GRCh38]
ChrX:70345233 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.3797G>A (p.Arg1266His) single nucleotide variant not provided [RCV000117599]|not specified [RCV000259098] ChrX:71129785 [GRCh38]
ChrX:70349635 [GRCh37]
ChrX:Xq13.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.3868-7T>A single nucleotide variant not provided [RCV000117600] ChrX:71130028 [GRCh38]
ChrX:70349878 [GRCh37]
ChrX:Xq13.1
conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.5650G>A (p.Gly1884Ser) single nucleotide variant Cardiovascular phenotype [RCV000248678]|FG syndrome 1 [RCV001080331]|History of neurodevelopmental disorder [RCV000718173]|not provided [RCV000224927]|not specified [RCV000117601] ChrX:71137285 [GRCh38]
ChrX:70357135 [GRCh37]
ChrX:Xq13.1
pathogenic|benign|likely benign|conflicting interpretations of pathogenicity|not provided
NM_005120.3(MED12):c.4111C>T (p.Pro1371Ser) single nucleotide variant FG syndrome 1 [RCV000228384]|not specified [RCV000121329] ChrX:71131613 [GRCh38]
ChrX:70351463 [GRCh37]
ChrX:Xq13.1
likely benign|not provided
NM_005120.3(MED12):c.5593A>G (p.Met1865Val) single nucleotide variant FG syndrome 1 [RCV001034727]|not specified [RCV000121330] ChrX:71137228 [GRCh38]
ChrX:70357078 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance|not provided
NM_005120.3(MED12):c.568A>G (p.Ile190Val) single nucleotide variant FG syndrome 1 [RCV000633692]|not specified [RCV000121332] ChrX:71120985 [GRCh38]
ChrX:70340835 [GRCh37]
ChrX:Xq13.1
uncertain significance|not provided
NM_005120.3(MED12):c.1313G>A (p.Arg438His) single nucleotide variant not specified [RCV000121333] ChrX:71122572 [GRCh38]
ChrX:70342422 [GRCh37]
ChrX:Xq13.1
not provided
NM_005120.3(MED12):c.1248+15T>C single nucleotide variant not provided [RCV000514187]|not specified [RCV000193778] ChrX:71122361 [GRCh38]
ChrX:70342211 [GRCh37]
ChrX:Xq13.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022826)x4 copy number gain See cases [RCV000133654] ChrX:10679..156022826 [GRCh38]
ChrX:60679..155252491 [GRCh37]
ChrX:679..154905685 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.6177_6182ACAGCA[3] (p.Gln2075_Gln2076dup) microsatellite FG syndrome 1 [RCV000871559]|not specified [RCV000178504] ChrX:71140761..71140762 [GRCh38]
ChrX:70360611..70360612 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.1562G>A (p.Arg521His) single nucleotide variant not specified [RCV000211106] ChrX:71123171 [GRCh38]
ChrX:70343021 [GRCh37]
ChrX:Xq13.1
uncertain significance
GRCh38/hg38 Xp22.33-q28(chrX:10701-155978689)x1 copy number loss See cases [RCV000133792] ChrX:10701..155978689 [GRCh38]
ChrX:60701..155208354 [GRCh37]
ChrX:701..154861548 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.6208_6210CAG[8] (p.Gln2076dup) microsatellite Cardiovascular phenotype [RCV000253558]|FG syndrome 1 [RCV000633697]|History of neurodevelopmental disorder [RCV000721006]|not provided [RCV001172017]|not specified [RCV000153024] ChrX:71140797..71140798 [GRCh38]
ChrX:70360647..70360648 [GRCh37]
ChrX:Xq13.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.6241_6243CAG[7] (p.Gln2086dup) microsatellite FG syndrome 1 [RCV000461504]|not specified [RCV000153025] ChrX:71140829..71140830 [GRCh38]
ChrX:70360679..70360680 [GRCh37]
ChrX:Xq13.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
GRCh38/hg38 Xp22.33-q28(chrX:10679-156013167)x1 copy number loss See cases [RCV000050386] ChrX:10679..156013167 [GRCh38]
ChrX:60679..155242832 [GRCh37]
ChrX:679..154896026 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156013167)x3 copy number gain See cases [RCV000050385] ChrX:10679..156013167 [GRCh38]
ChrX:60679..155242832 [GRCh37]
ChrX:679..154896026 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26102-155996431)x1 copy number loss See cases [RCV000052986] ChrX:26102..155996431 [GRCh38]
ChrX:76102..155226096 [GRCh37]
ChrX:16102..154879290 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26102-155996431)x3 copy number gain See cases [RCV000052984] ChrX:26102..155996431 [GRCh38]
ChrX:76102..155226096 [GRCh37]
ChrX:16102..154879290 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:14245-155999293)x1 copy number loss See cases [RCV000052982] ChrX:14245..155999293 [GRCh38]
ChrX:64245..155228958 [GRCh37]
ChrX:4245..154882152 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:20297-155999253)x3 copy number gain See cases [RCV000134564] ChrX:20297..155999253 [GRCh38]
ChrX:70297..155228918 [GRCh37]
ChrX:10297..154882112 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xq11.1-21.1(chrX:62712219-78605009)x3 copy number gain See cases [RCV000134569] ChrX:62712219..78605009 [GRCh38]
ChrX:61931689..77860506 [GRCh37]
ChrX:61848414..77747162 [NCBI36]
ChrX:Xq11.1-21.1
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10701-156003242)x1 copy number loss See cases [RCV000133947] ChrX:10701..156003242 [GRCh38]
ChrX:60701..155232907 [GRCh37]
ChrX:701..154886101 [NCBI36]
ChrX:Xp22.33-q28
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 Xq11.1-28(chrX:62712230-155978888)x3 copy number gain See cases [RCV000134025] ChrX:62712230..155978888 [GRCh38]
ChrX:61931700..155208553 [GRCh37]
ChrX:61848425..154861747 [NCBI36]
ChrX:Xq11.1-28
pathogenic
GRCh38/hg38 Xp21.1-q28(chrX:37076284-156016920)x1 copy number loss See cases [RCV000135300] ChrX:37076284..156016920 [GRCh38]
ChrX:37094357..155246585 [GRCh37]
ChrX:37004278..154899779 [NCBI36]
ChrX:Xp21.1-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:20297-156026127)x1 copy number loss See cases [RCV000135321] ChrX:20297..156026127 [GRCh38]
ChrX:70297..155255792 [GRCh37]
ChrX:10297..154908986 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp11.22-q21.31(chrX:53985575-92203108)x1 copy number loss See cases [RCV000135306] ChrX:53985575..92203108 [GRCh38]
ChrX:54012008..91458107 [GRCh37]
ChrX:54028733..91344763 [NCBI36]
ChrX:Xp11.22-q21.31
pathogenic
GRCh38/hg38 Xp21.1-q28(chrX:36237706-156022206)x1 copy number loss See cases [RCV000135552] ChrX:36237706..156022206 [GRCh38]
ChrX:36255823..155251871 [GRCh37]
ChrX:36165744..154905065 [NCBI36]
ChrX:Xp21.1-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10701-156003229)x1 copy number loss See cases [RCV000136097] ChrX:10701..156003229 [GRCh38]
ChrX:60701..155232894 [GRCh37]
ChrX:701..154886088 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:40904-155998166)x1 copy number loss See cases [RCV000136478] ChrX:40904..155998166 [GRCh38]
ChrX:90904..155227831 [GRCh37]
ChrX:30904..154881025 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xq13.1(chrX:70974174-71207055)x2 copy number gain See cases [RCV000136018] ChrX:70974174..71207055 [GRCh38]
ChrX:70194024..70426905 [GRCh37]
ChrX:70110749..70343630 [NCBI36]
ChrX:Xq13.1
uncertain significance
GRCh38/hg38 Xp22.33-q25(chrX:10701-128393708) copy number loss See cases [RCV000136094] ChrX:10701..128393708 [GRCh38]
ChrX:60701..127527686 [GRCh37]
ChrX:701..127355367 [NCBI36]
ChrX:Xp22.33-q25
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10001-156030895)x1 copy number loss See cases [RCV000136005] ChrX:10001..156030895 [GRCh38]
ChrX:60001..155260560 [GRCh37]
ChrX:1..154913754 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q13.3(chrX:10679-76420505)x3 copy number gain See cases [RCV000137137] ChrX:10679..76420505 [GRCh38]
ChrX:60679..75640898 [GRCh37]
ChrX:679..75557302 [NCBI36]
ChrX:Xp22.33-q13.3
pathogenic|likely benign
GRCh38/hg38 Xp22.33-q28(chrX:2765636-155522304)x3 copy number gain See cases [RCV000136791] ChrX:2765636..155522304 [GRCh38]
ChrX:2683677..154751965 [GRCh37]
ChrX:2693677..154405159 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:2782275-155611794)x2 copy number gain See cases [RCV000136841] ChrX:2782275..155611794 [GRCh38]
ChrX:2700316..154785891 [GRCh37]
ChrX:2710316..154494649 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xq11.1-28(chrX:62561604-156003242)x3 copy number gain See cases [RCV000137553] ChrX:62561604..156003242 [GRCh38]
ChrX:61781074..155232907 [GRCh37]
ChrX:61697799..154886101 [NCBI36]
ChrX:Xq11.1-28
pathogenic
GRCh38/hg38 Xp11.23-q22.1(chrX:49100536-102174742)x1 copy number loss See cases [RCV000137414] ChrX:49100536..102174742 [GRCh38]
ChrX:48957474..101429714 [GRCh37]
ChrX:48844418..101316370 [NCBI36]
ChrX:Xp11.23-q22.1
pathogenic|likely benign
GRCh38/hg38 Xp22.33-q22.3(chrX:10701-106113403)x1 copy number loss See cases [RCV000137886] ChrX:10701..106113403 [GRCh38]
ChrX:60701..105357395 [GRCh37]
ChrX:701..105244051 [NCBI36]
ChrX:Xp22.33-q22.3
pathogenic
GRCh38/hg38 Xp22.2-q27.3(chrX:13020141-143473520)x1 copy number loss See cases [RCV000138678] ChrX:13020141..143473520 [GRCh38]
ChrX:13038260..142561303 [GRCh37]
ChrX:12948181..142388969 [NCBI36]
ChrX:Xp22.2-q27.3
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:1085618-155699644)x1 copy number loss See cases [RCV000139278] ChrX:1085618..155699644 [GRCh38]
ChrX:1118268..154929305 [GRCh37]
ChrX:1038268..154582499 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xq11.1-28(chrX:62712219-156003242)x3 copy number gain See cases [RCV000139416] ChrX:62712219..156003242 [GRCh38]
ChrX:61931689..155232907 [GRCh37]
ChrX:61848414..154886101 [NCBI36]
ChrX:Xq11.1-28
pathogenic|likely benign
GRCh38/hg38 Xp22.33-q21.31(chrX:10701-88318651)x1 copy number loss See cases [RCV000139352] ChrX:10701..88318651 [GRCh38]
ChrX:60701..87573652 [GRCh37]
ChrX:701..87460308 [NCBI36]
ChrX:Xp22.33-q21.31
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251880-156004181)x3 copy number gain See cases [RCV000139888] ChrX:251880..156004181 [GRCh38]
ChrX:168547..155233846 [GRCh37]
ChrX:108547..154887040 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
NM_005120.2(MED12):c.6339_6340insCAGCAACACCAG insertion not specified [RCV000203010] ChrX:71141301..71141302 [GRCh38]
ChrX:70361151..70361152 [GRCh37]
ChrX:Xq13.1
benign
GRCh38/hg38 Xp22.33-q28(chrX:2299223-155992188)x3 copy number gain See cases [RCV000141400] ChrX:2299223..155992188 [GRCh38]
ChrX:2217264..155221853 [GRCh37]
ChrX:2227264..154875047 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:20297-156016920)x3 copy number gain See cases [RCV000141401] ChrX:20297..156016920 [GRCh38]
ChrX:70297..155246585 [GRCh37]
ChrX:10297..154899779 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251880-156004066)x4 copy number gain See cases [RCV000140786] ChrX:251880..156004066 [GRCh38]
ChrX:168547..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251880-156004066)x1 copy number loss See cases [RCV000140787] ChrX:251880..156004066 [GRCh38]
ChrX:168547..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic|conflicting data from submitters
GRCh38/hg38 Xp11.22-q24(chrX:50289384-119297604) copy number loss See cases [RCV000141742] ChrX:50289384..119297604 [GRCh38]
ChrX:50032384..118431567 [GRCh37]
ChrX:50049124..118315595 [NCBI36]
ChrX:Xp11.22-q24
pathogenic
GRCh38/hg38 Xq12-21.1(chrX:66445907-78172208)x3 copy number gain See cases [RCV000142336] ChrX:66445907..78172208 [GRCh38]
ChrX:65665749..77427705 [GRCh37]
ChrX:65582474..77314361 [NCBI36]
ChrX:Xq12-21.1
pathogenic
GRCh38/hg38 Xp22.33-q24(chrX:251879-118847157)x3 copy number gain See cases [RCV000142134] ChrX:251879..118847157 [GRCh38]
ChrX:168546..117981120 [GRCh37]
ChrX:108546..117865148 [NCBI36]
ChrX:Xp22.33-q24
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10701-156003229)x3 copy number gain See cases [RCV000142625] ChrX:10701..156003229 [GRCh38]
ChrX:60701..155232894 [GRCh37]
ChrX:701..154886088 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp11.22-q28(chrX:53144751-156003242)x1 copy number loss See cases [RCV000143349] ChrX:53144751..156003242 [GRCh38]
ChrX:53321095..155232907 [GRCh37]
ChrX:53190658..154886101 [NCBI36]
ChrX:Xp11.22-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251879-156004066)x1 copy number loss See cases [RCV000143441] ChrX:251879..156004066 [GRCh38]
ChrX:168546..155233731 [GRCh37]
ChrX:108546..154886925 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251879-156004066)x3 copy number gain See cases [RCV000143433] ChrX:251879..156004066 [GRCh38]
ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251880-156004066)x3 copy number gain See cases [RCV000143219] ChrX:251880..156004066 [GRCh38]
ChrX:168547..155233731 [GRCh37]
ChrX:108547..154886925 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp11.21-q13.3(chrX:56431359-76557419)x1 copy number loss See cases [RCV000143131] ChrX:56431359..76557419 [GRCh38]
ChrX:56457792..75777827 [GRCh37]
ChrX:56474517..75694231 [NCBI36]
ChrX:Xp11.21-q13.3
pathogenic
GRCh38/hg38 Xq13.1(chrX:71071787-71777197)x2 copy number gain See cases [RCV000143302] ChrX:71071787..71777197 [GRCh38]
ChrX:70291637..70997047 [GRCh37]
ChrX:70208362..70913772 [NCBI36]
ChrX:Xq13.1
uncertain significance
GRCh38/hg38 Xq13.1(chrX:71022322-71682982)x2 copy number gain See cases [RCV000143525] ChrX:71022322..71682982 [GRCh38]
ChrX:70242172..70902832 [GRCh37]
