NM_173842.3(IL1RN):c.206-516ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC[2] |
microsatellite |
Gastric cancer susceptibility after h. pylori infection [RCV000015787]|Microvascular complications of diabetes, susceptibility to, 4 [RCV000015788] |
Chr2:113130529..113130700 [GRCh38] Chr2:113888106..113888277 [GRCh37] Chr2:2q14.1 |
pathogenic|risk factor |
IL1RN, 2-BP DEL, 156CA |
deletion |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000015791] |
Chr2:2q14.2 |
pathogenic |
NC_000002.12:g.112960554_113135775del |
deletion |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000015792] |
Chr2:2q14.2 |
pathogenic |
NM_173842.3(IL1RN):c.229G>T (p.Glu77Ter) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000015789]|not provided [RCV000084165] |
Chr2:113131068 [GRCh38] Chr2:113888645 [GRCh37] Chr2:2q14.1 |
pathogenic|not provided |
NM_173842.3(IL1RN):c.160C>T (p.Gln54Ter) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000015790]|not provided [RCV000084164] |
Chr2:113129619 [GRCh38] Chr2:113887196 [GRCh37] Chr2:2q14.1 |
pathogenic|not provided |
NM_173841.2(IL1RN):c.442T>G (p.Phe148Val) |
single nucleotide variant |
Malignant melanoma [RCV000060302] |
Chr2:113132770 [GRCh38] Chr2:113890347 [GRCh37] Chr2:113606818 [NCBI36] Chr2:2q14.1 |
not provided |
NM_173842.3(IL1RN):c.156_157del (p.Asn52fs) |
deletion |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001857408]|not provided [RCV000084163] |
Chr2:113129614..113129615 [GRCh38] Chr2:113887191..113887192 [GRCh37] Chr2:2q14.1 |
pathogenic|not provided |
NM_173842.1(IL1RN):c.-64_1696del |
deletion |
not provided [RCV000162093] |
Chr2:113127561..113134033 [GRCh38] Chr2:113885138..113891610 [GRCh37] Chr2:2q14.1 |
not provided |
NM_173842.3(IL1RN):c.*1039C>T |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000260421] |
Chr2:113133910 [GRCh38] Chr2:113891487 [GRCh37] Chr2:2q14.1 |
likely benign|uncertain significance |
NM_173842.3(IL1RN):c.459C>T (p.Asp153=) |
single nucleotide variant |
Autoinflammatory syndrome [RCV002263602]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000386219] |
Chr2:113132796 [GRCh38] Chr2:113890373 [GRCh37] Chr2:2q14.1 |
benign|likely benign |
GRCh37/hg19 2q12.2-14.1(chr2:106423310-115054828)x1 |
copy number loss |
See cases [RCV000240053] |
Chr2:106423310..115054828 [GRCh37] Chr2:2q12.2-14.1 |
pathogenic |
NM_173842.3(IL1RN):c.*138C>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000279064]|not provided [RCV001653605] |
Chr2:113133009 [GRCh38] Chr2:113890586 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.69G>A (p.Thr23=) |
single nucleotide variant |
Autoinflammatory syndrome [RCV002263599]|Microvascular complications of diabetes, susceptibility to, 4 [RCV002480172]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000269844]|not provided [RCV000658875] |
Chr2:113127693 [GRCh38] Chr2:113885270 [GRCh37] Chr2:2q14.1 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
GRCh37/hg19 2q12.3-14.3(chr2:109798247-125658380)x1 |
copy number loss |
See cases [RCV000240485] |
Chr2:109798247..125658380 [GRCh37] Chr2:2q12.3-14.3 |
pathogenic |
GRCh38/hg38 2q14.1(chr2:112924872-113105404)x1 |
copy number loss |
See cases [RCV000053808] |
Chr2:112924872..113105404 [GRCh38] Chr2:113682449..113862981 [GRCh37] Chr2:113398920..113579452 [NCBI36] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.171T>C (p.Ala57=) |
single nucleotide variant |
Autoinflammatory syndrome [RCV002263601]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000389038]|not provided [RCV001723919]|not specified [RCV000455594] |
Chr2:113129630 [GRCh38] Chr2:113887207 [GRCh37] Chr2:2q14.1 |
benign |
NM_173841.3(IL1RN):c.-31A>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000264084]|not provided [RCV001718697] |
Chr2:113117988 [GRCh38] Chr2:113875565 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.318+12C>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000275837] |
