FAM47A (family with sequence similarity 47 member A) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: FAM47A (family with sequence similarity 47 member A) Homo sapiens
Analyze
Symbol: FAM47A
Name: family with sequence similarity 47 member A
RGD ID: 1347430
HGNC Page HGNC
Description: ASSOCIATED WITH Abnormality of neuronal migration; autistic disorder; Intellectual disability; INTERACTS WITH valproic acid
Type: protein-coding
RefSeq Status: VALIDATED
Also known as: family with sequence similarity 47, member A; hypothetical protein LOC158724; MGC27003
RGD Orthologs
Rat
Bonobo
Alliance Genes
More Info more info ...
Allele / Splice: See ClinVar data
Latest Assembly: GRCh38 - Human Genome Assembly GRCh38
Position:
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 EnsemblX34,129,756 - 34,132,314 (-)EnsemblGRCh38hg38GRCh38
GRCh38.p13 EnsemblX34,129,752 - 34,132,314 (-)EnsemblGRCh38hg38GRCh38
GRCh38X34,129,752 - 34,132,314 (-)NCBIGRCh38GRCh38hg38GRCh38
GRCh37X34,147,869 - 34,150,431 (-)NCBIGRCh37GRCh37hg19GRCh37
Build 36X34,057,794 - 34,060,349 (-)NCBINCBI36hg18NCBI36
Build 34X33,907,533 - 33,910,085NCBI
CeleraX38,275,096 - 38,277,674 (-)NCBI
Cytogenetic MapXp21.1NCBI
HuRefX31,885,862 - 31,888,440 (-)NCBIHuRef
CHM1_1X34,178,212 - 34,180,790 (-)NCBICHM1_1
JBrowse: View Region in Genome Browser (JBrowse)
Model


Gene-Chemical Interaction Annotations     Click to see Annotation Detail View
Gene Ontology Annotations     Click to see Annotation Detail View

Molecular Function

Phenotype Annotations     Click to see Annotation Detail View

Human Phenotype
References

Additional References at PubMed
PMID:15489334   PMID:15772651   PMID:17924679   PMID:18029348   PMID:24024966   PMID:29676528   PMID:32296183  


Genomics

Comparative Map Data
FAM47A
(Homo sapiens - human)
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 EnsemblX34,129,756 - 34,132,314 (-)EnsemblGRCh38hg38GRCh38
GRCh38.p13 EnsemblX34,129,752 - 34,132,314 (-)EnsemblGRCh38hg38GRCh38
GRCh38X34,129,752 - 34,132,314 (-)NCBIGRCh38GRCh38hg38GRCh38
GRCh37X34,147,869 - 34,150,431 (-)NCBIGRCh37GRCh37hg19GRCh37
Build 36X34,057,794 - 34,060,349 (-)NCBINCBI36hg18NCBI36
Build 34X33,907,533 - 33,910,085NCBI
CeleraX38,275,096 - 38,277,674 (-)NCBI
Cytogenetic MapXp21.1NCBI
HuRefX31,885,862 - 31,888,440 (-)NCBIHuRef
CHM1_1X34,178,212 - 34,180,790 (-)NCBICHM1_1
Fam47a
(Rattus norvegicus - Norway rat)
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
mRatBN7.2X42,762,231 - 42,763,887 (+)NCBI
Rnor_6.0 EnsemblX45,965,301 - 45,966,934 (+)EnsemblRnor6.0rn6Rnor6.0
Rnor_6.0X45,965,258 - 45,966,930 (+)NCBIRnor6.0Rnor_6.0rn6Rnor6.0
Rnor_5.0X46,183,917 - 46,185,531 (+)NCBIRnor5.0Rnor_5.0rn5Rnor5.0
RGSC_v3.4X64,506,270 - 64,507,565 (+)NCBIRGSC3.4rn4RGSC3.4
CeleraX43,410,152 - 43,411,824 (+)NCBICelera
Cytogenetic MapXq21NCBI
FAM47A
(Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
PanPan1.1X34,300,250 - 34,302,333 (-)NCBIpanpan1.1PanPan1.1panPan2
Mhudiblu_PPA_v0X26,764,406 - 26,767,087 (-)NCBIMhudiblu_PPA_v0panPan3

miRNA Target Status

Predicted Target Of
Summary Value
Count of predictions:109
Count of miRNA genes:108
Interacting mature miRNAs:109
Transcripts:ENST00000346193
Prediction methods:Miranda, Pita, Rnahybrid
Result types:miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.


Expression


RNA-SEQ Expression
High: > 1000 TPM value   Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM   Below Cutoff: < 0.5 TPM

alimentary part of gastrointestinal system circulatory system endocrine system exocrine system hemolymphoid system hepatobiliary system integumental system musculoskeletal system nervous system renal system reproductive system respiratory system sensory system adipose tissue appendage
High
Medium 21
Low 1 1 2 1 343 1
Below cutoff 247 262 181 29 89 12 266 193 422 15 168 183 18 41 217