ChrX:70158897..70819557 [NCBI36]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6321_6335del (p.Gln2111_Gln2115del) deletion Cardiovascular phenotype [RCV000619880]|FG syndrome 1 [RCV000551015]|History of neurodevelopmental disorder [RCV000721060]|not specified [RCV000153026] ChrX:71141272..71141286 [GRCh38]
ChrX:70361122..70361136 [GRCh37]
ChrX:Xq13.1
benign|uncertain significance
NM_005120.3(MED12):c.438A>G (p.Leu146=) single nucleotide variant Cardiovascular phenotype [RCV000618426]|FG syndrome 1 [RCV000541216]|not specified [RCV000153478] ChrX:71120055 [GRCh38]
ChrX:70339905 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.2886C>T (p.Ser962=) single nucleotide variant Cardiovascular phenotype [RCV000618419]|FG syndrome 1 [RCV000229119]|History of neurodevelopmental disorder [RCV000719189]|not specified [RCV000153479] ChrX:71127372 [GRCh38]
ChrX:70347222 [GRCh37]
ChrX:Xq13.1
benign
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022206)x3 copy number gain See cases [RCV000148141] ChrX:10679..156022206 [GRCh38]
ChrX:60679..155251871 [GRCh37]
ChrX:679..154905065 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022206)x1 copy number loss See cases [RCV000148135] ChrX:10679..156022206 [GRCh38]
ChrX:60679..155251871 [GRCh37]
ChrX:679..154905065 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.4831C>G (p.Arg1611Gly) single nucleotide variant not provided [RCV000153023] ChrX:71134816 [GRCh38]
ChrX:70354666 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3204C>T (p.Pro1068=) single nucleotide variant Cardiovascular phenotype [RCV000253625]|FG syndrome 1 [RCV000230552]|History of neurodevelopmental disorder [RCV000721024]|not specified [RCV000225707] ChrX:71128115 [GRCh38]
ChrX:70347965 [GRCh37]
ChrX:Xq13.1
benign|likely benign|uncertain significance
NM_005120.3(MED12):c.4488C>T (p.Arg1496=) single nucleotide variant Cardiovascular phenotype [RCV000620107]|FG syndrome 1 [RCV000863032]|not specified [RCV000192683] ChrX:71132917 [GRCh38]
ChrX:70352767 [GRCh37]
ChrX:Xq13.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.6339A>G (p.Gln2113=) single nucleotide variant not specified [RCV000193874] ChrX:71141301 [GRCh38]
ChrX:70361151 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5418G>A (p.Pro1806=) single nucleotide variant not specified [RCV000193892] ChrX:71136896 [GRCh38]
ChrX:70356746 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1695T>A (p.Ile565=) single nucleotide variant Cardiovascular phenotype [RCV000617339]|FG syndrome 1 [RCV000460842]|not specified [RCV000194224] ChrX:71123671 [GRCh38]
ChrX:70343521 [GRCh37]
ChrX:Xq13.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.6285A>G (p.Gln2095=) single nucleotide variant Cardiovascular phenotype [RCV000618261]|not provided [RCV000178534] ChrX:71141247 [GRCh38]
ChrX:70361097 [GRCh37]
ChrX:Xq13.1
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.6288_6290GCA[9] (p.Gln2114_Gln2115dup) microsatellite FG syndrome 1 [RCV000706173]|not provided [RCV000824717]|not specified [RCV000178535] ChrX:71141247..71141248 [GRCh38]
ChrX:70361097..70361098 [GRCh37]
ChrX:Xq13.1
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.2274T>C (p.Phe758=) single nucleotide variant not specified [RCV000194590] ChrX:71125398 [GRCh38]
ChrX:70345248 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.653C>T (p.Thr218Met) single nucleotide variant Cardiovascular phenotype [RCV000253128]|not provided [RCV000178900] ChrX:71121070 [GRCh38]
ChrX:70340920 [GRCh37]
ChrX:Xq13.1
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.381G>A (p.Thr127=) single nucleotide variant Cardiovascular phenotype [RCV000620351]|FG syndrome 1 [RCV001083528]|not provided [RCV000724071]|not specified [RCV000177224] ChrX:71119862 [GRCh38]
ChrX:70339712 [GRCh37]
ChrX:Xq13.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.4416-77CTCTT[16] microsatellite not provided [RCV000177652] ChrX:71132767..71132768 [GRCh38]
ChrX:70352617..70352618 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4620G>A (p.Val1540=) single nucleotide variant not provided [RCV000177790] ChrX:71134359 [GRCh38]
ChrX:70354209 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4669T>C (p.Trp1557Arg) single nucleotide variant not provided [RCV000592576] ChrX:71134408 [GRCh38]
ChrX:70354258 [GRCh37]
ChrX:Xq13.1
likely pathogenic|uncertain significance
NM_005120.3(MED12):c.5400+6C>T single nucleotide variant FG syndrome 1 [RCV001086702]|Intellectual disability [RCV001251841]|not provided [RCV000724242]|not specified [RCV000225701] ChrX:71136661 [GRCh38]
ChrX:70356511 [GRCh37]
ChrX:Xq13.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
GRCh37/hg19 Xp22.33-q28(chrX:71267-155246643)x3 copy number gain See cases [RCV000240122] ChrX:71267..155246643 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xq11.1-28(chrX:62063537-155246643)x3 copy number gain See cases [RCV000240143] ChrX:62063537..155246643 [GRCh37]
ChrX:Xq11.1-28
pathogenic
NM_005120.3(MED12):c.6288_6290GCA[10] (p.Gln2113_Gln2115dup) microsatellite FG syndrome 1 [RCV001208635]|not specified [RCV000192962] ChrX:71141247..71141248 [GRCh38]
ChrX:70361097..70361098 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1849A>G (p.Thr617Ala) single nucleotide variant Cardiovascular phenotype [RCV000622207]|X-linked mental retardation with marfanoid habitus syndrome [RCV000199251]|not provided [RCV000224083] ChrX:71124263 [GRCh38]
ChrX:70344113 [GRCh37]
ChrX:Xq13.1
likely pathogenic|uncertain significance
NM_005120.3(MED12):c.1807C>T (p.Leu603=) single nucleotide variant not specified [RCV000192456] ChrX:71124221 [GRCh38]
ChrX:70344071 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3063C>A (p.Phe1021Leu) single nucleotide variant not provided [RCV000192792] ChrX:71127974 [GRCh38]
ChrX:70347824 [GRCh37]
ChrX:Xq13.1
likely pathogenic|uncertain significance
NM_005120.3(MED12):c.3989T>G (p.Leu1330Arg) single nucleotide variant not specified [RCV000193647] ChrX:71130156 [GRCh38]
ChrX:70350006 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2128G>A (p.Val710Met) single nucleotide variant not specified [RCV000193668] ChrX:71125048 [GRCh38]
ChrX:70344898 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6208_6210CAG[9] (p.Gln2075_Gln2076dup) microsatellite FG syndrome 1 [RCV000866438]|History of neurodevelopmental disorder [RCV000718604]|not specified [RCV000200223] ChrX:71140797..71140798 [GRCh38]
ChrX:70360647..70360648 [GRCh37]
ChrX:Xq13.1
likely pathogenic|benign|likely benign|conflicting interpretations of pathogenicity
NM_005120.2(MED12):c.2449C>T (p.Arg817Cys) single nucleotide variant not specified [RCV000196501] ChrX:71126062 [GRCh38]
ChrX:70345912 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1028C>T (p.Ser343Leu) single nucleotide variant FG syndrome 1 [RCV000868543]|not specified [RCV000196724] ChrX:71121743 [GRCh38]
ChrX:70341593 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.3(MED12):c.1386G>T (p.Val462=) single nucleotide variant Cardiovascular phenotype [RCV000618012]|FG syndrome 1 [RCV000633701]|History of neurodevelopmental disorder [RCV000717989]|not specified [RCV000196766] ChrX:71122775 [GRCh38]
ChrX:70342625 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.3883C>T (p.Arg1295Cys) single nucleotide variant not provided [RCV000196935] ChrX:71130050 [GRCh38]
ChrX:70349900 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1101+18C>T single nucleotide variant not specified [RCV000200785] ChrX:71121834 [GRCh38]
ChrX:70341684 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.2(MED12):c.6313C>T (p.Gln2105Ter) single nucleotide variant not provided [RCV000200799] ChrX:71141275 [GRCh38]
ChrX:70361125 [GRCh37]
ChrX:Xq13.1
pathogenic
NM_005120.3(MED12):c.3210G>T (p.Arg1070Ser) single nucleotide variant FG syndrome 1 [RCV001295956]|not provided [RCV000197058] ChrX:71128296 [GRCh38]
ChrX:70348146 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.204+12_204+13del microsatellite FG syndrome 1 [RCV000227345]|not specified [RCV000197184] ChrX:71119487..71119488 [GRCh38]
ChrX:70339337..70339338 [GRCh37]
ChrX:Xq13.1
likely pathogenic|benign
NM_005120.3(MED12):c.2981+13G>A single nucleotide variant not specified [RCV000197322] ChrX:71127480 [GRCh38]
ChrX:70347330 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.6235A>G (p.Ile2079Val) single nucleotide variant not provided [RCV000197416] ChrX:71140825 [GRCh38]
ChrX:70360675 [GRCh37]
ChrX:Xq13.1
uncertain significance
GRCh37/hg19 Xp22.33-q28(chrX:176426-155250222)x3 copy number gain See cases [RCV000239843] ChrX:176426..155250222 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.5510G>C (p.Gly1837Ala) single nucleotide variant not specified [RCV000197590] ChrX:71136988 [GRCh38]
ChrX:70356838 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1039A>G (p.Ser347Gly) single nucleotide variant Cardiovascular phenotype [RCV000620563]|X-linked mental retardation with marfanoid habitus syndrome [RCV000766102]|not provided [RCV000197655] ChrX:71121754 [GRCh38]
ChrX:70341604 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6139A>G (p.Ile2047Val) single nucleotide variant not provided [RCV000197721] ChrX:71140729 [GRCh38]
ChrX:70360579 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2093G>A (p.Ser698Asn) single nucleotide variant FG syndrome 1 [RCV001244805]|not provided [RCV000197861] ChrX:71125013 [GRCh38]
ChrX:70344863 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.2(MED12):c.4211C>T (p.Ala1404Val) single nucleotide variant not provided [RCV000197941] ChrX:71132164 [GRCh38]
ChrX:70352014 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.2(MED12):c.1393A>G (p.Ser465Gly) single nucleotide variant not specified [RCV000197982] ChrX:71122782 [GRCh38]
ChrX:70342632 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5748+16G>T single nucleotide variant not specified [RCV000198049] ChrX:71137399 [GRCh38]
ChrX:70357249 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.2252A>G (p.Asn751Ser) single nucleotide variant not provided [RCV000198136] ChrX:71125376 [GRCh38]
ChrX:70345226 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6241_6243CAG[5] (p.Gln2086del) microsatellite Cardiovascular phenotype [RCV000622064]|FG syndrome 1 [RCV000544153]|History of neurodevelopmental disorder [RCV000718240]|not specified [RCV000198426] ChrX:71140830..71140832 [GRCh38]
ChrX:70360680..70360682 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.3(MED12):c.6150_6152GCA[4] (p.Gln2075_Gln2076del) microsatellite FG syndrome 1 [RCV001317523]|not specified [RCV000198584] ChrX:71140739..71140744 [GRCh38]
ChrX:70360589..70360594 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.2(MED12):c.2869C>T (p.His957Tyr) single nucleotide variant not provided [RCV000198701] ChrX:71127355 [GRCh38]
ChrX:70347205 [GRCh37]
ChrX:Xq13.1
pathogenic
NM_005120.3(MED12):c.4179A>C (p.Ser1393=) single nucleotide variant Cardiovascular phenotype [RCV000247788]|FG syndrome 1 [RCV001088216]|History of neurodevelopmental disorder [RCV000716617]|not provided [RCV000466649]|not specified [RCV000194870] ChrX:71132132 [GRCh38]
ChrX:70351982 [GRCh37]
ChrX:Xq13.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.4416-77CTCTT[7] microsatellite not specified [RCV000195418] ChrX:71132768..71132792 [GRCh38]
ChrX:70352618..70352642 [GRCh37]
ChrX:Xq13.1
likely pathogenic|benign
NM_005120.3(MED12):c.4115A>G (p.Asn1372Ser) single nucleotide variant Cardiovascular phenotype [RCV000247718]|FG syndrome 1 [RCV001085906]|not provided [RCV000198940] ChrX:71131617 [GRCh38]
ChrX:70351467 [GRCh37]
ChrX:Xq13.1
benign|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.4021C>T (p.Arg1341Trp) single nucleotide variant FG syndrome 1 [RCV000633693]|X-linked mental retardation with marfanoid habitus syndrome [RCV000789018]|not provided [RCV000199133] ChrX:71130188 [GRCh38]
ChrX:70350038 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6097A>G (p.Met2033Val) single nucleotide variant X-linked mental retardation with marfanoid habitus syndrome [RCV000766104]|not specified [RCV000195505] ChrX:71140687 [GRCh38]
ChrX:70360537 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1754G>A (p.Arg585Gln) single nucleotide variant not provided [RCV000195665] ChrX:71124168 [GRCh38]
ChrX:70344018 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4147G>A (p.Ala1383Thr) single nucleotide variant FG syndrome 1 [RCV000239402]|Inborn genetic diseases [RCV000622415]|not provided [RCV000195723] ChrX:71132100 [GRCh38]
ChrX:70351950 [GRCh37]
ChrX:Xq13.1
pathogenic|likely pathogenic|uncertain significance
NM_005120.2(MED12):c.204G>A (p.Lys68=) single nucleotide variant not specified [RCV000195897] ChrX:71119477 [GRCh38]
ChrX:70339327 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4372G>C (p.Gly1458Arg) single nucleotide variant not provided [RCV000199497] ChrX:71132495 [GRCh38]
ChrX:70352345 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1660G>A (p.Ala554Thr) single nucleotide variant not provided [RCV000199505] ChrX:71123636 [GRCh38]