Chr2:113131169 [GRCh38] Chr2:113888746 [GRCh37] Chr2:2q14.1 |
conflicting interpretations of pathogenicity|uncertain significance |
NM_173842.3(IL1RN):c.529G>A (p.Glu177Lys) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000282452]|not provided [RCV001706542]|not specified [RCV001731611] |
Chr2:113132866 [GRCh38] Chr2:113890443 [GRCh37] Chr2:2q14.1 |
likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_173841.3(IL1RN):c.73+8A>C |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000364652]|not provided [RCV001653604]|not specified [RCV000455023] |
Chr2:113120136 [GRCh38] Chr2:113877713 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.390T>C (p.Ser130=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000330957]|not provided [RCV001643028]|not specified [RCV000454505] |
Chr2:113132727 [GRCh38] Chr2:113890304 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.116+5G>A |
single nucleotide variant |
Autoinflammatory syndrome [RCV002263600]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000325166] |
Chr2:113127745 [GRCh38] Chr2:113885322 [GRCh37] Chr2:2q14.1 |
benign|likely benign |
NM_173842.3(IL1RN):c.*691del |
deletion |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000275491] |
Chr2:113133553 [GRCh38] Chr2:113891130 [GRCh37] Chr2:2q14.1 |
uncertain significance |
GRCh37/hg19 2q12.3-14.1(chr2:109556627-117570152)x1 |
copy number loss |
See cases [RCV000240490] |
Chr2:109556627..117570152 [GRCh37] Chr2:2q12.3-14.1 |
pathogenic |
NM_173842.3(IL1RN):c.370G>A (p.Ala124Thr) |
single nucleotide variant |
Autoinflammatory syndrome [RCV002263787]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000550180]|not provided [RCV002223870] |
Chr2:113132707 [GRCh38] Chr2:113890284 [GRCh37] Chr2:2q14.1 |
benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_173842.3(IL1RN):c.*130C>T |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000373524] |
Chr2:113133001 [GRCh38] Chr2:113890578 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*601C>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000315277] |
Chr2:113133472 [GRCh38] Chr2:113891049 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*964G>A |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000355397] |
Chr2:113133835 [GRCh38] Chr2:113891412 [GRCh37] Chr2:2q14.1 |
benign |
NM_173841.2(IL1RN):c.-87G>A |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000402395]|not provided [RCV001613074] |
Chr2:113117932 [GRCh38] Chr2:113875509 [GRCh37] Chr2:2q14.1 |
benign |
NM_173841.2(IL1RN):c.-83G>A |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000304296] |
Chr2:113117936 [GRCh38] Chr2:113875513 [GRCh37] Chr2:2q14.1 |
likely benign|uncertain significance |
NM_173842.3(IL1RN):c.*119C>T |
single nucleotide variant |
Autoinflammatory syndrome [RCV002263603]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000318920] |
Chr2:113132990 [GRCh38] Chr2:113890567 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*958C>T |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000319231] |
Chr2:113133829 [GRCh38] Chr2:113891406 [GRCh37] Chr2:2q14.1 |
benign|uncertain significance |
NM_173841.2(IL1RN):c.-71A>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000359043] |
Chr2:113117948 [GRCh38] Chr2:113875525 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*162C>T |
single nucleotide variant |
Autoinflammatory syndrome [RCV002263604]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000343482] |
Chr2:113133033 [GRCh38] Chr2:113890610 [GRCh37] Chr2:2q14.1 |
benign|likely benign|uncertain significance |
NM_173842.3(IL1RN):c.*382C>T |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000364326] |
Chr2:113133253 [GRCh38] Chr2:113890830 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173841.3(IL1RN):c.-12G>C |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000309920]|not provided [RCV001618583]|not specified [RCV000454566] |