Sequence


Reference Sequences
RefSeq Acc Id: ENST00000346193   ⟹   ENSP00000345029
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX34,129,756 - 34,132,311 (-)Ensembl
RefSeq Acc Id: ENST00000613251   ⟹   ENSP00000481513
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX34,129,758 - 34,132,314 (-)Ensembl
RefSeq Acc Id: NM_203408   ⟹   NP_981953
RefSeq Status: VALIDATED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38X34,129,752 - 34,132,314 (-)NCBI
GRCh37X34,147,869 - 34,150,447 (-)RGD
Build 36X34,057,794 - 34,060,349 (-)NCBI Archive
CeleraX38,275,096 - 38,277,674 (-)RGD
HuRefX31,885,862 - 31,888,440 (-)RGD
CHM1_1X34,178,212 - 34,180,790 (-)NCBI
Sequence:
Protein Sequences
Protein RefSeqs NP_981953 (Get FASTA)   NCBI Sequence Viewer  
GenBank Protein AAH26171 (Get FASTA)   NCBI Sequence Viewer  
  BAF85043 (Get FASTA)   NCBI Sequence Viewer  
  EAW99068 (Get FASTA)   NCBI Sequence Viewer  
  Q5JRC9 (Get FASTA)   NCBI Sequence Viewer  
Reference Sequences
RefSeq Acc Id: NP_981953   ⟸   NM_203408
- UniProtKB: Q5JRC9 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: ENSP00000345029   ⟸   ENST00000346193
RefSeq Acc Id: ENSP00000481513   ⟸   ENST00000613251