ChrX:70343486 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.397-12A>T single nucleotide variant not specified [RCV000199598] ChrX:71120002 [GRCh38]
ChrX:70339852 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.3928_3930delinsTCC (p.Pro1310Ser) indel not provided [RCV000196147] ChrX:71130095..71130097 [GRCh38]
ChrX:70349945..70349947 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.2(MED12):c.2422+3A>G single nucleotide variant not specified [RCV000199742] ChrX:71125716 [GRCh38]
ChrX:70345566 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1264C>T (p.Arg422Trp) single nucleotide variant FG syndrome 1 [RCV000702451]|X-linked mental retardation with marfanoid habitus syndrome [RCV000766103]|not provided [RCV000735096] ChrX:71122523 [GRCh38]
ChrX:70342373 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.2(MED12):c.6439C>A (p.Gln2147Lys) single nucleotide variant not specified [RCV000199947] ChrX:71141913 [GRCh38]
ChrX:70361763 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.2(MED12):c.64C>T (p.Pro22Ser) single nucleotide variant not provided [RCV000200077] ChrX:71118818 [GRCh38]
ChrX:70338668 [GRCh37]
ChrX:Xq13.1
likely pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:71267-155255839)x1 copy number loss See cases [RCV000239832] ChrX:71267..155255839 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.2-q28(chrX:13147668-155250222)x3 copy number gain See cases [RCV000239798] ChrX:13147668..155250222 [GRCh37]
ChrX:Xp22.2-q28
pathogenic
NM_005120.3(MED12):c.4028G>A (p.Arg1343His) single nucleotide variant FG syndrome 1 [RCV000203845] ChrX:71130195 [GRCh38]
ChrX:70350045 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3413G>A (p.Arg1138Gln) single nucleotide variant Inborn genetic diseases [RCV000210676] ChrX:71128656 [GRCh38]
ChrX:70348506 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6327G>A (p.Gln2109=) single nucleotide variant FG syndrome 1 [RCV000552391] ChrX:71141289 [GRCh38]
ChrX:70361139 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2068A>G (p.Thr690Ala) single nucleotide variant FG syndrome 1 [RCV000231280] ChrX:71124988 [GRCh38]
ChrX:70344838 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2220C>T (p.Ile740=) single nucleotide variant Cardiovascular phenotype [RCV000619706]|FG syndrome 1 [RCV000234149]|not specified [RCV000502631] ChrX:71125140 [GRCh38]
ChrX:70344990 [GRCh37]
ChrX:Xq13.1
likely benign
GRCh37/hg19 Xp11.21-q21.1(chrX:55240087-78225374)x1 copy number loss See cases [RCV000511311] ChrX:55240087..78225374 [GRCh37]
ChrX:Xp11.21-q21.1
pathogenic
NM_005120.2(MED12):c.204+10_204+11delCT deletion FG syndrome [RCV000227345] ChrX:71119487..71119488 [GRCh38]
ChrX:70339337..70339338 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.380C>T (p.Thr127Met) single nucleotide variant not provided [RCV000234550] ChrX:71119861 [GRCh38]
ChrX:70339711 [GRCh37]
ChrX:Xq13.1
benign
GRCh37/hg19 Xp22.33-q28(chrX:150002-155234036)x2 copy number gain See cases [RCV000240106] ChrX:150002..155234036 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60701-155246271)x3 copy number gain See cases [RCV000239989] ChrX:60701..155246271 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.1300del (p.Ala434fs) deletion Inborn genetic diseases [RCV000622863] ChrX:71122558 [GRCh38]
ChrX:70342408 [GRCh37]
ChrX:Xq13.1
likely pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:71267-155224766)x1 copy number loss See cases [RCV000239902] ChrX:71267..155224766 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.5490A>C (p.Thr1830=) single nucleotide variant Cardiovascular phenotype [RCV000621267]|not provided [RCV000633699]|not specified [RCV000607202] ChrX:71136968 [GRCh38]
ChrX:70356818 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.5252C>T (p.Pro1751Leu) single nucleotide variant Cardiovascular phenotype [RCV000621660]|FG syndrome 1 [RCV001042091]|Inborn genetic diseases [RCV000624172] ChrX:71136507 [GRCh38]
ChrX:70356357 [GRCh37]
ChrX:Xq13.1
uncertain significance
GRCh37/hg19 Xp22.33-q28(chrX:71267-155234036)x2 copy number gain See cases [RCV000239874] ChrX:71267..155234036 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.5088G>A (p.Pro1696=) single nucleotide variant not specified [RCV000603797] ChrX:71136343 [GRCh38]
ChrX:70356193 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2444G>A (p.Arg815Gln) single nucleotide variant FG syndrome 1 [RCV000239397] ChrX:71126057 [GRCh38]
ChrX:70345907 [GRCh37]
ChrX:Xq13.1
pathogenic
NM_005120.3(MED12):c.5898dup (p.Ser1967fs) duplication FG syndrome 1 [RCV000239399]|not provided [RCV001008098] ChrX:71137791..71137792 [GRCh38]
ChrX:70357641..70357642 [GRCh37]
ChrX:Xq13.1
pathogenic|likely pathogenic
NM_005120.3(MED12):c.3067A>G (p.Ile1023Val) single nucleotide variant FG syndrome 1 [RCV000239400] ChrX:71127978 [GRCh38]
ChrX:70347828 [GRCh37]
ChrX:Xq13.1
pathogenic
NM_005120.3(MED12):c.5922G>T (p.Gln1974His) single nucleotide variant Cardiovascular phenotype [RCV000618781]|FG syndrome 1 [RCV000239403]|Intellectual disability [RCV000515779]|not provided [RCV000762650] ChrX:71137821 [GRCh38]
ChrX:70357671 [GRCh37]
ChrX:Xq13.1
pathogenic|benign|uncertain significance
GRCh37/hg19 Xp11.3-q21.1(chrX:44734936-79676121)x3 copy number gain See cases [RCV000240019] ChrX:44734936..79676121 [GRCh37]
ChrX:Xp11.3-q21.1
pathogenic
NM_005120.3(MED12):c.3968T>C (p.Leu1323Pro) single nucleotide variant not provided [RCV000519950] ChrX:71130135 [GRCh38]
ChrX:70349985 [GRCh37]
ChrX:Xq13.1
likely pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:553069-155233731)x1 copy number loss See cases [RCV000446026] ChrX:553069..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:70297-155255839)x3 copy number gain See cases [RCV000239934] ChrX:70297..155255839 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:176426-155236656)x3 copy number gain See cases [RCV000240552] ChrX:176426..155236656 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.492T>C (p.Cys164=) single nucleotide variant Cardiovascular phenotype [RCV000251154]|FG syndrome 1 [RCV000633695] ChrX:71120109 [GRCh38]
ChrX:70339959 [GRCh37]
ChrX:Xq13.1
likely benign
GRCh37/hg19 Xp22.33-q28(chrX:225816-155234036)x2 copy number gain See cases [RCV000240464] ChrX:225816..155234036 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:150002-155234036)x3 copy number gain See cases [RCV000240314] ChrX:150002..155234036 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.6201A>G (p.Gln2067=) single nucleotide variant Cardiovascular phenotype [RCV000253965]|FG syndrome 1 [RCV000473107]|not specified [RCV000610989] ChrX:71140791 [GRCh38]
ChrX:70360641 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.4253+4G>A single nucleotide variant Cardiovascular phenotype [RCV000254024]|FG syndrome 1 [RCV000633703] ChrX:71132210 [GRCh38]
ChrX:70352060 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3354+26A>G single nucleotide variant not specified [RCV000249305] ChrX:71128466 [GRCh38]
ChrX:70348316 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4650C>T (p.Ser1550=) single nucleotide variant Cardiovascular phenotype [RCV000249367] ChrX:71134389 [GRCh38]
ChrX:70354239 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6045-24C>T single nucleotide variant not provided [RCV000833195]|not specified [RCV000242050] ChrX:71140611 [GRCh38]
ChrX:70360461 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2422+30C>T single nucleotide variant not specified [RCV000244546] ChrX:71125743 [GRCh38]
ChrX:70345593 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.205-38C>T single nucleotide variant not provided [RCV000832621]|not specified [RCV000254396] ChrX:71119648 [GRCh38]
ChrX:70339498 [GRCh37]
ChrX:Xq13.1
benign|likely benign
GRCh37/hg19 Xq11.1-28(chrX:62063537-155250222)x3 copy number gain See cases [RCV000240148] ChrX:62063537..155250222 [GRCh37]
ChrX:Xq11.1-28
pathogenic
NM_005120.3(MED12):c.4415+29T>C single nucleotide variant not provided [RCV000832624]|not specified [RCV000249822] ChrX:71132567 [GRCh38]
ChrX:70352417 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.2750G>A (p.Ser917Asn) single nucleotide variant not provided [RCV000520435] ChrX:71127033 [GRCh38]
ChrX:70346883 [GRCh37]
ChrX:Xq13.1
uncertain significance
GRCh37/hg19 Xp22.33-q28(chrX:2707626-155250222)x2 copy number gain See cases [RCV000240541] ChrX:2707626..155250222 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.5401-25C>T single nucleotide variant not specified [RCV000245586] ChrX:71136854 [GRCh38]
ChrX:70356704 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4416-48T>C single nucleotide variant not specified [RCV000252949] ChrX:71132797 [GRCh38]
ChrX:70352647 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2982C>T (p.Ser994=) single nucleotide variant Cardiovascular phenotype [RCV000243263] ChrX:71127893 [GRCh38]
ChrX:70347743 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6168A>G (p.Gln2056=) single nucleotide variant Cardiovascular phenotype [RCV000243286] ChrX:71140758 [GRCh38]
ChrX:70360608 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3354+27G>C single nucleotide variant not specified [RCV000253275] ChrX:71128467 [GRCh38]
ChrX:70348317 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.5125C>T (p.Arg1709Ter) single nucleotide variant not provided [RCV000368474] ChrX:71136380 [GRCh38]
ChrX:70356230 [GRCh37]
ChrX:Xq13.1
pathogenic
NM_005120.3(MED12):c.3354+6A>G single nucleotide variant not provided [RCV000357478] ChrX:71128446 [GRCh38]
ChrX:70348296 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4382C>T (p.Ser1461Leu) single nucleotide variant FG syndrome 1 [RCV001374616] ChrX:71132505 [GRCh38]
ChrX:70352355 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5563G>A (p.Val1855Met) single nucleotide variant not provided [RCV000489335] ChrX:71137198 [GRCh38]
ChrX:70357048 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6526C>T (p.Arg2176Cys) single nucleotide variant FG syndrome 1 [RCV000633690]|not provided [RCV000489695] ChrX:71142210 [GRCh38]
ChrX:70362060 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5712G>A (p.Ala1904=) single nucleotide variant not provided [RCV000863999]|not specified [RCV000603038] ChrX:71137347 [GRCh38]
ChrX:70357197 [GRCh37]
ChrX:Xq13.1
benign|likely benign
GRCh37/hg19 Xp22.2-q25(chrX:11692290-121187337)x2 copy number gain not provided [RCV000488046] ChrX:11692290..121187337 [GRCh37]
ChrX:Xp22.2-q25
uncertain significance
NM_005120.3(MED12):c.4880G>A (p.Arg1627His) single nucleotide variant not provided [RCV000489900] ChrX:71135108 [GRCh38]
ChrX:70354958 [GRCh37]
ChrX:Xq13.1
conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.1975-5C>T single nucleotide variant not provided [RCV000941592]|not specified [RCV000602695] ChrX:71124759 [GRCh38]
ChrX:70344609 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.6476A>C (p.Gln2159Pro) single nucleotide variant Ohdo syndrome, X-linked [RCV001290305]|not provided [RCV000488923] ChrX:71141950 [GRCh38]
ChrX:70361800 [GRCh37]
ChrX:Xq13.1
pathogenic|likely pathogenic
NM_005120.2(MED12):c.6276_6278dup (p.Gln2115_His2116insGln) microsatellite History of neurodevelopmental disorder [RCV000718015]|not specified [RCV000604996] ChrX:71141227..71141228 [GRCh38]
ChrX:70361077..70361078 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.129A>G (p.Gln43=) single nucleotide variant not specified [RCV000605051] ChrX:71119402 [GRCh38]
ChrX:70339252 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.2(MED12):c.6163_6177delCAGCAACAGCAGCAA (p.Gln2072_Gln2076del) deletion Ohdo syndrome, X-linked [RCV000626252] ChrX:71140753..71140767 [GRCh38]
ChrX:70360603..70360617 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1475A>G (p.Asp492Gly) single nucleotide variant Inborn genetic diseases [RCV000622317] ChrX:71122864 [GRCh38]
ChrX:70342714 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5092G>A (p.Ala1698Thr) single nucleotide variant Inborn genetic diseases [RCV000624244] ChrX:71136347 [GRCh38]
ChrX:70356197 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6268-4A>G single nucleotide variant Cardiovascular phenotype [RCV000617469] ChrX:71141226 [GRCh38]
ChrX:70361076 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5103T>C (p.Ser1701=) single nucleotide variant Cardiovascular phenotype [RCV000617718]|not specified [RCV000610532] ChrX:71136358 [GRCh38]
ChrX:70356208 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4041T>C (p.Ile1347=) single nucleotide variant Cardiovascular phenotype [RCV000622122] ChrX:71130208 [GRCh38]
ChrX:70350058 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5135_5138dup (p.Val1714fs) duplication not provided [RCV000599132] ChrX:71136389..71136390 [GRCh38]
ChrX:70356239..70356240 [GRCh37]
ChrX:Xq13.1
pathogenic
Single allele duplication Syndromic X-linked intellectual disability Lubs type [RCV000768455] ChrX:15323210..153542100 [GRCh37]
ChrX:Xp22.2-q28
pathogenic
NM_005120.3(MED12):c.2613G>A (p.Gln871=) single nucleotide variant Cardiovascular phenotype [RCV000620589]|FG syndrome 1 [RCV001088366]|not provided [RCV000726879]|not specified [RCV000598249] ChrX:71126412 [GRCh38]