Chr2:113118007 [GRCh38] Chr2:113875584 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.*644del |
deletion |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000370119] |
Chr2:113133515 [GRCh38] Chr2:113891092 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*311G>A |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000394829] |
Chr2:113133182 [GRCh38] Chr2:113890759 [GRCh37] Chr2:2q14.1 |
benign|likely benign |
GRCh37/hg19 2p25.3-q37.3(chr2:14238-243048760)x3 |
copy number gain |
not provided [RCV000752802] |
Chr2:14238..243048760 [GRCh37] Chr2:2p25.3-q37.3 |
pathogenic |
NM_173842.3(IL1RN):c.*1049A>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000379765] |
Chr2:113133920 [GRCh38] Chr2:113891497 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*490del |
deletion |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000398420] |
Chr2:113133351 [GRCh38] Chr2:113890928 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*1040G>A |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000315607] |
Chr2:113133911 [GRCh38] Chr2:113891488 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*245G>A |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000284512] |
Chr2:113133116 [GRCh38] Chr2:113890693 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173841.2(IL1RN):c.*1145A>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000285357] |
Chr2:113134016 [GRCh38] Chr2:113891593 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*369T>A |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000309586] |
Chr2:113133240 [GRCh38] Chr2:113890817 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*165C>T |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000394827] |
Chr2:113133036 [GRCh38] Chr2:113890613 [GRCh37] Chr2:2q14.1 |
uncertain significance |
GRCh37/hg19 2q13(chr2:113735617-113891118)x1 |
copy number loss |
See cases [RCV000448884] |
Chr2:113735617..113891118 [GRCh37] Chr2:2q13 |
benign |
GRCh37/hg19 2p25.3-q37.3(chr2:12771-242783384) |
copy number gain |
See cases [RCV000512056] |
Chr2:12771..242783384 [GRCh37] Chr2:2p25.3-q37.3 |
pathogenic |
GRCh37/hg19 2p25.3-q37.3(chr2:12771-242783384)x3 |
copy number gain |
See cases [RCV000511212] |
Chr2:12771..242783384 [GRCh37] Chr2:2p25.3-q37.3 |
pathogenic |
NM_173842.3(IL1RN):c.79C>T (p.Pro27Ser) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000646721] |
Chr2:113127703 [GRCh38] Chr2:113885280 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*310T>C |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000340072] |
Chr2:113133181 [GRCh38] Chr2:113890758 [GRCh37] Chr2:2q14.1 |
likely benign |
NM_173842.3(IL1RN):c.245T>A (p.Phe82Tyr) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000646722] |
Chr2:113131084 [GRCh38] Chr2:113888661 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.237T>C (p.His79=) |
single nucleotide variant |
Autoinflammatory syndrome [RCV002263898]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000646723] |
Chr2:113131076 [GRCh38] Chr2:113888653 [GRCh37] Chr2:2q14.1 |
benign|likely benign |
NM_173842.3(IL1RN):c.465C>T (p.Pro155=) |
single nucleotide variant |
Autoinflammatory syndrome [RCV002263899]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000646724] |
Chr2:113132802 [GRCh38] Chr2:113890379 [GRCh37] Chr2:2q14.1 |
benign|likely benign |
NM_173842.3(IL1RN):c.205+242C>T |
single nucleotide variant |
Autoinflammatory syndrome [RCV002263900]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000646725]|not provided [RCV001724114] |
Chr2:113129906 [GRCh38] Chr2:113887483 [GRCh37] Chr2:2q14.1 |
benign |
GRCh37/hg19 2q12.1-24.3(chr2:104172062-168223828)x1 |
copy number loss |
Poly (ADP-Ribose) polymerase inhibitor response [RCV000626436] |