Clinical Variants
Name Type Condition(s) Position(s) Clinical significance
GRCh38/hg38 Xp22.33-q28(chrX:10701-156003242)x3 copy number gain See cases [RCV000133911] ChrX:10701..156003242 [GRCh38]
ChrX:60701..155232907 [GRCh37]
ChrX:701..154886101 [NCBI36]
ChrX:Xp22.33-q28
pathogenic|likely pathogenic|conflicting data from submitters
GRCh38/hg38 Xp22.33-q28(chrX:20140-155699618)x3 copy number gain See cases [RCV000050810] ChrX:20140..155699618 [GRCh38]
ChrX:70140..154929279 [GRCh37]
ChrX:10140..154582473 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:3092486-155699618)x2 copy number gain See cases [RCV000050889] ChrX:3092486..155699618 [GRCh38]
ChrX:3010527..154929279 [GRCh37]
ChrX:3020527..154582473 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:20140-155699618)x1 copy number loss See cases [RCV000050811] ChrX:20140..155699618 [GRCh38]
ChrX:70140..154929279 [GRCh37]
ChrX:10140..154582473 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022206)x1 copy number loss See cases [RCV000050699] ChrX:10679..156022206 [GRCh38]
ChrX:60679..155251871 [GRCh37]
ChrX:679..154905065 [NCBI36]
ChrX:Xp22.33-q28
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 Xp22.33-q28(chrX:10679-156013167)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000050385]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000050385]|See cases [RCV000050385] ChrX:10679..156013167 [GRCh38]
ChrX:60679..155242832 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156013167)x1 copy number loss Global developmental delay [RCV000050386]|See cases [RCV000050386] ChrX:10679..156013167 [GRCh38]
ChrX:60679..155242832 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022206)x3 copy number gain See cases [RCV000050697] ChrX:10679..156022206 [GRCh38]
ChrX:60679..155251871 [GRCh37]
ChrX:679..154905065 [NCBI36]
ChrX:Xp22.33-q28
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 Xp22.33-11.22(chrX:10679-52809182)x1 copy number loss See cases [RCV000051026] ChrX:10679..52809182 [GRCh38]
ChrX:60679..52838206 [GRCh37]
ChrX:679..52854931 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:40704-156022362)x3 copy number gain See cases [RCV000052325] ChrX:40704..156022362 [GRCh38]
ChrX:90704..155252027 [GRCh37]
ChrX:30704..154905221 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26101-155999293)x3 copy number gain See cases [RCV000052322] ChrX:26101..155999293 [GRCh38]
ChrX:76101..155228958 [GRCh37]
ChrX:16101..154882152 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:2790845-155699618)x3 copy number gain See cases [RCV000052359] ChrX:2790845..155699618 [GRCh38]
ChrX:2708886..154929279 [GRCh37]
ChrX:2718886..154582473 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:237659-156022362)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052327]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052327]|See cases [RCV000052327] ChrX:237659..156022362 [GRCh38]
ChrX:154326..155252027 [GRCh37]
ChrX:94326..154905221 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:27245-155996431)x3 copy number gain See cases [RCV000052324] ChrX:27245..155996431 [GRCh38]
ChrX:77245..155226096 [GRCh37]
ChrX:17245..154879290 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.3(chrX:675360-46016699)x3 copy number gain See cases [RCV000052328] ChrX:675360..46016699 [GRCh38]
ChrX:636095..45876134 [GRCh37]
ChrX:556095..45761078 [NCBI36]
ChrX:Xp22.33-11.3
pathogenic
GRCh38/hg38 Xp22.11-11.4(chrX:22420237-38834728)x1 copy number loss See cases [RCV000053063] ChrX:22420237..38834728 [GRCh38]
ChrX:22438354..38693981 [GRCh37]
ChrX:22348275..38578925 [NCBI36]
ChrX:Xp22.11-11.4
pathogenic
GRCh38/hg38 Xp21.1-11.4(chrX:31665506-37921988)x0 copy number loss See cases [RCV000053080] ChrX:31665506..37921988 [GRCh38]
ChrX:31683623..37781241 [GRCh37]
ChrX:31593544..37666185 [NCBI36]
ChrX:Xp21.1-11.4
pathogenic
GRCh38/hg38 Xp22.33-11.23(chrX:10679-48344725)x1 copy number loss See cases [RCV000052981] ChrX:10679..48344725 [GRCh38]
ChrX:60679..48204160 [GRCh37]
ChrX:679..48089104 [NCBI36]
ChrX:Xp22.33-11.23
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26102-155996431)x1 copy number loss Global developmental delay [RCV000052986]|Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052987]|Intellectual functioning disability [RCV000052988]|Global developmental delay [RCV000052989]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052987]|See cases [RCV000052986] ChrX:26102..155996431 [GRCh38]
ChrX:76102..155226096 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.21(chrX:26102-57302794)x1 copy number loss See cases [RCV000052990] ChrX:26102..57302794 [GRCh38]
ChrX:76102..57329227 [GRCh37]
ChrX:16102..57345952 [NCBI36]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.33-q22.1(chrX:675360-100368517)x1 copy number loss See cases [RCV000053005] ChrX:675360..100368517 [GRCh38]
ChrX:636095..99623515 [GRCh37]
ChrX:556095..99510171 [NCBI36]
ChrX:Xp22.33-q22.1
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:14245-155999293)x1 copy number loss Hypoplastic left heart [RCV000052982]|See cases [RCV000052982] ChrX:14245..155999293 [GRCh38]
ChrX:64245..155228958 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.21(chrX:2769041-58055036)x1 copy number loss See cases [RCV000053007] ChrX:2769041..58055036 [GRCh38]
ChrX:2687082..58081470 [GRCh37]
ChrX:2697082..58098195 [NCBI36]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.33-11.1(chrX:253129-58271563)x1 copy number loss See cases [RCV000052994] ChrX:253129..58271563 [GRCh38]
ChrX:169796..58297997 [GRCh37]
ChrX:109796..58314722 [NCBI36]
ChrX:Xp22.33-11.1
pathogenic
GRCh38/hg38 Xp22.33-11.21(chrX:10679-55550898)x1 copy number loss Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052971]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052971]|See cases [RCV000052971] ChrX:10679..55550898 [GRCh38]
ChrX:60679..55577331 [GRCh37]
ChrX:679..55594056 [NCBI36]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26102-155996431)x3 copy number gain Global developmental delay [RCV000052984]|Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052985]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052985]|See cases [RCV000052984] ChrX:26102..155996431 [GRCh38]
ChrX:76102..155226096 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10479-54179172)x3 copy number gain See cases [RCV000053817] ChrX:10479..54179172 [GRCh38]
ChrX:60479..53957191 [GRCh37]
ChrX:479..54222330 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
NM_203408.3(FAM47A):c.2352C>T (p.Ile784=) single nucleotide variant Malignant melanoma [RCV000073175] ChrX:34129927 [GRCh38]