ChrX:70346262 [GRCh37]
ChrX:Xq13.1
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.6318_6320GCA[5] (p.Gln2115dup) microsatellite not specified [RCV000601107] ChrX:71141277..71141278 [GRCh38]
ChrX:70361127..70361128 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.2(MED12):c.6300_6329del30 (p.Gln2106_Gln2115del) microsatellite not provided [RCV000599496] ChrX:71141228..71141257 [GRCh38]
ChrX:70361078..70361107 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3219C>T (p.Asp1073=) single nucleotide variant FG syndrome 1 [RCV001087694]|not provided [RCV000593530] ChrX:71128305 [GRCh38]
ChrX:70348155 [GRCh37]
ChrX:Xq13.1
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_005120.3(MED12):c.872C>A (p.Ala291Glu) single nucleotide variant Cardiovascular phenotype [RCV000619543] ChrX:71121587 [GRCh38]
ChrX:70341437 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5476C>T (p.Pro1826Ser) single nucleotide variant Ehlers-Danlos syndrome, classic type [RCV000583569]|FG syndrome 1 [RCV001069215] ChrX:71136954 [GRCh38]
ChrX:70356804 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4120-12C>T single nucleotide variant not specified [RCV000599997] ChrX:71132061 [GRCh38]
ChrX:70351911 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6267+166G>A single nucleotide variant Ohdo syndrome, X-linked [RCV000626124] ChrX:71141023 [GRCh38]
ChrX:70360873 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4342G>A (p.Gly1448Arg) single nucleotide variant Global developmental delay [RCV000415054] ChrX:71132465 [GRCh38]
ChrX:70352315 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.3(MED12):c.6297G>A (p.Gln2099=) single nucleotide variant FG syndrome 1 [RCV000525622] ChrX:71141259 [GRCh38]
ChrX:70361109 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4806G>T (p.Ser1602=) single nucleotide variant FG syndrome 1 [RCV000529421] ChrX:71134791 [GRCh38]
ChrX:70354641 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1332C>T (p.Cys444=) single nucleotide variant not provided [RCV000534554]|not specified [RCV000601179] ChrX:71122591 [GRCh38]
ChrX:70342441 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.369C>T (p.Thr123=) single nucleotide variant not provided [RCV000731476] ChrX:71119850 [GRCh38]
ChrX:70339700 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1269G>A (p.Glu423=) single nucleotide variant FG syndrome 1 [RCV000526926] ChrX:71122528 [GRCh38]
ChrX:70342378 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.616C>G (p.Arg206Gly) single nucleotide variant FG syndrome 1 [RCV000536062] ChrX:71121033 [GRCh38]
ChrX:70340883 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6291G>A (p.Gln2097=) single nucleotide variant FG syndrome 1 [RCV000536845] ChrX:71141253 [GRCh38]
ChrX:70361103 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3125G>A (p.Ser1042Asn) single nucleotide variant FG syndrome 1 [RCV000540437] ChrX:71128036 [GRCh38]
ChrX:70347886 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.397-12A>G single nucleotide variant not provided [RCV000413334] ChrX:71120002 [GRCh38]
ChrX:70339852 [GRCh37]
ChrX:Xq13.1
uncertain significance
GRCh37/hg19 Xp22.33-q28(chrX:168546-154930047)x3 copy number gain See cases [RCV000449437] ChrX:168546..154930047 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x3 copy number gain See cases [RCV000449330] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:70297-155255792) copy number loss See cases [RCV000449461] ChrX:70297..155255792 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60701-155246225)x3 copy number gain See cases [RCV000446270] ChrX:60701..155246225 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xq13.1-28(chrX:68701338-155233731)x3 copy number gain See cases [RCV000446471] ChrX:68701338..155233731 [GRCh37]
ChrX:Xq13.1-28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:71267-155255792)x1 copy number loss See cases [RCV000446197] ChrX:71267..155255792 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:2703632-155233731)x1 copy number loss See cases [RCV000446712] ChrX:2703632..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:318707-155224707)x1 copy number loss See cases [RCV000446667] ChrX:318707..155224707 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xq13.1(chrX:70344802-70345036)x1 copy number loss See cases [RCV000447029] ChrX:70344802..70345036 [GRCh37]
ChrX:Xq13.1
uncertain significance
GRCh37/hg19 Xp11.1-q28(chrX:58140271-155046703)x3 copy number gain See cases [RCV000446151] ChrX:58140271..155046703 [GRCh37]
ChrX:Xp11.1-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x4 copy number gain See cases [RCV000446932] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155196888)x3 copy number gain See cases [RCV000446310] ChrX:168546..155196888 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155081533)x3 copy number gain See cases [RCV000447253] ChrX:168546..155081533 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.4299T>C (p.Ala1433=) single nucleotide variant not specified [RCV000423797] ChrX:71132422 [GRCh38]
ChrX:70352272 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3667G>A (p.Val1223Ile) single nucleotide variant not provided [RCV000427306] ChrX:71129405 [GRCh38]
ChrX:70349255 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1744+4C>T single nucleotide variant FG syndrome 1 [RCV000811541]|not specified [RCV000423906] ChrX:71123724 [GRCh38]
ChrX:70343574 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.3(MED12):c.6072A>T (p.Thr2024=) single nucleotide variant not specified [RCV000431103] ChrX:71140662 [GRCh38]
ChrX:70360512 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6408+16C>T single nucleotide variant not specified [RCV000431297] ChrX:71141386 [GRCh38]
ChrX:70361236 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.736-14C>G single nucleotide variant not specified [RCV000438023] ChrX:71121313 [GRCh38]
ChrX:70341163 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3942T>C (p.Ser1314=) single nucleotide variant Cardiovascular phenotype [RCV000617555]|FG syndrome 1 [RCV000528631]|not specified [RCV000427771] ChrX:71130109 [GRCh38]
ChrX:70349959 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.27C>T (p.Tyr9=) single nucleotide variant not specified [RCV000431341] ChrX:71118781 [GRCh38]
ChrX:70338631 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1348+18G>A single nucleotide variant not specified [RCV000431605] ChrX:71122625 [GRCh38]
ChrX:70342475 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4665G>A (p.Thr1555=) single nucleotide variant FG syndrome 1 [RCV000633706]|not specified [RCV000434851] ChrX:71134404 [GRCh38]
ChrX:70354254 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3801C>T (p.Asn1267=) single nucleotide variant not specified [RCV000442143] ChrX:71129789 [GRCh38]
ChrX:70349639 [GRCh37]
ChrX:Xq13.1
likely benign
GRCh37/hg19 Xp22.33-q28(chrX:168566-155233731)x1 copy number loss See cases [RCV000445720] ChrX:168566..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.1745-19C>T single nucleotide variant not specified [RCV000418305] ChrX:71124140 [GRCh38]
ChrX:70343990 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6044+16G>C single nucleotide variant not specified [RCV000424492] ChrX:71137959 [GRCh38]
ChrX:70357809 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.-47A>T single nucleotide variant not specified [RCV000428135] ChrX:71118708 [GRCh38]
ChrX:70338558 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1349-11T>C single nucleotide variant not specified [RCV000428405] ChrX:71122727 [GRCh38]
ChrX:70342577 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1618-8T>C single nucleotide variant not specified [RCV000418836] ChrX:71123586 [GRCh38]
ChrX:70343436 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3412C>A (p.Arg1138=) single nucleotide variant not specified [RCV000442770] ChrX:71128655 [GRCh38]
ChrX:70348505 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.100-19C>T single nucleotide variant not specified [RCV000419152] ChrX:71119354 [GRCh38]
ChrX:70339204 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4470A>G (p.Lys1490=) single nucleotide variant not specified [RCV000421669] ChrX:71132899 [GRCh38]
ChrX:70352749 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6409-14C>A single nucleotide variant not specified [RCV000435771] ChrX:71141869 [GRCh38]
ChrX:70361719 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5775A>G (p.Ser1925=) single nucleotide variant not specified [RCV000419287] ChrX:71137584 [GRCh38]
ChrX:70357434 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3670C>T (p.Leu1224Phe) single nucleotide variant Adenocarcinoma of prostate [RCV000425461]|Adenocarcinoma of stomach [RCV000436162]|Breast neoplasm [RCV000433808]|Pancreatic adenocarcinoma [RCV000445331]|Squamous cell lung carcinoma [RCV000426762] ChrX:71129408 [GRCh38]
ChrX:70349258 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.3(MED12):c.384A>G (p.Gln128=) single nucleotide variant FG syndrome 1 [RCV000862034]|History of neurodevelopmental disorder [RCV000717968]|not specified [RCV000425539] ChrX:71119865 [GRCh38]
ChrX:70339715 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.1485+6C>T single nucleotide variant FG syndrome 1 [RCV000633700]|not specified [RCV000432352] ChrX:71122880 [GRCh38]
ChrX:70342730 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.111G>A (p.Thr37=) single nucleotide variant not specified [RCV000439512] ChrX:71119384 [GRCh38]
ChrX:70339234 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4950G>A (p.Thr1650=) single nucleotide variant FG syndrome 1 [RCV000868240]|not specified [RCV000422110] ChrX:71135178 [GRCh38]
ChrX:70355028 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.3577+17T>G single nucleotide variant not specified [RCV000436251] ChrX:71129232 [GRCh38]
ChrX:70349082 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4974C>T (p.Ile1658=) single nucleotide variant FG syndrome 1 [RCV000869624]|not specified [RCV000439708] ChrX:71135202 [GRCh38]
ChrX:70355052 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1892C>T (p.Pro631Leu) single nucleotide variant not provided [RCV000443432] ChrX:71124306 [GRCh38]
ChrX:70344156 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1167G>A (p.Lys389=) single nucleotide variant Cardiovascular phenotype [RCV000620011]|FG syndrome 1 [RCV000550932]|History of neurodevelopmental disorder [RCV000720035]|not specified [RCV000432789] ChrX:71122265 [GRCh38]
ChrX:70342115 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.3516C>G (p.Thr1172=) single nucleotide variant not specified [RCV000432991] ChrX:71129154 [GRCh38]
ChrX:70349004 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4831C>T (p.Arg1611Cys) single nucleotide variant not provided [RCV000431564] ChrX:71134816 [GRCh38]
ChrX:70354666 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.3(MED12):c.272G>T (p.Arg91Leu) single nucleotide variant FG syndrome 1 [RCV001298178]|not provided [RCV000420005] ChrX:71119753 [GRCh38]
ChrX:70339603 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.204+13T>G single nucleotide variant not specified [RCV000422583] ChrX:71119490 [GRCh38]
ChrX:70339340 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.736-4A>G single nucleotide variant not specified [RCV000426119] ChrX:71121323 [GRCh38]
ChrX:70341173 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3843C>T (p.Tyr1281=) single nucleotide variant not specified [RCV000426230] ChrX:71129831 [GRCh38]
ChrX:70349681 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1602G>A (p.Ala534=) single nucleotide variant not specified [RCV000433018] ChrX:71123211 [GRCh38]
ChrX:70343061 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4851G>A (p.Ala1617=) single nucleotide variant not specified [RCV000443885] ChrX:71134836 [GRCh38]
ChrX:70354686 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3670C>G (p.Leu1224Val) single nucleotide variant Adenocarcinoma of prostate [RCV000417890]|Adenocarcinoma of stomach [RCV000424408]|Breast neoplasm [RCV000428595]|Pancreatic adenocarcinoma [RCV000435099]|Squamous cell lung carcinoma [RCV000418945] ChrX:71129408 [GRCh38]
ChrX:70349258 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.3(MED12):c.5190G>C (p.Leu1730=) single nucleotide variant not specified [RCV000422864] ChrX:71136445 [GRCh38]
ChrX:70356295 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.93G>C (p.Gln31His) single nucleotide variant not provided [RCV000433847] ChrX:71118847 [GRCh38]
ChrX:70338697 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.3(MED12):c.2056-20C>T single nucleotide variant not specified [RCV000426628] ChrX:71124956 [GRCh38]
ChrX:70344806 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5659G>A (p.Gly1887Ser) single nucleotide variant FG syndrome 1 [RCV000542788]|not specified [RCV000426655] ChrX:71137294 [GRCh38]