Chr2:104172062..168223828 [GRCh37] Chr2:2q12.1-24.3 |
drug response |
NM_173842.3(IL1RN):c.62C>G (p.Ser21Ter) |
single nucleotide variant |
not provided [RCV000512716] |
Chr2:113127686 [GRCh38] Chr2:113885263 [GRCh37] Chr2:2q14.1 |
likely pathogenic |
NM_173842.3(IL1RN):c.23G>A (p.Arg8His) |
single nucleotide variant |
not provided [RCV000513390] |
Chr2:113127647 [GRCh38] Chr2:113885224 [GRCh37] Chr2:2q14.1 |
likely benign |
NM_173842.3(IL1RN):c.374T>G (p.Phe125Cys) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000686492] |
Chr2:113132711 [GRCh38] Chr2:113890288 [GRCh37] Chr2:2q14.1 |
uncertain significance |
Single allele |
deletion |
not provided [RCV000714264] |
Chr2:40608411..146900718 [GRCh37] Chr2:2p22.1-q22.3 |
likely pathogenic |
NM_173842.3(IL1RN):c.63A>G (p.Ser21=) |
single nucleotide variant |
Interstitial lung disease 2 [RCV000677223]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000779276] |
Chr2:113127687 [GRCh38] Chr2:113885264 [GRCh37] Chr2:2q14.1 |
uncertain significance |
GRCh37/hg19 2q13(chr2:113698135-114064263)x1 |
copy number loss |
not provided [RCV000682066] |
Chr2:113698135..114064263 [GRCh37] Chr2:2q13 |
uncertain significance |
NM_173841.3(IL1RN):c.28G>C (p.Gly10Arg) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000687661] |
Chr2:113120083 [GRCh38] Chr2:113877660 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173841.3(IL1RN):c.58A>C (p.Asn20His) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000693420] |
Chr2:113120113 [GRCh38] Chr2:113877690 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.272G>T (p.Cys91Phe) |
single nucleotide variant |
Autoinflammatory syndrome [RCV002263948]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000705510]|not provided [RCV000997195] |
Chr2:113131111 [GRCh38] Chr2:113888688 [GRCh37] Chr2:2q14.1 |
uncertain significance |
GRCh37/hg19 2p25.3-q37.3(chr2:15672-243101834)x3 |
copy number gain |
not provided [RCV000752804] |
Chr2:15672..243101834 [GRCh37] Chr2:2p25.3-q37.3 |
pathogenic |
NM_173841.3(IL1RN):c.10+26T>C |
single nucleotide variant |
not provided [RCV001648580] |
Chr2:113118054 [GRCh38] Chr2:113875631 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.318+272T>G |
single nucleotide variant |
not provided [RCV001667709] |
Chr2:113131429 [GRCh38] Chr2:113889006 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.205+158G>A |
single nucleotide variant |
not provided [RCV001679872] |
Chr2:113129822 [GRCh38] Chr2:113887399 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.339G>A (p.Leu113=) |
single nucleotide variant |
not provided [RCV000981805] |
Chr2:113132676 [GRCh38] Chr2:113890253 [GRCh37] Chr2:2q14.1 |
likely benign |
NM_173842.3(IL1RN):c.489C>T (p.Asp163=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000926784] |
Chr2:113132826 [GRCh38] Chr2:113890403 [GRCh37] Chr2:2q14.1 |
likely benign |
NM_173842.3(IL1RN):c.418G>A (p.Ala140Thr) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001041483] |
Chr2:113132755 [GRCh38] Chr2:113890332 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.466G>A (p.Val156Ile) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001041752] |
Chr2:113132803 [GRCh38] Chr2:113890380 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.213_227del (p.Asp72_Ile76del) |
deletion |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000818103] |
Chr2:113131050..113131064 [GRCh38] Chr2:113888627..113888641 [GRCh37] Chr2:2q14.1 |
likely pathogenic|uncertain significance |
NM_173842.3(IL1RN):c.109G>T (p.Ala37Ser) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000813494] |
Chr2:113127733 [GRCh38] Chr2:113885310 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.185G>A (p.Gly62Glu) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000817668] |
Chr2:113129644 [GRCh38] Chr2:113887221 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.166G>A (p.Val56Ile) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001132305] |