ChrX:34148044 [GRCh37]
ChrX:34057965 [NCBI36]
ChrX:Xp21.1
not provided
NM_203408.3(FAM47A):c.1734C>T (p.Ser578=) single nucleotide variant Malignant melanoma [RCV000073176] ChrX:34130545 [GRCh38]
ChrX:34148662 [GRCh37]
ChrX:34058583 [NCBI36]
ChrX:Xp21.1
not provided
NM_203408.3(FAM47A):c.806C>T (p.Ser269Phe) single nucleotide variant Malignant melanoma [RCV000073177] ChrX:34131473 [GRCh38]
ChrX:34149590 [GRCh37]
ChrX:34059511 [NCBI36]
ChrX:Xp21.1
not provided
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022826)x4 copy number gain See cases [RCV000133654] ChrX:10679..156022826 [GRCh38]
ChrX:60679..155252491 [GRCh37]
ChrX:679..154905685 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:70297-58066465)x3 copy number gain See cases [RCV000239834] ChrX:70297..58066465 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10701-155978689)x1 copy number loss See cases [RCV000133792] ChrX:10701..155978689 [GRCh38]
ChrX:60701..155208354 [GRCh37]
ChrX:701..154861548 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10701-52857805)x1 copy number loss See cases [RCV000133817] ChrX:10701..52857805 [GRCh38]
ChrX:60701..52886834 [GRCh37]
ChrX:701..52903559 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp21.1(chrX:32932236-34171724)x2 copy number gain See cases [RCV000133807] ChrX:32932236..34171724 [GRCh38]
ChrX:32950353..34189841 [GRCh37]
ChrX:32860274..34099762 [NCBI36]
ChrX:Xp21.1
uncertain significance
GRCh38/hg38 Xp22.33-q28(chrX:10679-156013167)x1 copy number loss See cases [RCV000050386] ChrX:10679..156013167 [GRCh38]
ChrX:60679..155242832 [GRCh37]
ChrX:679..154896026 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156013167)x3 copy number gain See cases [RCV000050385] ChrX:10679..156013167 [GRCh38]
ChrX:60679..155242832 [GRCh37]
ChrX:679..154896026 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:14245-155999293)x1 copy number loss See cases [RCV000052982] ChrX:14245..155999293 [GRCh38]
ChrX:64245..155228958 [GRCh37]
ChrX:4245..154882152 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26102-155996431)x1 copy number loss See cases [RCV000052986] ChrX:26102..155996431 [GRCh38]
ChrX:76102..155226096 [GRCh37]
ChrX:16102..154879290 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26102-155996431)x3 copy number gain See cases [RCV000052984] ChrX:26102..155996431 [GRCh38]
ChrX:76102..155226096 [GRCh37]
ChrX:16102..154879290 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.23(chrX:10679-50059388)x1 copy number loss See cases [RCV000133745] ChrX:10679..50059388 [GRCh38]
ChrX:60679..49824045 [GRCh37]
ChrX:679..49710785 [NCBI36]
ChrX:Xp22.33-11.23
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:20297-155999253)x3 copy number gain See cases [RCV000134564] ChrX:20297..155999253 [GRCh38]
ChrX:70297..155228918 [GRCh37]
ChrX:10297..154882112 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q11.1(chrX:10701-62712219)x1 copy number loss See cases [RCV000134568] ChrX:10701..62712219 [GRCh38]
ChrX:60701..61931689 [GRCh37]
ChrX:701..61848414 [NCBI36]
ChrX:Xp22.33-q11.1
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10701-156003242)x1 copy number loss See cases [RCV000133947] ChrX:10701..156003242 [GRCh38]
ChrX:60701..155232907 [GRCh37]
ChrX:701..154886101 [NCBI36]
ChrX:Xp22.33-q28
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 Xp22.33-11.21(chrX:10701-58055053)x1 copy number loss See cases [RCV000134026] ChrX:10701..58055053 [GRCh38]
ChrX:60701..58081487 [GRCh37]
ChrX:701..58098212 [NCBI36]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.31-11.22(chrX:8176030-53962833)x1 copy number loss See cases [RCV000135305] ChrX:8176030..53962833 [GRCh38]
ChrX:8144071..53989266 [GRCh37]
ChrX:8104071..54005991 [NCBI36]
ChrX:Xp22.31-11.22
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:20297-156026127)x1 copy number loss See cases [RCV000135321] ChrX:20297..156026127 [GRCh38]
ChrX:70297..155255792 [GRCh37]
ChrX:10297..154908986 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-21.1(chrX:233335-37292980)x1 copy number loss See cases [RCV000135299] ChrX:233335..37292980 [GRCh38]
ChrX:150002..37152232 [GRCh37]
ChrX:90002..37037153 [NCBI36]
ChrX:Xp22.33-21.1
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10679-52857805)x3 copy number gain See cases [RCV000134957] ChrX:10679..52857805 [GRCh38]
ChrX:60679..52886834 [GRCh37]
ChrX:679..52903559 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp22.33-21.1(chrX:10679-36186635)x1 copy number loss See cases [RCV000135551] ChrX:10679..36186635 [GRCh38]
ChrX:60679..36202463 [GRCh37]
ChrX:679..36114673 [NCBI36]
ChrX:Xp22.33-21.1
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10701-156003229)x1 copy number loss See cases [RCV000136097] ChrX:10701..156003229 [GRCh38]
ChrX:60701..155232894 [GRCh37]
ChrX:701..154886088 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:40904-155998166)x1 copy number loss See cases [RCV000136478] ChrX:40904..155998166 [GRCh38]
ChrX:90904..155227831 [GRCh37]
ChrX:30904..154881025 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q25(chrX:10701-128393708) copy number loss See cases [RCV000136094] ChrX:10701..128393708 [GRCh38]
ChrX:60701..127527686 [GRCh37]
ChrX:701..127355367 [NCBI36]
ChrX:Xp22.33-q25
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10001-156030895)x1 copy number loss See cases [RCV000136005] ChrX:10001..156030895 [GRCh38]
ChrX:60001..155260560 [GRCh37]
ChrX:1..154913754 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10679-52213731)x1 copy number loss See cases [RCV000137112] ChrX:10679..52213731 [GRCh38]
ChrX:60679..51948998 [GRCh37]
ChrX:679..51973598 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic|uncertain significance
GRCh38/hg38 Xp22.33-q28(chrX:2782275-155611794)x2 copy number gain See cases [RCV000136841] ChrX:2782275..155611794 [GRCh38]
ChrX:2700316..154785891 [GRCh37]
ChrX:2710316..154494649 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:2765636-155522304)x3 copy number gain See cases [RCV000136791] ChrX:2765636..155522304 [GRCh38]
ChrX:2683677..154751965 [GRCh37]
ChrX:2693677..154405159 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10701-52033734)x1 copy number loss See cases [RCV000137430] ChrX:10701..52033734 [GRCh38]
ChrX:60701..51776830 [GRCh37]
ChrX:701..51793570 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp22.33-11.21(chrX:10701-58055036)x1 copy number loss See cases [RCV000137552] ChrX:10701..58055036 [GRCh38]
ChrX:60701..58081470 [GRCh37]
ChrX:701..58098195 [NCBI36]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.33-11.23(chrX:10701-49071220)x1 copy number loss See cases [RCV000137413] ChrX:10701..49071220 [GRCh38]