ChrX:70357144 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.4528-19T>C single nucleotide variant not specified [RCV000426669] ChrX:71133104 [GRCh38]
ChrX:70352954 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5805C>T (p.Ser1935=) single nucleotide variant Cardiovascular phenotype [RCV000619840]|FG syndrome 1 [RCV000868192]|not specified [RCV000420285] ChrX:71137614 [GRCh38]
ChrX:70357464 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.3699G>A (p.Ala1233=) single nucleotide variant FG syndrome 1 [RCV000468386]|not specified [RCV000430576] ChrX:71129687 [GRCh38]
ChrX:70349537 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.6267+20T>C single nucleotide variant not specified [RCV000423514] ChrX:71140877 [GRCh38]
ChrX:70360727 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5026-12T>A single nucleotide variant not specified [RCV000437487] ChrX:71136269 [GRCh38]
ChrX:70356119 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4009G>A (p.Glu1337Lys) single nucleotide variant not provided [RCV000441093] ChrX:71130176 [GRCh38]
ChrX:70350026 [GRCh37]
ChrX:Xq13.1
likely benign
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x1 copy number loss See cases [RCV000448393] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.1862G>A (p.Arg621Gln) single nucleotide variant FG syndrome 1 [RCV000416709] ChrX:71124276 [GRCh38]
ChrX:70344126 [GRCh37]
ChrX:Xq13.1
likely pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:70297-155255792)x4 copy number gain See cases [RCV000448034] ChrX:70297..155255792 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:70297-155246585)x1 copy number loss See cases [RCV000448652] ChrX:70297..155246585 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp11.21-q28(chrX:55532799-150239235)x1 copy number loss See cases [RCV000448870] ChrX:55532799..150239235 [GRCh37]
ChrX:Xp11.21-q28
pathogenic
NM_005120.3(MED12):c.4416-77CTCTT[8] microsatellite not specified [RCV000479134] ChrX:71132768..71132787 [GRCh38]
ChrX:70352618..70352637 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6208_6210CAG[6] (p.Gln2076del) microsatellite Cardiovascular phenotype [RCV000619137]|FG syndrome 1 [RCV000459087]|History of neurodevelopmental disorder [RCV000718631] ChrX:71140798..71140800 [GRCh38]
ChrX:70360648..70360650 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6288_6290GCA[8] (p.Gln2115dup) microsatellite FG syndrome 1 [RCV000691164]|not specified [RCV000479470] ChrX:71141247..71141248 [GRCh38]
ChrX:70361097..70361098 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.3(MED12):c.4238C>A (p.Thr1413Asn) single nucleotide variant FG syndrome 1 [RCV000459550]|not provided [RCV000514449] ChrX:71132191 [GRCh38]
ChrX:70352041 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.3(MED12):c.5345G>A (p.Arg1782His) single nucleotide variant FG syndrome 1 [RCV000474508] ChrX:71136600 [GRCh38]
ChrX:70356450 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4047+14G>A single nucleotide variant not specified [RCV000454572] ChrX:71130228 [GRCh38]
ChrX:70350078 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.708C>T (p.Thr236=) single nucleotide variant FG syndrome 1 [RCV000467485]|History of neurodevelopmental disorder [RCV000719636] ChrX:71121125 [GRCh38]
ChrX:70340975 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.1140C>T (p.His380=) single nucleotide variant Cardiovascular phenotype [RCV000620849]|FG syndrome 1 [RCV000471283]|not provided [RCV001090306] ChrX:71122238 [GRCh38]
ChrX:70342088 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.1682C>T (p.Pro561Leu) single nucleotide variant FG syndrome 1 [RCV000633691]|not provided [RCV000480397] ChrX:71123658 [GRCh38]
ChrX:70343508 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.3(MED12):c.1273dup (p.Glu425fs) duplication not provided [RCV000483034] ChrX:71122531..71122532 [GRCh38]
ChrX:70342381..70342382 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.3(MED12):c.6177_6200ACAGCAACAGCAGCAGCAGCAGCA[1] (p.Gln2069_Gln2076del) microsatellite FG syndrome 1 [RCV000467964] ChrX:71140759..71140782 [GRCh38]
ChrX:70360609..70360632 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5616A>G (p.Pro1872=) single nucleotide variant not provided [RCV000471906] ChrX:71137251 [GRCh38]
ChrX:70357101 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5957A>C (p.Asp1986Ala) single nucleotide variant not provided [RCV000481143] ChrX:71137856 [GRCh38]
ChrX:70357706 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2169G>A (p.Gly723=) single nucleotide variant not provided [RCV000472273] ChrX:71125089 [GRCh38]
ChrX:70344939 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6309_6314ACAGCA[3] (p.Gln2114_Gln2115dup) microsatellite FG syndrome 1 [RCV000803502]|not provided [RCV000514550] ChrX:71141265..71141266 [GRCh38]
ChrX:70361115..70361116 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.3(MED12):c.3796C>T (p.Arg1266Cys) single nucleotide variant FG syndrome 1 [RCV000469040] ChrX:71129784 [GRCh38]
ChrX:70349634 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3691+4C>T single nucleotide variant FG syndrome 1 [RCV000476695]|not specified [RCV000610539] ChrX:71129433 [GRCh38]
ChrX:70349283 [GRCh37]
ChrX:Xq13.1
benign|uncertain significance
NM_005120.3(MED12):c.3849G>T (p.Leu1283=) single nucleotide variant not provided [RCV000461941] ChrX:71129837 [GRCh38]
ChrX:70349687 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3063C>T (p.Phe1021=) single nucleotide variant not provided [RCV000461967] ChrX:71127974 [GRCh38]
ChrX:70347824 [GRCh37]
ChrX:Xq13.1
likely benign
NC_000023.10:g.(?_70348964)_(70350064_?)dup duplication FG syndrome 1 [RCV000465539] ChrX:71129114..71130214 [GRCh38]
ChrX:70348964..70350064 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5427C>T (p.Ser1809=) single nucleotide variant not provided [RCV000465540] ChrX:71136905 [GRCh38]
ChrX:70356755 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2895C>T (p.Ser965=) single nucleotide variant not provided [RCV000458188] ChrX:71127381 [GRCh38]
ChrX:70347231 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6121G>A (p.Gly2041Ser) single nucleotide variant FG syndrome 1 [RCV001230631]|not provided [RCV000482969] ChrX:71140711 [GRCh38]
ChrX:70360561 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1744+5G>A single nucleotide variant FG syndrome 1 [RCV000473894] ChrX:71123725 [GRCh38]
ChrX:70343575 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3582G>A (p.Lys1194=) single nucleotide variant FG syndrome 1 [RCV000477623] ChrX:71129320 [GRCh38]
ChrX:70349170 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3355-8dup duplication not specified [RCV000478983] ChrX:71128584..71128585 [GRCh38]
ChrX:70348434..70348435 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.708C>G (p.Thr236=) single nucleotide variant not specified [RCV000500867] ChrX:71121125 [GRCh38]
ChrX:70340975 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.473G>A (p.Trp158Ter) single nucleotide variant not provided [RCV000498872] ChrX:71120090 [GRCh38]
ChrX:70339940 [GRCh37]
ChrX:Xq13.1
pathogenic
NM_005120.3(MED12):c.2545T>C (p.Ser849Pro) single nucleotide variant X-linked mental retardation with marfanoid habitus syndrome [RCV000496123] ChrX:71126344 [GRCh38]
ChrX:70346194 [GRCh37]
ChrX:Xq13.1
uncertain significance
GRCh37/hg19 Xp22.33-q28(chrX:168547-151304063)x1 copy number loss See cases [RCV000510382] ChrX:168547..151304063 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.5266C>T (p.Leu1756=) single nucleotide variant not specified [RCV000504418] ChrX:71136521 [GRCh38]
ChrX:70356371 [GRCh37]
ChrX:Xq13.1
likely benign
GRCh37/hg19 Xp22.33-q23(chrX:168547-112474026)x1 copy number loss See cases [RCV000510419] ChrX:168547..112474026 [GRCh37]
ChrX:Xp22.33-q23
pathogenic
NM_005120.3(MED12):c.6017A>C (p.Tyr2006Ser) single nucleotide variant Cardiovascular phenotype [RCV000621099]|FG syndrome 1 [RCV000633694]|Inborn genetic diseases [RCV000624603]|not specified [RCV000502755] ChrX:71137916 [GRCh38]
ChrX:70357766 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4265G>A (p.Arg1422His) single nucleotide variant not provided [RCV000498140] ChrX:71132388 [GRCh38]
ChrX:70352238 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.3(MED12):c.1732G>C (p.Ala578Pro) single nucleotide variant not provided [RCV000493652] ChrX:71123708 [GRCh38]
ChrX:70343558 [GRCh37]
ChrX:Xq13.1
likely pathogenic
GRCh37/hg19 Xp11.21-q28(chrX:55000501-155230750)x3 copy number gain See cases [RCV000511787] ChrX:55000501..155230750 [GRCh37]
ChrX:Xp11.21-q28
pathogenic
NM_005120.3(MED12):c.5980C>T (p.Arg1994Trp) single nucleotide variant Glioblastoma [RCV000505660] ChrX:71137879 [GRCh38]
ChrX:70357729 [GRCh37]
ChrX:Xq13.1
other
GRCh37/hg19 Xp21.1-q22.1(chrX:37521774-98488534)x1 copy number loss See cases [RCV000512026] ChrX:37521774..98488534 [GRCh37]
ChrX:Xp21.1-q22.1
pathogenic
GRCh37/hg19 Xp21.2-q28(chrX:31088082-155233731)x1 copy number loss See cases [RCV000511413] ChrX:31088082..155233731 [GRCh37]
ChrX:Xp21.2-q28
pathogenic
GRCh37/hg19 Xq13.1(chrX:70287671-70997047)x3 copy number gain See cases [RCV000511625] ChrX:70287671..70997047 [GRCh37]
ChrX:Xq13.1
uncertain significance
GRCh37/hg19 Xp22.33-q28(chrX:168547-155233731) copy number gain See cases [RCV000512020] ChrX:168547..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp11.21-q28(chrX:57511767-155233731)x3 copy number gain See cases [RCV000510826] ChrX:57511767..155233731 [GRCh37]
ChrX:Xp11.21-q28
pathogenic
GRCh37/hg19 Xp11.21-q28(chrX:56457791-155233731)x3 copy number gain See cases [RCV000511307] ChrX:56457791..155233731 [GRCh37]
ChrX:Xp11.21-q28
pathogenic
NM_005120.3(MED12):c.5336C>T (p.Thr1779Ile) single nucleotide variant FG syndrome 1 [RCV000633687] ChrX:71136591 [GRCh38]
ChrX:70356441 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3498G>A (p.Glu1166=) single nucleotide variant FG syndrome 1 [RCV000633698] ChrX:71129136 [GRCh38]
ChrX:70348986 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6303G>A (p.Gln2101=) single nucleotide variant FG syndrome 1 [RCV000526377] ChrX:71141265 [GRCh38]
ChrX:70361115 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4725C>A (p.Asn1575Lys) single nucleotide variant Cardiovascular phenotype [RCV000618316] ChrX:71134464 [GRCh38]
ChrX:70354314 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5585G>A (p.Arg1862His) single nucleotide variant FG syndrome 1 [RCV000530761] ChrX:71137220 [GRCh38]
ChrX:70357070 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4870T>G (p.Leu1624Val) single nucleotide variant Cardiovascular phenotype [RCV000619668] ChrX:71135098 [GRCh38]
ChrX:70354948 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5258C>T (p.Ala1753Val) single nucleotide variant Cardiovascular phenotype [RCV000620061]|FG syndrome 1 [RCV001055537] ChrX:71136513 [GRCh38]
ChrX:70356363 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6300G>A (p.Gln2100=) single nucleotide variant FG syndrome 1 [RCV000537638] ChrX:71141262 [GRCh38]
ChrX:70361112 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6324G>A (p.Gln2108=) single nucleotide variant FG syndrome 1 [RCV000539766] ChrX:71141286 [GRCh38]
ChrX:70361136 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6351G>A (p.Gln2117=) single nucleotide variant FG syndrome 1 [RCV000540553] ChrX:71141313 [GRCh38]
ChrX:70361163 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1344T>G (p.Thr448=) single nucleotide variant not specified [RCV000606631] ChrX:71122603 [GRCh38]
ChrX:70342453 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3884G>A (p.Arg1295His) single nucleotide variant Inborn genetic diseases [RCV000624336] ChrX:71130051 [GRCh38]
ChrX:70349901 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2308G>A (p.Ala770Thr) single nucleotide variant Cardiovascular phenotype [RCV000617840] ChrX:71125432 [GRCh38]
ChrX:70345282 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.735+15A>G single nucleotide variant not specified [RCV000607187] ChrX:71121167 [GRCh38]
ChrX:70341017 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5779G>A (p.Val1927Ile) single nucleotide variant Cardiovascular phenotype [RCV000618224] ChrX:71137588 [GRCh38]
ChrX:70357438 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3948G>A (p.Gln1316=) single nucleotide variant Cardiovascular phenotype [RCV000618383] ChrX:71130115 [GRCh38]
ChrX:70349965 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5442G>C (p.Val1814=) single nucleotide variant Cardiovascular phenotype [RCV000618562] ChrX:71136920 [GRCh38]
ChrX:70356770 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4154C>T (p.Ala1385Val) single nucleotide variant FG syndrome 1 [RCV000633688] ChrX:71132107 [GRCh38]
ChrX:70351957 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3587C>A (p.Thr1196Lys) single nucleotide variant FG syndrome 1 [RCV000633689] ChrX:71129325 [GRCh38]