Chr2:113129625 [GRCh38] Chr2:113887202 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*290T>A |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001134695] |
Chr2:113133161 [GRCh38] Chr2:113890738 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.205+8G>A |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001132306] |
Chr2:113129672 [GRCh38] Chr2:113887249 [GRCh37] Chr2:2q14.1 |
uncertain significance |
GRCh37/hg19 2q11.1-13(chr2:96353030-114045463)x3 |
copy number gain |
not provided [RCV000682168] |
Chr2:96353030..114045463 [GRCh37] Chr2:2q11.1-13 |
pathogenic |
NM_173842.3(IL1RN):c.450G>A (p.Met150Ile) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000694345] |
Chr2:113132787 [GRCh38] Chr2:113890364 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.117-9C>T |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000929590] |
Chr2:113129567 [GRCh38] Chr2:113887144 [GRCh37] Chr2:2q14.1 |
likely benign|conflicting interpretations of pathogenicity |
NM_173842.3(IL1RN):c.495C>T (p.Gly165=) |
single nucleotide variant |
Autoinflammatory syndrome [RCV002264098]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000930942] |
Chr2:113132832 [GRCh38] Chr2:113890409 [GRCh37] Chr2:2q14.1 |
likely benign|uncertain significance |
NM_173842.3(IL1RN):c.192T>C (p.Asn64=) |
single nucleotide variant |
Autoinflammatory syndrome [RCV002264132]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000980969] |
Chr2:113129651 [GRCh38] Chr2:113887228 [GRCh37] Chr2:2q14.1 |
likely benign|uncertain significance |
NM_173842.3(IL1RN):c.486T>C (p.Pro162=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001497635] |
Chr2:113132823 [GRCh38] Chr2:113890400 [GRCh37] Chr2:2q14.1 |
likely benign |
NM_173841.3(IL1RN):c.44G>A (p.Gly15Glu) |
single nucleotide variant |
Autoinflammatory syndrome [RCV002264005]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000811873] |
Chr2:113120099 [GRCh38] Chr2:113877676 [GRCh37] Chr2:2q14.1 |
uncertain significance |
GRCh37/hg19 2q13(chr2:113717386-113892774)x1 |
copy number loss |
not provided [RCV000847007] |
Chr2:113717386..113892774 [GRCh37] Chr2:2q13 |
pathogenic |
NM_173842.3(IL1RN):c.305G>C (p.Arg102Thr) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001238669] |
Chr2:113131144 [GRCh38] Chr2:113888721 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.220G>A (p.Val74Ile) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001231377] |
Chr2:113131059 [GRCh38] Chr2:113888636 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.446C>T (p.Ala149Val) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001226366] |
Chr2:113132783 [GRCh38] Chr2:113890360 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173841.3(IL1RN):c.4G>A (p.Ala2Thr) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001226116] |
Chr2:113118022 [GRCh38] Chr2:113875599 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*75C>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001133237] |
Chr2:113132946 [GRCh38] Chr2:113890523 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173841.3(IL1RN):c.11-230G>T |
single nucleotide variant |
not provided [RCV001621257] |
Chr2:113119836 [GRCh38] Chr2:113877413 [GRCh37] Chr2:2q14.1 |
benign |
NM_173841.3(IL1RN):c.11-105G>C |
single nucleotide variant |
not provided [RCV001645378] |
Chr2:113119961 [GRCh38] Chr2:113877538 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.206-43T>C |
single nucleotide variant |
not provided [RCV001720657] |
Chr2:113131002 [GRCh38] Chr2:113888579 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.205+21C>T |
single nucleotide variant |
not provided [RCV001720671] |
Chr2:113129685 [GRCh38] Chr2:113887262 [GRCh37] Chr2:2q14.1 |
benign |
NM_173841.3(IL1RN):c.11-148G>T |
single nucleotide variant |