ChrX:60701..48928877 [GRCh37]
ChrX:701..48815821 [NCBI36]
ChrX:Xp22.33-11.23
pathogenic
GRCh38/hg38 Xp22.33-11.23(chrX:10679-49157514)x1 copy number loss See cases [RCV000137166] ChrX:10679..49157514 [GRCh38]
ChrX:60679..49016667 [GRCh37]
ChrX:679..48903611 [NCBI36]
ChrX:Xp22.33-11.23
pathogenic
GRCh38/hg38 Xp22.33-q13.3(chrX:10679-76420505)x3 copy number gain See cases [RCV000137137] ChrX:10679..76420505 [GRCh38]
ChrX:60679..75640898 [GRCh37]
ChrX:679..75557302 [NCBI36]
ChrX:Xp22.33-q13.3
pathogenic|likely benign
GRCh38/hg38 Xp22.33-21.1(chrX:10701-37723318)x1 copy number loss See cases [RCV000138019] ChrX:10701..37723318 [GRCh38]
ChrX:60701..37318587 [GRCh37]
ChrX:701..37467510 [NCBI36]
ChrX:Xp22.33-21.1
pathogenic
GRCh38/hg38 Xp21.3-11.4(chrX:28234352-37850186)x3 copy number gain See cases [RCV000138078] ChrX:28234352..37850186 [GRCh38]
ChrX:28252469..37709439 [GRCh37]
ChrX:28162390..37594383 [NCBI36]
ChrX:Xp21.3-11.4
likely pathogenic|uncertain significance
GRCh38/hg38 Xp22.33-q22.3(chrX:10701-106113403)x1 copy number loss See cases [RCV000137886] ChrX:10701..106113403 [GRCh38]
ChrX:60701..105357395 [GRCh37]
ChrX:701..105244051 [NCBI36]
ChrX:Xp22.33-q22.3
pathogenic
GRCh38/hg38 Xp22.2-q27.3(chrX:13020141-143473520)x1 copy number loss See cases [RCV000138678] ChrX:13020141..143473520 [GRCh38]
ChrX:13038260..142561303 [GRCh37]
ChrX:12948181..142388969 [NCBI36]
ChrX:Xp22.2-q27.3
pathogenic
GRCh38/hg38 Xp22.33-11.1(chrX:10701-58517661)x1 copy number loss See cases [RCV000139343] ChrX:10701..58517661 [GRCh38]
ChrX:60701..58544094 [GRCh37]
ChrX:701..58560819 [NCBI36]
ChrX:Xp22.33-11.1
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:1085618-155699644)x1 copy number loss See cases [RCV000139278] ChrX:1085618..155699644 [GRCh38]
ChrX:1118268..154929305 [GRCh37]
ChrX:1038268..154582499 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q21.31(chrX:10701-88318651)x1 copy number loss See cases [RCV000139352] ChrX:10701..88318651 [GRCh38]
ChrX:60701..87573652 [GRCh37]
ChrX:701..87460308 [NCBI36]
ChrX:Xp22.33-q21.31
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251880-156004181)x3 copy number gain See cases [RCV000139888] ChrX:251880..156004181 [GRCh38]
ChrX:168547..155233846 [GRCh37]
ChrX:108547..154887040 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:2299223-155992188)x3 copy number gain See cases [RCV000141400] ChrX:2299223..155992188 [GRCh38]
ChrX:2217264..155221853 [GRCh37]
ChrX:2227264..154875047 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.4(chrX:3909315-38682287)x3 copy number gain See cases [RCV000141261] ChrX:3909315..38682287 [GRCh38]
ChrX:3827356..38541541 [GRCh37]
ChrX:3837356..38426485 [NCBI36]
ChrX:Xp22.33-11.4
uncertain significance
GRCh38/hg38 Xp22.33-q28(chrX:20297-156016920)x3 copy number gain See cases [RCV000141401] ChrX:20297..156016920 [GRCh38]
ChrX:70297..155246585 [GRCh37]
ChrX:10297..154899779 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251880-156004066)x4 copy number gain See cases [RCV000140786] ChrX:251880..156004066 [GRCh38]
ChrX:168547..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10701-53750424)x1 copy number loss See cases [RCV000140711] ChrX:10701..53750424 [GRCh38]
ChrX:60701..53776922 [GRCh37]
ChrX:701..53793647 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251880-156004066)x1 copy number loss See cases [RCV000140787] ChrX:251880..156004066 [GRCh38]
ChrX:168547..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic|conflicting data from submitters
GRCh38/hg38 Xp22.33-11.22(chrX:251879-50289363)x1 copy number loss See cases [RCV000141741] ChrX:251879..50289363 [GRCh38]
ChrX:168546..50032363 [GRCh37]
ChrX:108546..50049103 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp22.33-q12(chrX:251880-66445845)x1 copy number loss See cases [RCV000142334] ChrX:251880..66445845 [GRCh38]
ChrX:168547..65665687 [GRCh37]
ChrX:108547..65582412 [NCBI36]
ChrX:Xp22.33-q12
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:251880-51643625)x1 copy number loss See cases [RCV000142035] ChrX:251880..51643625 [GRCh38]
ChrX:168547..51386559 [GRCh37]
ChrX:108547..51403299 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp22.33-q24(chrX:251879-118847157)x3 copy number gain See cases [RCV000142134] ChrX:251879..118847157 [GRCh38]
ChrX:168546..117981120 [GRCh37]
ChrX:108546..117865148 [NCBI36]
ChrX:Xp22.33-q24
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10701-156003229)x3 copy number gain See cases [RCV000142625] ChrX:10701..156003229 [GRCh38]
ChrX:60701..155232894 [GRCh37]
ChrX:701..154886088 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10701-53131191)x1 copy number loss See cases [RCV000143348] ChrX:10701..53131191 [GRCh38]
ChrX:60701..53047381 [GRCh37]
ChrX:701..53177098 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251879-156004066)x1 copy number loss See cases [RCV000143441] ChrX:251879..156004066 [GRCh38]
ChrX:168546..155233731 [GRCh37]
ChrX:108546..154886925 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251879-156004066)x3 copy number gain See cases [RCV000143433] ChrX:251879..156004066 [GRCh38]
ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.21(chrX:251879-56428859)x1 copy number loss See cases [RCV000143130] ChrX:251879..56428859 [GRCh38]
ChrX:168546..56455292 [GRCh37]
ChrX:108546..56472017 [NCBI36]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251880-156004066)x3 copy number gain See cases [RCV000143219] ChrX:251880..156004066 [GRCh38]
ChrX:168547..155233731 [GRCh37]
ChrX:108547..154886925 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp21.3-11.4(chrX:28218244-37855706)x3 copy number gain See cases [RCV000143685] ChrX:28218244..37855706 [GRCh38]
ChrX:28236361..37714959 [GRCh37]
ChrX:28146282..37599903 [NCBI36]
ChrX:Xp21.3-11.4
uncertain significance
GRCh38/hg38 Xp22.33-21.1(chrX:251879-35885004)x1 copy number loss See cases [RCV000143496] ChrX:251879..35885004 [GRCh38]
ChrX:168546..35903121 [GRCh37]
ChrX:108546..35813042 [NCBI36]
ChrX:Xp22.33-21.1
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022206)x1 copy number loss See cases [RCV000148135] ChrX:10679..156022206 [GRCh38]
ChrX:60679..155251871 [GRCh37]
ChrX:679..154905065 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022206)x3 copy number gain See cases [RCV000148141] ChrX:10679..156022206 [GRCh38]
ChrX:60679..155251871 [GRCh37]