ChrX:70349175 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2571G>C (p.Thr857=) single nucleotide variant FG syndrome 1 [RCV000633696] ChrX:71126370 [GRCh38]
ChrX:70346220 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5655C>T (p.Val1885=) single nucleotide variant FG syndrome 1 [RCV000633704] ChrX:71137290 [GRCh38]
ChrX:70357140 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2136C>T (p.Pro712=) single nucleotide variant not provided [RCV000633705] ChrX:71125056 [GRCh38]
ChrX:70344906 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1956C>T (p.Ser652=) single nucleotide variant FG syndrome 1 [RCV000633707] ChrX:71124370 [GRCh38]
ChrX:70344220 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4146C>T (p.Ile1382=) single nucleotide variant not specified [RCV000602445] ChrX:71132099 [GRCh38]
ChrX:70351949 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4161C>T (p.Ile1387=) single nucleotide variant Cardiovascular phenotype [RCV000620757] ChrX:71132114 [GRCh38]
ChrX:70351964 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.183C>T (p.Asn61=) single nucleotide variant not specified [RCV000609665] ChrX:71119456 [GRCh38]
ChrX:70339306 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1659C>T (p.Ile553=) single nucleotide variant FG syndrome 1 [RCV000863165]|not specified [RCV000612298] ChrX:71123635 [GRCh38]
ChrX:70343485 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6309_6314ACAGCA[1] (p.Gln2114_Gln2115del) microsatellite FG syndrome 1 [RCV000538945]|not specified [RCV000615285] ChrX:71141266..71141271 [GRCh38]
ChrX:70361116..70361121 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.3(MED12):c.6358C>T (p.Gln2120Ter) single nucleotide variant Inborn genetic diseases [RCV000624720] ChrX:71141320 [GRCh38]
ChrX:70361170 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.3(MED12):c.3303C>G (p.Cys1101Trp) single nucleotide variant Inborn genetic diseases [RCV000624187] ChrX:71128389 [GRCh38]
ChrX:70348239 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5026-17T>C single nucleotide variant not specified [RCV000612588] ChrX:71136264 [GRCh38]
ChrX:70356114 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2850-7C>G single nucleotide variant FG syndrome 1 [RCV001350516]|not specified [RCV000610014] ChrX:71127329 [GRCh38]
ChrX:70347179 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.3(MED12):c.3231G>T (p.Leu1077=) single nucleotide variant not specified [RCV000615486] ChrX:71128317 [GRCh38]
ChrX:70348167 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4864-6C>T single nucleotide variant FG syndrome 1 [RCV001330018]|not specified [RCV000616026] ChrX:71135086 [GRCh38]
ChrX:70354936 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.3(MED12):c.1066C>A (p.Arg356=) single nucleotide variant FG syndrome 1 [RCV001338747]|not specified [RCV000606096] ChrX:71121781 [GRCh38]
ChrX:70341631 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.3(MED12):c.6326A>C (p.Gln2109Pro) single nucleotide variant Cardiovascular phenotype [RCV000618619] ChrX:71141288 [GRCh38]
ChrX:70361138 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.701A>T (p.Asp234Val) single nucleotide variant Cardiovascular phenotype [RCV000618986] ChrX:71121118 [GRCh38]
ChrX:70340968 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.553+12C>G single nucleotide variant not specified [RCV000610353] ChrX:71120182 [GRCh38]
ChrX:70340032 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1101+8_1101+9insCC insertion not specified [RCV000613295] ChrX:71121823..71121824 [GRCh38]
ChrX:70341673..70341674 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3577+9C>A single nucleotide variant not specified [RCV000616392] ChrX:71129224 [GRCh38]
ChrX:70349074 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3456C>T (p.Ile1152=) single nucleotide variant not specified [RCV000616424] ChrX:71128699 [GRCh38]
ChrX:70348549 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5400+7G>A single nucleotide variant FG syndrome 1 [RCV000860928]|not specified [RCV000616430] ChrX:71136662 [GRCh38]
ChrX:70356512 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.6279A>G (p.Gln2093=) single nucleotide variant not specified [RCV000616536] ChrX:71141241 [GRCh38]
ChrX:70361091 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6186_6188GCA[6] (p.Gln2076dup) microsatellite not specified [RCV000607874] ChrX:71140773..71140774 [GRCh38]
ChrX:70360623..70360624 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5205C>T (p.Arg1735=) single nucleotide variant not specified [RCV000613517] ChrX:71136460 [GRCh38]
ChrX:70356310 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3516C>A (p.Thr1172=) single nucleotide variant not specified [RCV000608111] ChrX:71129154 [GRCh38]
ChrX:70349004 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1744+14C>T single nucleotide variant not specified [RCV000613752] ChrX:71123734 [GRCh38]
ChrX:70343584 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4048-12C>T single nucleotide variant not specified [RCV000616902] ChrX:71131538 [GRCh38]
ChrX:70351388 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6321G>A (p.Gln2107=) single nucleotide variant FG syndrome 1 [RCV000527171] ChrX:71141283 [GRCh38]
ChrX:70361133 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1924G>A (p.Asp642Asn) single nucleotide variant FG syndrome 1 [RCV000527851] ChrX:71124338 [GRCh38]
ChrX:70344188 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.-28G>T single nucleotide variant not specified [RCV000613928] ChrX:71118727 [GRCh38]
ChrX:70338577 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.887G>A (p.Arg296Gln) single nucleotide variant Inborn genetic diseases [RCV000623246] ChrX:71121602 [GRCh38]
ChrX:70341452 [GRCh37]
ChrX:Xq13.1
likely pathogenic|uncertain significance
NM_005120.3(MED12):c.2748C>A (p.Gly916=) single nucleotide variant not specified [RCV000608542] ChrX:71127031 [GRCh38]
ChrX:70346881 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6279_6284ACAGCA[3] (p.Gln2114_Gln2115dup) microsatellite FG syndrome 1 [RCV000800094]|History of neurodevelopmental disorder [RCV000719864]|not specified [RCV000608857] ChrX:71141235..71141236 [GRCh38]
ChrX:70361085..70361086 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.3(MED12):c.1929C>T (p.Asp643=) single nucleotide variant not specified [RCV000614258] ChrX:71124343 [GRCh38]
ChrX:70344193 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3355-16_3355-13del microsatellite not specified [RCV000614511] ChrX:71128575..71128578 [GRCh38]
ChrX:70348425..70348428 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6333G>A (p.Gln2111=) single nucleotide variant FG syndrome 1 [RCV000532528] ChrX:71141295 [GRCh38]
ChrX:70361145 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1030A>C (p.Thr344Pro) single nucleotide variant FG syndrome 1 [RCV000533767] ChrX:71121745 [GRCh38]
ChrX:70341595 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4863+15C>T single nucleotide variant not specified [RCV000604403] ChrX:71134863 [GRCh38]
ChrX:70354713 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6177_6191del (p.Gln2072_Gln2076del) deletion Cardiovascular phenotype [RCV000618867]|Ohdo syndrome, X-linked [RCV000626252] ChrX:71140753..71140767 [GRCh38]
ChrX:70360603..70360617 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6336_6362del (p.Gln2115_Gln2123del) deletion not specified [RCV000605230] ChrX:71141284..71141310 [GRCh38]
ChrX:70361134..70361160 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3210-27C>T single nucleotide variant Ohdo syndrome, X-linked [RCV000625905] ChrX:71128269 [GRCh38]
ChrX:70348119 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3357C>T (p.Val1119=) single nucleotide variant Cardiovascular phenotype [RCV000619129] ChrX:71128600 [GRCh38]
ChrX:70348450 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3222C>T (p.Ile1074=) single nucleotide variant Cardiovascular phenotype [RCV000619289]|FG syndrome 1 [RCV001088377]|not provided [RCV000863756] ChrX:71128308 [GRCh38]
ChrX:70348158 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1290G>A (p.Glu430=) single nucleotide variant Cardiovascular phenotype [RCV000619321] ChrX:71122549 [GRCh38]
ChrX:70342399 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4416-43_4416-14del deletion not specified [RCV000607629] ChrX:71132801..71132830 [GRCh38]
ChrX:70352651..70352680 [GRCh37]
ChrX:Xq13.1
likely benign
GRCh37/hg19 Xp22.33-q13.3(chrX:168546-74549686) copy number loss See cases [RCV000512142] ChrX:168546..74549686 [GRCh37]
ChrX:Xp22.33-q13.3
pathogenic
GRCh37/hg19 Xq13.1(chrX:70287671-70997047)x2 copy number gain See cases [RCV000512522] ChrX:70287671..70997047 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2990G>A (p.Cys997Tyr) single nucleotide variant Cardiovascular phenotype [RCV000622024] ChrX:71127901 [GRCh38]
ChrX:70347751 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2118C>T (p.Val706=) single nucleotide variant Cardiovascular phenotype [RCV000620971] ChrX:71125038 [GRCh38]
ChrX:70344888 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3443G>T (p.Arg1148Leu) single nucleotide variant Cardiovascular phenotype [RCV000621328] ChrX:71128686 [GRCh38]
ChrX:70348536 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.184G>A (p.Val62Ile) single nucleotide variant Cardiovascular phenotype [RCV000621373] ChrX:71119457 [GRCh38]
ChrX:70339307 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3009C>A (p.Thr1003=) single nucleotide variant Cardiovascular phenotype [RCV000621621] ChrX:71127920 [GRCh38]
ChrX:70347770 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4505C>G (p.Ser1502Cys) single nucleotide variant Inborn genetic diseases [RCV000624186] ChrX:71132934 [GRCh38]
ChrX:70352784 [GRCh37]
ChrX:Xq13.1
uncertain significance
GRCh37/hg19 Xp11.21-q28(chrX:57415659-155233731)x3 copy number gain See cases [RCV000512173] ChrX:57415659..155233731 [GRCh37]
ChrX:Xp11.21-q28
pathogenic
NM_005120.3(MED12):c.4159A>G (p.Ile1387Val) single nucleotide variant not provided [RCV000658234] ChrX:71132112 [GRCh38]
ChrX:70351962 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3979C>A (p.Pro1327Thr) single nucleotide variant History of neurodevelopmental disorder [RCV000715705] ChrX:71130146 [GRCh38]
ChrX:70349996 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3693G>T (p.Gly1231=) single nucleotide variant FG syndrome 1 [RCV000698988] ChrX:71129681 [GRCh38]
ChrX:70349531 [GRCh37]
ChrX:Xq13.1
uncertain significance
GRCh37/hg19 Xp22.31-q21.31(chrX:7841947-90815333)x1,2 copy number gain not provided [RCV000684261] ChrX:7841947..90815333 [GRCh37]
ChrX:Xp22.31-q21.31
pathogenic
NM_005120.3(MED12):c.628G>C (p.Ala210Pro) single nucleotide variant X-linked mental retardation with marfanoid habitus syndrome [RCV000678351] ChrX:71121045 [GRCh38]
ChrX:70340895 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6186_6188GCA[3] (p.Gln2075_Gln2076del) microsatellite FG syndrome 1 [RCV000701599] ChrX:71140774..71140779 [GRCh38]
ChrX:70360624..70360629 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1619G>A (p.Arg540His) single nucleotide variant FG syndrome 1 [RCV000701859] ChrX:71123595 [GRCh38]
ChrX:70343445 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1963A>G (p.Ser655Gly) single nucleotide variant FG syndrome 1 [RCV000691119] ChrX:71124377 [GRCh38]
ChrX:70344227 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6288_6290GCA[6] (p.Gln2115del) microsatellite FG syndrome 1 [RCV000694662] ChrX:71141248..71141250 [GRCh38]
ChrX:70361098..70361100 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5192G>A (p.Arg1731Lys) single nucleotide variant FG syndrome 1 [RCV000692793] ChrX:71136447 [GRCh38]
ChrX:70356297 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2422+6T>G single nucleotide variant FG syndrome 1 [RCV000693807] ChrX:71125719 [GRCh38]
ChrX:70345569 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6204G>A (p.Gln2068=) single nucleotide variant History of neurodevelopmental disorder [RCV000717951] ChrX:71140794 [GRCh38]
ChrX:70360644 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4711G>A (p.Asp1571Asn) single nucleotide variant History of neurodevelopmental disorder [RCV000717379] ChrX:71134450 [GRCh38]
ChrX:70354300 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2867A>G (p.Lys956Arg) single nucleotide variant History of neurodevelopmental disorder [RCV000717637] ChrX:71127353 [GRCh38]
ChrX:70347203 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5267T>C (p.Leu1756Pro) single nucleotide variant FG syndrome 1 [RCV000868976]|History of neurodevelopmental disorder [RCV000719696] ChrX:71136522 [GRCh38]
ChrX:70356372 [GRCh37]
ChrX:Xq13.1
benign|likely benign
NM_005120.3(MED12):c.1253G>A (p.Arg418His) single nucleotide variant History of neurodevelopmental disorder [RCV000718496] ChrX:71122512 [GRCh38]
ChrX:70342362 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4832G>A (p.Arg1611His) single nucleotide variant History of neurodevelopmental disorder [RCV000719142]|Intellectual disability [RCV000850217]|X-linked MED12-related disorder [RCV000984976] ChrX:71134817 [GRCh38]
ChrX:70354667 [GRCh37]
ChrX:Xq13.1
likely pathogenic|uncertain significance
NM_005120.3(MED12):c.1203G>A (p.Pro401=) single nucleotide variant History of neurodevelopmental disorder [RCV000719461] ChrX:71122301 [GRCh38]
ChrX:70342151 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2571G>A (p.Thr857=) single nucleotide variant History of neurodevelopmental disorder [RCV000719663] ChrX:71126370 [GRCh38]
ChrX:70346220 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6443A>G (p.Gln2148Arg) single nucleotide variant History of neurodevelopmental disorder [RCV000719711] ChrX:71141917 [GRCh38]
ChrX:70361767 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2271G>A (p.Leu757=) single nucleotide variant History of neurodevelopmental disorder [RCV000720032] ChrX:71125395 [GRCh38]
ChrX:70345245 [GRCh37]
ChrX:Xq13.1
likely benign
GRCh37/hg19 Xp11.23-q13.2(chrX:48115450-73424191)x1 copy number loss not provided [RCV000753535] ChrX:48115450..73424191 [GRCh37]
ChrX:Xp11.23-q13.2
pathogenic
NC_000023.10:g.36649710_136649711del100000002insG indel Heterotaxy, visceral, 1, X-linked [RCV000754886] ChrX:36649710..136649711 [GRCh37]
ChrX:Xp21.1-q26.3
pathogenic
GRCh37/hg19 Xq13.1(chrX:70313664-70568458)x2 copy number gain not provided [RCV000753588] ChrX:70313664..70568458 [GRCh37]
ChrX:Xq13.1
benign
GRCh37/hg19 Xq13.1(chrX:70323237-70431963)x2 copy number gain not provided [RCV000753589] ChrX:70323237..70431963 [GRCh37]
ChrX:Xq13.1
benign
GRCh37/hg19 Xp22.33-q28(chrX:60814-155254881)x2 copy number gain not provided [RCV000753277] ChrX:60814..155254881 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60262-155245765)x1 copy number loss not provided [RCV000753271] ChrX:60262..155245765 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60262-155245765)x3 copy number gain not provided [RCV000753272] ChrX:60262..155245765 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:181779-155171702)x1 copy number loss not provided [RCV000753278] ChrX:181779..155171702 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
Single allele duplication Autistic disorder of childhood onset [RCV000754365] ChrX:1..156040895 [GRCh38]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60814-155236712)x2 copy number gain not provided [RCV000753276] ChrX:60814..155236712 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xq11.1-28(chrX:61694576-155254881)x1 copy number loss not provided [RCV000753556] ChrX:61694576..155254881 [GRCh37]
ChrX:Xq11.1-28
pathogenic
NM_005120.3(MED12):c.2286G>A (p.Lys762=) single nucleotide variant not provided [RCV000861706] ChrX:71125410 [GRCh38]
ChrX:70345260 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2871T>C (p.His957=) single nucleotide variant not provided [RCV000978825] ChrX:71127357 [GRCh38]
ChrX:70347207 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5920C>T (p.Gln1974Ter) single nucleotide variant not provided [RCV000760831] ChrX:71137819 [GRCh38]
ChrX:70357669 [GRCh37]
ChrX:Xq13.1
pathogenic
NM_005120.3(MED12):c.2023C>T (p.Leu675Phe) single nucleotide variant Wilms tumor 1 [RCV000760289]|X-linked mental retardation with marfanoid habitus syndrome [RCV000760197] ChrX:71124812 [GRCh38]
ChrX:70344662 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5017_5019AAG[1] (p.Lys1674del) microsatellite X-linked mental retardation with marfanoid habitus syndrome [RCV000760279] ChrX:71135245..71135247 [GRCh38]
ChrX:70355095..70355097 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.734A>G (p.Gln245Arg) single nucleotide variant not provided [RCV000762649] ChrX:71121151 [GRCh38]
ChrX:70341001 [GRCh37]
ChrX:Xq13.1
uncertain significance
46,Y,inv(X)(p21.1q13.3) inversion Elevated serum creatine phosphokinase [RCV000856573] ChrX:32196272..75245806 [GRCh37]
ChrX:Xp21.1-q13.3
likely pathogenic
NM_005120.3(MED12):c.1546C>T (p.Arg516Cys) single nucleotide variant FG syndrome 1 [RCV000757919] ChrX:71123155 [GRCh38]
ChrX:70343005 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.3(MED12):c.3012C>T (p.Ile1004=) single nucleotide variant FG syndrome 1 [RCV000866328] ChrX:71127923 [GRCh38]
ChrX:70347773 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.2395C>T (p.Leu799=) single nucleotide variant not provided [RCV000943740] ChrX:71125686 [GRCh38]
ChrX:70345536 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2862C>T (p.Val954=) single nucleotide variant not provided [RCV000869915] ChrX:71127348 [GRCh38]
ChrX:70347198 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5301C>G (p.Pro1767=) single nucleotide variant not provided [RCV000869479] ChrX:71136556 [GRCh38]
ChrX:70356406 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.147T>A (p.Pro49=) single nucleotide variant FG syndrome 1 [RCV000863265] ChrX:71119420 [GRCh38]
ChrX:70339270 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3934T>C (p.Leu1312=) single nucleotide variant FG syndrome 1 [RCV000868488] ChrX:71130101 [GRCh38]
ChrX:70349951 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2937C>T (p.Tyr979=) single nucleotide variant not provided [RCV000868502] ChrX:71127423 [GRCh38]
ChrX:70347273 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1923C>G (p.Ala641=) single nucleotide variant not provided [RCV000868557] ChrX:71124337 [GRCh38]
ChrX:70344187 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5718C>T (p.Pro1906=) single nucleotide variant not provided [RCV000869456] ChrX:71137353 [GRCh38]
ChrX:70357203 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6177A>G (p.Gln2059=) single nucleotide variant not provided [RCV000915102] ChrX:71140767 [GRCh38]
ChrX:70360617 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1170C>T (p.Thr390=) single nucleotide variant not provided [RCV000867003] ChrX:71122268 [GRCh38]
ChrX:70342118 [GRCh37]
ChrX:Xq13.1
benign
NC_000023.11:g.(?_71118745)_(71224569_?)dup duplication FG syndrome 1 [RCV001033220] ChrX:70338595..70444419 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1033C>T (p.Pro345Ser) single nucleotide variant not provided [RCV000995943] ChrX:71121748 [GRCh38]
ChrX:70341598 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1745-3C>T single nucleotide variant not provided [RCV000995944] ChrX:71124156 [GRCh38]
ChrX:70344006 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3110C>T (p.Thr1037Met) single nucleotide variant FG syndrome 1 [RCV000808894] ChrX:71128021 [GRCh38]
ChrX:70347871 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1208A>G (p.Asn403Ser) single nucleotide variant FG syndrome 1 [RCV000806407] ChrX:71122306 [GRCh38]
ChrX:70342156 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1599G>A (p.Gln533=) single nucleotide variant not provided [RCV000868508] ChrX:71123208 [GRCh38]
ChrX:70343058 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1545G>A (p.Lys515=) single nucleotide variant not provided [RCV000926284] ChrX:71123154 [GRCh38]
ChrX:70343004 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2413A>C (p.Thr805Pro) single nucleotide variant not provided [RCV000875141] ChrX:71125704 [GRCh38]
ChrX:70345554 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.4194A>G (p.Ser1398=) single nucleotide variant FG syndrome 1 [RCV000864100] ChrX:71132147 [GRCh38]
ChrX:70351997 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5836C>T (p.Pro1946Ser) single nucleotide variant not provided [RCV000864124] ChrX:71137735 [GRCh38]
ChrX:70357585 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.2372-10C>T single nucleotide variant FG syndrome 1 [RCV000983515] ChrX:71125653 [GRCh38]
ChrX:70345503 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.966T>C (p.Ala322=) single nucleotide variant FG syndrome 1 [RCV000867270] ChrX:71121681 [GRCh38]
ChrX:70341531 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1662C>T (p.Ala554=) single nucleotide variant not provided [RCV000980642] ChrX:71123638 [GRCh38]
ChrX:70343488 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2265C>T (p.Val755=) single nucleotide variant FG syndrome 1 [RCV000875817] ChrX:71125389 [GRCh38]
ChrX:70345239 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.1476T>C (p.Asp492=) single nucleotide variant not provided [RCV000874339] ChrX:71122865 [GRCh38]
ChrX:70342715 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6201_6206ACAGCA[3] (p.Gln2075_Gln2076dup) microsatellite not provided [RCV000874055] ChrX:71140785..71140786 [GRCh38]
ChrX:70360635..70360636 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5754T>C (p.Ser1918=) single nucleotide variant not provided [RCV000931815] ChrX:71137563 [GRCh38]
ChrX:70357413 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5991C>T (p.Gly1997=) single nucleotide variant not provided [RCV000874117] ChrX:71137890 [GRCh38]
ChrX:70357740 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5109C>T (p.Gly1703=) single nucleotide variant FG syndrome 1 [RCV000872283] ChrX:71136364 [GRCh38]
ChrX:70356214 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.3288T>G (p.Leu1096=) single nucleotide variant not provided [RCV000868014] ChrX:71128374 [GRCh38]
ChrX:70348224 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1639G>A (p.Ala547Thr) single nucleotide variant FG syndrome 1 [RCV000872237] ChrX:71123615 [GRCh38]
ChrX:70343465 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.1098A>G (p.Leu366=) single nucleotide variant not provided [RCV000923138] ChrX:71121813 [GRCh38]
ChrX:70341663 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6165_6173GCAACAGCA[3] (p.Gln2074_Gln2076dup) microsatellite FG syndrome 1 [RCV000874991] ChrX:71140749..71140750 [GRCh38]
ChrX:70360599..70360600 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5602C>G (p.Leu1868Val) single nucleotide variant FG syndrome 1 [RCV000809961] ChrX:71137237 [GRCh38]
ChrX:70357087 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.281C>T (p.Pro94Leu) single nucleotide variant FG syndrome 1 [RCV000793124] ChrX:71119762 [GRCh38]
ChrX:70339612 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6150_6152GCA[7] (p.Gln2076dup) microsatellite FG syndrome 1 [RCV000823071] ChrX:71140738..71140739 [GRCh38]
ChrX:70360588..70360589 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4651A>G (p.Thr1551Ala) single nucleotide variant FG syndrome 1 [RCV000799513] ChrX:71134390 [GRCh38]
ChrX:70354240 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6177_6182ACAGCA[1] (p.Gln2075_Gln2076del) microsatellite FG syndrome 1 [RCV001327489]|not provided [RCV000841999] ChrX:71140762..71140767 [GRCh38]
ChrX:70360612..70360617 [GRCh37]
ChrX:Xq13.1
likely benign|uncertain significance
NM_005120.3(MED12):c.5653G>A (p.Val1885Ile) single nucleotide variant FG syndrome 1 [RCV000810549]|not provided [RCV001310731] ChrX:71137288 [GRCh38]
ChrX:70357138 [GRCh37]
ChrX:Xq13.1
uncertain significance
NC_000023.11:g.71118268G>A single nucleotide variant not provided [RCV000828775] ChrX:71118268 [GRCh38]
ChrX:70338118 [GRCh37]
ChrX:Xq13.1
benign
NC_000023.11:g.71140611C>T single nucleotide variant not provided [RCV000833195] ChrX:70360461 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3505G>T (p.Ala1169Ser) single nucleotide variant FG syndrome 1 [RCV000824877] ChrX:71129143 [GRCh38]
ChrX:70348993 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.3(MED12):c.4231A>G (p.Ser1411Gly) single nucleotide variant FG syndrome 1 [RCV000791614] ChrX:71132184 [GRCh38]
ChrX:70352034 [GRCh37]
ChrX:Xq13.1
uncertain significance
NC_000023.11:g.71119648C>T single nucleotide variant not provided [RCV000832621] ChrX:70339498 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.1744+51A>G single nucleotide variant not provided [RCV000832622] ChrX:71123771 [GRCh38]
ChrX:70343621 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.2056-63G>T single nucleotide variant not provided [RCV000832623] ChrX:71124913 [GRCh38]
ChrX:70344763 [GRCh37]
ChrX:Xq13.1
benign
NC_000023.11:g.71132567T>C single nucleotide variant not provided [RCV000832624] ChrX:70352417 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.6491-58G>A single nucleotide variant not provided [RCV000832625] ChrX:71142117 [GRCh38]
ChrX:70361967 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.503C>T (p.Ala168Val) single nucleotide variant FG syndrome 1 [RCV000821554] ChrX:71120120 [GRCh38]
ChrX:70339970 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5026-189G>C single nucleotide variant not provided [RCV000833078] ChrX:71136092 [GRCh38]
ChrX:70355942 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.5401-87T>C single nucleotide variant not provided [RCV000833079] ChrX:71136792 [GRCh38]
ChrX:70356642 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.6409-125T>C single nucleotide variant not provided [RCV000833080] ChrX:71141758 [GRCh38]
ChrX:70361608 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.553+302C>G single nucleotide variant not provided [RCV000844152] ChrX:71120472 [GRCh38]