ChrX:679..154905065 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:71267-155246643)x3 copy number gain See cases [RCV000240122] ChrX:71267..155246643 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_203408.3(FAM47A):c.1310C>T (p.Thr437Met) single nucleotide variant Abnormality of neuronal migration [RCV000201331] ChrX:34130969 [GRCh38]
ChrX:34149086 [GRCh37]
ChrX:Xp21.1
pathogenic|benign
NM_203408.3(FAM47A):c.127A>G (p.Met43Val) single nucleotide variant Abnormality of neuronal migration [RCV000201355] ChrX:34132152 [GRCh38]
ChrX:34150269 [GRCh37]
ChrX:Xp21.1
uncertain significance
GRCh37/hg19 Xp22.33-q28(chrX:176426-155250222)x3 copy number gain See cases [RCV000239843] ChrX:176426..155250222 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:70297-58066465)x1 copy number loss See cases [RCV000239814] ChrX:70297..58066465 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:71267-155255839)x1 copy number loss See cases [RCV000239832] ChrX:71267..155255839 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.2-q28(chrX:13147668-155250222)x3 copy number gain See cases [RCV000239798] ChrX:13147668..155250222 [GRCh37]
ChrX:Xp22.2-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:150002-155234036)x2 copy number gain See cases [RCV000240106] ChrX:150002..155234036 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60701-155246271)x3 copy number gain See cases [RCV000239989] ChrX:60701..155246271 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:71267-155224766)x1 copy number loss See cases [RCV000239902] ChrX:71267..155224766 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:71267-155234036)x2 copy number gain See cases [RCV000239874] ChrX:71267..155234036 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:70297-155255839)x3 copy number gain See cases [RCV000239934] ChrX:70297..155255839 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:176426-155236656)x3 copy number gain See cases [RCV000240552] ChrX:176426..155236656 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:150002-155234036)x3 copy number gain See cases [RCV000240314] ChrX:150002..155234036 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:225816-155234036)x2 copy number gain See cases [RCV000240464] ChrX:225816..155234036 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-21.1(chrX:71267-35809046)x1 copy number loss See cases [RCV000240335] ChrX:71267..35809046 [GRCh37]
ChrX:Xp22.33-21.1
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:2707626-155250222)x2 copy number gain See cases [RCV000240541] ChrX:2707626..155250222 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.2-q25(chrX:11692290-121187337)x2 copy number gain not provided [RCV000488046] ChrX:11692290..121187337 [GRCh37]
ChrX:Xp22.2-q25
uncertain significance
GRCh37/hg19 Xp22.33-11.21(chrX:60814-55476165)x1 copy number loss not provided [RCV000753275] ChrX:60814..55476165 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-11.23(chrX:60814-48317386)x1 copy number loss not provided [RCV000753273] ChrX:60814..48317386 [GRCh37]
ChrX:Xp22.33-11.23
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x3 copy number gain See cases [RCV000449330] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.3(chrX:168546-43917011)x3 copy number gain See cases [RCV000449393] ChrX:168546..43917011 [GRCh37]
ChrX:Xp22.33-11.3
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:70297-155255792) copy number loss See cases [RCV000449461] ChrX:70297..155255792 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-154930047)x3 copy number gain See cases [RCV000449437] ChrX:168546..154930047 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60701-155246225)x3 copy number gain See cases [RCV000446270] ChrX:60701..155246225 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168546-55529093)x1 copy number loss See cases [RCV000446584] ChrX:168546..55529093 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168546-56684082)x1 copy number loss See cases [RCV000447092] ChrX:168546..56684082 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:2703632-155233731)x1 copy number loss See cases [RCV000446712] ChrX:2703632..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.22(chrX:168546-52573789)x1 copy number loss See cases [RCV000447470] ChrX:168546..52573789 [GRCh37]
ChrX:Xp22.33-11.22
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:71267-155255792)x1 copy number loss See cases [RCV000446197] ChrX:71267..155255792 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:318707-155224707)x1 copy number loss See cases [RCV000446667] ChrX:318707..155224707 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x4 copy number gain See cases [RCV000446932] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155196888)x3 copy number gain See cases [RCV000446310] ChrX:168546..155196888 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155081533)x3 copy number gain See cases [RCV000447253] ChrX:168546..155081533 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:553069-155233731)x1 copy number loss See cases [RCV000446026] ChrX:553069..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168566-155233731)x1 copy number loss See cases [RCV000445720] ChrX:168566..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x1 copy number loss See cases [RCV000448393] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:70297-155255792)x4 copy number gain See cases [RCV000448034] ChrX:70297..155255792 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.1(chrX:168546-58140271)x1 copy number loss See cases [RCV000447773] ChrX:168546..58140271 [GRCh37]
ChrX:Xp22.33-11.1
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:70297-155246585)x1 copy number loss See cases [RCV000448652] ChrX:70297..155246585 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168546-55240087)x1 copy number loss See cases [RCV000512136] ChrX:168546..55240087 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-21.1(chrX:168546-37515849)x1 copy number loss See cases [RCV000510590] ChrX:168546..37515849 [GRCh37]
ChrX:Xp22.33-21.1
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168547-151304063)x1 copy number loss See cases [RCV000510382] ChrX:168547..151304063 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-21.1(chrX:168546-35841052)x1 copy number loss See cases [RCV000510308] ChrX:168546..35841052 [GRCh37]
ChrX:Xp22.33-21.1
pathogenic
GRCh37/hg19 Xp22.33-q23(chrX:168547-112474026)x1 copy number loss See cases [RCV000510419] ChrX:168547..112474026 [GRCh37]
ChrX:Xp22.33-q23
pathogenic
GRCh37/hg19 Xp22.33-11.1(chrX:168546-58527164)x1 copy number loss See cases [RCV000510437] ChrX:168546..58527164 [GRCh37]
ChrX:Xp22.33-11.1