ChrX:70340322 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.5360C>G (p.Thr1787Ser) single nucleotide variant FG syndrome 1 [RCV000796450] ChrX:71136615 [GRCh38]
ChrX:70356465 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3355-16C>G single nucleotide variant not provided [RCV000840697] ChrX:71128582 [GRCh38]
ChrX:70348432 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.6465C>T (p.Val2155=) single nucleotide variant not provided [RCV000936699] ChrX:71141939 [GRCh38]
ChrX:70361789 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2383C>T (p.Pro795Ser) single nucleotide variant FG syndrome 1 [RCV000792725] ChrX:71125674 [GRCh38]
ChrX:70345524 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5423G>A (p.Arg1808Gln) single nucleotide variant FG syndrome 1 [RCV000813237] ChrX:71136901 [GRCh38]
ChrX:70356751 [GRCh37]
ChrX:Xq13.1
uncertain significance
NC_000023.11:g.71118549A>G single nucleotide variant not provided [RCV000830104] ChrX:71118549 [GRCh38]
ChrX:70338399 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.1561C>T (p.Arg521Cys) single nucleotide variant X-linked MED12-related disorder [RCV000984932] ChrX:71123170 [GRCh38]
ChrX:70343020 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3721A>G (p.Thr1241Ala) single nucleotide variant FG syndrome 1 [RCV000816484] ChrX:71129709 [GRCh38]
ChrX:70349559 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.727A>C (p.Met243Leu) single nucleotide variant FG syndrome 1 [RCV000791694] ChrX:71121144 [GRCh38]
ChrX:70340994 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5709T>A (p.Pro1903=) single nucleotide variant not provided [RCV000840863] ChrX:71137344 [GRCh38]
ChrX:70357194 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3762_3764AGG[1] (p.Gly1257del) microsatellite FG syndrome 1 [RCV000793086] ChrX:71129748..71129750 [GRCh38]
ChrX:70349598..70349600 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6094C>G (p.Pro2032Ala) single nucleotide variant FG syndrome 1 [RCV001067631] ChrX:71140684 [GRCh38]
ChrX:70360534 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6239G>A (p.Arg2080Gln) single nucleotide variant FG syndrome 1 [RCV000812442] ChrX:71140829 [GRCh38]
ChrX:70360679 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6273_6278dup (p.Gln2115_His2116insGlnGln) microsatellite FG syndrome 1 [RCV000799478] ChrX:71141227..71141228 [GRCh38]
ChrX:70361077..70361078 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6103G>A (p.Ala2035Thr) single nucleotide variant FG syndrome 1 [RCV000794725] ChrX:71140693 [GRCh38]
ChrX:70360543 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5026-249A>T single nucleotide variant not provided [RCV000843307] ChrX:71136032 [GRCh38]
ChrX:70355882 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.1485+5G>A single nucleotide variant FG syndrome 1 [RCV000823116] ChrX:71122879 [GRCh38]
ChrX:70342729 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.817C>T (p.Leu273Phe) single nucleotide variant FG syndrome 1 [RCV000810605] ChrX:71121408 [GRCh38]
ChrX:70341258 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3769G>A (p.Gly1257Ser) single nucleotide variant FG syndrome 1 [RCV000798859] ChrX:71129757 [GRCh38]
ChrX:70349607 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.554-83A>G single nucleotide variant not provided [RCV000833607] ChrX:71120888 [GRCh38]
ChrX:70340738 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.1102-136G>A single nucleotide variant not provided [RCV000833608] ChrX:71122064 [GRCh38]
ChrX:70341914 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.1974+93G>C single nucleotide variant not provided [RCV000833609] ChrX:71124481 [GRCh38]
ChrX:70344331 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.6409-114T>C single nucleotide variant not provided [RCV000833610] ChrX:71141769 [GRCh38]
ChrX:70361619 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.1485+96A>G single nucleotide variant not provided [RCV000833850] ChrX:71122970 [GRCh38]
ChrX:70342820 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.2422+120T>G single nucleotide variant not provided [RCV000833851] ChrX:71125833 [GRCh38]
ChrX:70345683 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.3354+54G>A single nucleotide variant not provided [RCV000833852] ChrX:71128494 [GRCh38]
ChrX:70348344 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.4415+128A>G single nucleotide variant not provided [RCV000833853] ChrX:71132666 [GRCh38]
ChrX:70352516 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.5025+156_5025+157del deletion not provided [RCV000833854] ChrX:71135409..71135410 [GRCh38]
ChrX:70355259..70355260 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.1323C>T (p.Phe441=) single nucleotide variant FG syndrome 1 [RCV000875838] ChrX:71122582 [GRCh38]
ChrX:70342432 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1113G>A (p.Leu371=) single nucleotide variant not provided [RCV000841240] ChrX:71122211 [GRCh38]
ChrX:70342061 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2670C>T (p.Ile890=) single nucleotide variant not provided [RCV000862555] ChrX:71126469 [GRCh38]
ChrX:70346319 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.3918C>T (p.Asp1306=) single nucleotide variant FG syndrome 1 [RCV001089028]|not provided [RCV000829098] ChrX:71130085 [GRCh38]
ChrX:70349935 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2227-4G>A single nucleotide variant FG syndrome 1 [RCV000801279] ChrX:71125347 [GRCh38]
ChrX:70345197 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2450G>A (p.Arg817His) single nucleotide variant FG syndrome 1 [RCV000791861] ChrX:71126063 [GRCh38]
ChrX:70345913 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4047+223A>G single nucleotide variant not provided [RCV000838183] ChrX:71130437 [GRCh38]
ChrX:70350287 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.2698C>T (p.Leu900=) single nucleotide variant FG syndrome 1 [RCV000875215] ChrX:71126981 [GRCh38]
ChrX:70346831 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4428G>A (p.Leu1476=) single nucleotide variant not provided [RCV000841972] ChrX:71132857 [GRCh38]
ChrX:70352707 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4048-1G>A single nucleotide variant FG syndrome 1 [RCV001044680] ChrX:71131549 [GRCh38]
ChrX:70351399 [GRCh37]
ChrX:Xq13.1
uncertain significance
GRCh37/hg19 Xp11.4-q21.32(chrX:40572613-92796528)x1 copy number loss not provided [RCV000845670] ChrX:40572613..92796528 [GRCh37]
ChrX:Xp11.4-q21.32
pathogenic
NM_005120.3(MED12):c.6191_6192insACAGCAACA (p.Gln2074_Gln2076dup) insertion not provided [RCV000915103] ChrX:71140779..71140780 [GRCh38]
ChrX:70360629..70360630 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.224G>C (p.Ser75Thr) single nucleotide variant FG syndrome 1 [RCV000990861] ChrX:71119705 [GRCh38]
ChrX:70339555 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.3(MED12):c.4416-77CTCTT[14] microsatellite FG syndrome 1 [RCV000990862] ChrX:71132767..71132768 [GRCh38]
ChrX:70352617..70352618 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.3946C>G (p.Gln1316Glu) single nucleotide variant X-linked mental retardation with marfanoid habitus syndrome [RCV001249625] ChrX:71130113 [GRCh38]
ChrX:70349963 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6267+3A>C single nucleotide variant FG syndrome 1 [RCV001242549] ChrX:71140860 [GRCh38]
ChrX:70360710 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6384A>G (p.Gln2128=) single nucleotide variant FG syndrome 1 [RCV001240900] ChrX:71141346 [GRCh38]
ChrX:70361196 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5617A>G (p.Thr1873Ala) single nucleotide variant FG syndrome 1 [RCV001237639] ChrX:71137252 [GRCh38]
ChrX:70357102 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3641G>A (p.Arg1214His) single nucleotide variant FG syndrome 1 [RCV001225025] ChrX:71129379 [GRCh38]
ChrX:70349229 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1364G>A (p.Arg455Gln) single nucleotide variant FG syndrome 1 [RCV001206723] ChrX:71122753 [GRCh38]
ChrX:70342603 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6037A>G (p.Thr2013Ala) single nucleotide variant FG syndrome 1 [RCV001207056] ChrX:71137936 [GRCh38]
ChrX:70357786 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3742G>C (p.Glu1248Gln) single nucleotide variant X-linked mental retardation with marfanoid habitus syndrome [RCV001195905] ChrX:71129730 [GRCh38]
ChrX:70349580 [GRCh37]
ChrX:Xq13.1
uncertain significance
GRCh37/hg19 Xp11.21-q28(chrX:54941868-155233731)x1 copy number loss not provided [RCV000848218] ChrX:54941868..155233731 [GRCh37]
ChrX:Xp11.21-q28
uncertain significance
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x4 copy number gain not provided [RCV000846039] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp11.1-q28(chrX:58455352-155233731)x1 copy number loss not provided [RCV000846274] ChrX:58455352..155233731 [GRCh37]
ChrX:Xp11.1-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x1 copy number loss not provided [RCV000848828] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_005120.3(MED12):c.4415+3A>G single nucleotide variant not provided [RCV000995945] ChrX:71132541 [GRCh38]
ChrX:70352391 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6352CAGCAACAG[3] (p.Gln2121_Gln2123dup) microsatellite FG syndrome 1 [RCV001211312] ChrX:71141310..71141311 [GRCh38]
ChrX:70361160..70361161 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.3955C>T (p.Arg1319Cys) single nucleotide variant FG syndrome 1 [RCV001229323] ChrX:71130122 [GRCh38]
ChrX:70349972 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2982-20C>T single nucleotide variant X-linked mental retardation with marfanoid habitus syndrome [RCV001197839] ChrX:71127873 [GRCh38]
ChrX:70347723 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1996A>G (p.Met666Val) single nucleotide variant X-linked mental retardation with marfanoid habitus syndrome [RCV001198284] ChrX:71124785 [GRCh38]
ChrX:70344635 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5124C>A (p.Val1708=) single nucleotide variant not provided [RCV000869844] ChrX:71136379 [GRCh38]
ChrX:70356229 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.906A>G (p.Thr302=) single nucleotide variant not provided [RCV000866625] ChrX:71121621 [GRCh38]
ChrX:70341471 [GRCh37]
ChrX:Xq13.1
benign
NM_005120.3(MED12):c.2535G>A (p.Thr845=) single nucleotide variant not provided [RCV000938639] ChrX:71126148 [GRCh38]
ChrX:70345998 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.553+9C>T single nucleotide variant not provided [RCV000980913] ChrX:71120179 [GRCh38]
ChrX:70340029 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.5862G>A (p.Gln1954=) single nucleotide variant not provided [RCV000910147] ChrX:71137761 [GRCh38]
ChrX:70357611 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1102-9A>G single nucleotide variant not provided [RCV000937313] ChrX:71122191 [GRCh38]
ChrX:70342041 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.4197T>A (p.Ser1399=) single nucleotide variant not provided [RCV000927110] ChrX:71132150 [GRCh38]
ChrX:70352000 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.1485+9A>G single nucleotide variant not provided [RCV000930827] ChrX:71122883 [GRCh38]
ChrX:70342733 [GRCh37]
ChrX:Xq13.1
likely benign
NM_005120.3(MED12):c.2549G>A (p.Arg850Gln) single nucleotide variant FG syndrome 1 [RCV001208256] ChrX:71126348 [GRCh38]
ChrX:70346198 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.4937G>A (p.Arg1646Gln) single nucleotide variant FG syndrome 1 [RCV001245083] ChrX:71135165 [GRCh38]
ChrX:70355015 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6300_6314dup (p.Gln2111_Gln2115dup) duplication FG syndrome 1 [RCV001245544] ChrX:71141256..71141257 [GRCh38]
ChrX:70361106..70361107 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1298A>G (p.Gln433Arg) single nucleotide variant not provided [RCV001090307] ChrX:71122557 [GRCh38]
ChrX:70342407 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.6218A>G (p.Gln2073Arg) single nucleotide variant FG syndrome 1 [RCV001227866] ChrX:71140808 [GRCh38]
ChrX:70360658 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2456G>A (p.Arg819Gln) single nucleotide variant FG syndrome 1 [RCV001220840] ChrX:71126069 [GRCh38]
ChrX:70345919 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.5578C>T (p.Pro1860Ser) single nucleotide variant Ohdo syndrome, X-linked [RCV001251842] ChrX:71137213 [GRCh38]
ChrX:70357063 [GRCh37]
ChrX:Xq13.1
likely pathogenic
NM_005120.3(MED12):c.5878G>A (p.Ala1960Thr) single nucleotide variant FG syndrome 1 [RCV001065641] ChrX:71137777 [GRCh38]
ChrX:70357627 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.1930C>A (p.Pro644Thr) single nucleotide variant FG syndrome 1 [RCV001209902]|not specified [RCV001175074] ChrX:71124344 [GRCh38]
ChrX:70344194 [GRCh37]
ChrX:Xq13.1
uncertain significance
NM_005120.3(MED12):c.2294A>T (p.Asp765Val) single nucleotide variant not specified [