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168546-57504183)x1 copy number loss See cases [RCV000511615] ChrX:168546..57504183 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168546-57683964)x1 copy number loss See cases [RCV000512022] ChrX:168546..57683964 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp21.2-q28(chrX:31088082-155233731)x1 copy number loss See cases [RCV000511413] ChrX:31088082..155233731 [GRCh37]
ChrX:Xp21.2-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168547-155233731) copy number gain See cases [RCV000512020] ChrX:168547..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168546-54996659)x1 copy number loss See cases [RCV000510822] ChrX:168546..54996659 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-q13.3(chrX:168546-74549686) copy number loss See cases [RCV000512142] ChrX:168546..74549686 [GRCh37]
ChrX:Xp22.33-q13.3
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168564-57413442)x1 copy number loss See cases [RCV000512339] ChrX:168564..57413442 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-11.23(chrX:168546-46908284)x1 copy number loss not provided [RCV000684185] ChrX:168546..46908284 [GRCh37]
ChrX:Xp22.33-11.23
pathogenic
GRCh37/hg19 Xp22.31-q21.31(chrX:7841947-90815333)x1,2 copy number gain not provided [RCV000684261] ChrX:7841947..90815333 [GRCh37]
ChrX:Xp22.31-q21.31
pathogenic
GRCh37/hg19 Xp22.33-11.3(chrX:168546-43248706)x1 copy number loss not provided [RCV000684184] ChrX:168546..43248706 [GRCh37]
ChrX:Xp22.33-11.3
pathogenic
GRCh37/hg19 Xp22.33-11.22(chrX:60814-51821765)x1 copy number loss not provided [RCV000753274] ChrX:60814..51821765 [GRCh37]
ChrX:Xp22.33-11.22
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x1 copy number loss not provided [RCV000848828] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp21.1(chrX:34117079-34333522)x2 copy number gain not provided [RCV000753490] ChrX:34117079..34333522 [GRCh37]
ChrX:Xp21.1
benign
GRCh37/hg19 Xp21.1(chrX:34137327-34333522)x2 copy number gain not provided [RCV000753491] ChrX:34137327..34333522 [GRCh37]
ChrX:Xp21.1
benign
GRCh37/hg19 Xp21.1(chrX:34137327-34416776)x2 copy number gain not provided [RCV000753493] ChrX:34137327..34416776 [GRCh37]
ChrX:Xp21.1
benign
GRCh37/hg19 Xp21.1(chrX:34137327-34383989)x2 copy number gain not provided [RCV000753492] ChrX:34137327..34383989 [GRCh37]
ChrX:Xp21.1
benign
GRCh37/hg19 Xp22.33-q28(chrX:60814-155254881)x2 copy number gain not provided [RCV000753277] ChrX:60814..155254881 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60262-155245765)x1 copy number loss not provided [RCV000753271] ChrX:60262..155245765 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60262-155245765)x3 copy number gain not provided [RCV000753272] ChrX:60262..155245765 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:181779-155171702)x1 copy number loss not provided [RCV000753278] ChrX:181779..155171702 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
Single allele duplication Autistic disorder of childhood onset [RCV000754365] ChrX:1..156040895 [GRCh38]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60814-155236712)x2 copy number gain not provided [RCV000753276] ChrX:60814..155236712 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_203408.3(FAM47A):c.246T>C (p.Ser82=) single nucleotide variant not provided [RCV000961242] ChrX:34132033 [GRCh38]
ChrX:34150150 [GRCh37]
ChrX:Xp21.1
benign|likely benign
NC_000023.11:g.34130721_34130759CCGAGCGGAGACTGGACGTCCGACGAGTCTTGGGAGGCT[1] microsatellite not provided [RCV000948514] ChrX:34130689..34130727 [GRCh38]
ChrX:34148806..34148844 [GRCh37]
ChrX:Xp21.1
benign
NM_203408.3(FAM47A):c.377T>C (p.Met126Thr) single nucleotide variant not provided [RCV000969761] ChrX:34131902 [GRCh38]
ChrX:34150019 [GRCh37]
ChrX:Xp21.1
benign
NC_000023.10:g.(?_30326313)_(41000684_?)del deletion Ornithine carbamoyltransferase deficiency [RCV001033914] ChrX:30326313..41000684 [GRCh37]
ChrX:Xp21.2-11.4
pathogenic
46,Y,inv(X)(p21.1q13.3) inversion Elevated serum creatine phosphokinase [RCV000856573] ChrX:32196272..75245806 [GRCh37]
ChrX:Xp21.1-q13.3
likely pathogenic
Single allele duplication Syndromic X-linked intellectual disability Lubs type [RCV000768455] ChrX:15323210..153542100 [GRCh37]
ChrX:Xp22.2-q28
pathogenic
GRCh37/hg19 Xp22.33-11.4(chrX:168546-38054739)x1 copy number loss not provided [RCV000845671] ChrX:168546..38054739 [GRCh37]
ChrX:Xp22.33-11.4
pathogenic
GRCh37/hg19 Xp21.1-11.3(chrX:32849282-43713387)x1 copy number loss not provided [RCV001007291] ChrX:32849282..43713387 [GRCh37]
ChrX:Xp21.1-11.3
pathogenic
GRCh37/hg19 Xp22.33-11.22(chrX:60814-50519984)x1 copy number loss See cases [RCV000790583] ChrX:60814..50519984 [GRCh37]
ChrX:Xp22.33-11.22
pathogenic
Single allele deletion Neurodevelopmental disorder [RCV000787440] ChrX:1..47140860 [GRCh37]
ChrX:Xp22.33-11.23
pathogenic
GRCh37/hg19 Xp22.12-21.1(chrX:20925922-35511818)x1 copy number loss not provided [RCV000847678] ChrX:20925922..35511818 [GRCh37]
ChrX:Xp22.12-21.1
pathogenic
NM_203408.3(FAM47A):c.1624A>G (p.Ser542Gly) single nucleotide variant not provided [RCV000999387] ChrX:34130655 [GRCh38]
ChrX:34148772 [GRCh37]
ChrX:Xp21.1
uncertain significance
GRCh37/hg19 Xp22.33-21.1(chrX:168546-34753512)x1 copy number loss not provided [RCV001007559] ChrX:168546..34753512 [GRCh37]
ChrX:Xp22.33-21.1
pathogenic
GRCh37/hg19 Xp22.33-q11.1(chrX:168546-61877279)x1 copy number loss not provided [RCV000846273] ChrX:168546..61877279 [GRCh37]
ChrX:Xp22.33-q11.1
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x4 copy number gain not provided [RCV000846039] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:539722-55509385)x1 copy number loss not provided [RCV001007224] ChrX:539722..55509385 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
NM_203408.3(FAM47A):c.1707C>A (p.Phe569Leu) single nucleotide variant Intellectual disability [RCV001252482] ChrX:34130572 [GRCh38]
ChrX:34148689 [GRCh37]
ChrX:Xp21.1
likely benign
NM_203408.3(FAM47A):c.522_523del (p.Glu174fs) deletion Intellectual disability [RCV001252483] ChrX:34131756..34131757 [GRCh38]
ChrX:34149873..34149874 [GRCh37]
ChrX:Xp21.1
likely benign
NM_203408.3(FAM47A):c.748G>A (p.Gly250Arg) single nucleotide variant Intellectual disability [RCV001252484] ChrX:34131531 [GRCh38]
ChrX:34149648 [GRCh37]
ChrX:Xp21.1
likely benign
GRCh37/hg19 Xp22.33-11.21(chrX:219609-55466476)x1 copy number loss See cases [RCV001263061] ChrX:219609..55466476 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168546-56457794)x1 copy number loss not provided [RCV001281358] ChrX:168546..56457794 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic

Additional Information

Database Acc Id Source(s)
AGR Gene HGNC:29962 AgrOrtholog
COSMIC FAM47A COSMIC
Ensembl Genes ENSG00000185448 Ensembl, ENTREZGENE, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Ensembl Protein ENSP00000345029 ENTREZGENE, UniProtKB/Swiss-Prot
  ENSP00000481513 UniProtKB/TrEMBL
Ensembl Transcript ENST00000346193 ENTREZGENE, UniProtKB/Swiss-Prot
  ENST00000613251 UniProtKB/TrEMBL
GTEx ENSG00000185448 GTEx
HGNC ID HGNC:29962 ENTREZGENE
Human Proteome Map FAM47A Human Proteome Map
InterPro FAM47 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
KEGG Report hsa:158724 UniProtKB/Swiss-Prot
NCBI Gene 158724 ENTREZGENE
Pfam FAM47 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PharmGKB PA134944222 PharmGKB
UniProt A0A0C4DGW7_HUMAN UniProtKB/TrEMBL
  FA47A_HUMAN UniProtKB/Swiss-Prot, ENTREZGENE
UniProt Secondary A8K8I9 UniProtKB/Swiss-Prot
  Q8TAA0 UniProtKB/Swiss-Prot


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2015-11-24 FAM47A  family with sequence similarity 47 member A    family with sequence similarity 47, member A  Symbol and/or name change 5135510 APPROVED