not provided [RCV001670476] |
Chr2:113119918 [GRCh38] Chr2:113877495 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.318+166T>A |
single nucleotide variant |
not provided [RCV001657579] |
Chr2:113131323 [GRCh38] Chr2:113888900 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.414T>C (p.Ser138=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV000910623] |
Chr2:113132751 [GRCh38] Chr2:113890328 [GRCh37] Chr2:2q14.1 |
likely benign|conflicting interpretations of pathogenicity |
NM_173841.2(IL1RN):c.*1156T>C |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001132403] |
Chr2:113134027 [GRCh38] Chr2:113891604 [GRCh37] Chr2:2q14.1 |
likely benign |
NM_173842.3(IL1RN):c.426C>T (p.Pro142=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001428761] |
Chr2:113132763 [GRCh38] Chr2:113890340 [GRCh37] Chr2:2q14.1 |
likely benign |
NC_000002.12:g.(?_113116893)_(113135016_?)del |
deletion |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001032678] |
Chr2:113874470..113892593 [GRCh37] Chr2:2q13 |
pathogenic |
NM_173842.3(IL1RN):c.318+327G>A |
single nucleotide variant |
not provided [RCV001620214] |
Chr2:113131484 [GRCh38] Chr2:113889061 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.206-157A>G |
single nucleotide variant |
not provided [RCV001720672] |
Chr2:113130888 [GRCh38] Chr2:113888465 [GRCh37] Chr2:2q14.1 |
benign |
Single allele |
single nucleotide variant |
not provided [RCV001720659] |
Chr2:113117851 [GRCh38] Chr2:113875428 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.205+53G>C |
single nucleotide variant |
not provided [RCV001720665] |
Chr2:113129717 [GRCh38] Chr2:113887294 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.206-152C>G |
single nucleotide variant |
not provided [RCV001720667] |
Chr2:113130893 [GRCh38] Chr2:113888470 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.205+97A>C |
single nucleotide variant |
not provided [RCV001720673] |
Chr2:113129761 [GRCh38] Chr2:113887338 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.205+94T>G |
single nucleotide variant |
not provided [RCV001654596] |
Chr2:113129758 [GRCh38] Chr2:113887335 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.*350C>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001129689] |
Chr2:113133221 [GRCh38] Chr2:113890798 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.319-230C>T |
single nucleotide variant |
not provided [RCV001709815] |
Chr2:113132426 [GRCh38] Chr2:113890003 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.318+59A>T |
single nucleotide variant |
not provided [RCV001671322] |
Chr2:113131216 [GRCh38] Chr2:113888793 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.*537G>A |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001129690] |
Chr2:113133408 [GRCh38] Chr2:113890985 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.205+217G>T |
single nucleotide variant |
not provided [RCV001666799] |
Chr2:113129881 [GRCh38] Chr2:113887458 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.496G>A (p.Val166Ile) |
single nucleotide variant |
Microvascular complications of diabetes, susceptibility to, 4 [RCV003224528]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001214883] |
Chr2:113132833 [GRCh38] Chr2:113890410 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.169G>T (p.Ala57Ser) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001220016] |
Chr2:113129628 [GRCh38] Chr2:113887205 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.68C>T (p.Thr23Met) |
single nucleotide variant |
Microvascular complications of diabetes, susceptibility to, 4 [RCV003224503]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001027789] |
Chr2:113127692 [GRCh38] Chr2:113885269 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*1070T>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001132402] |
Chr2:113133941 [GRCh38] Chr2:113891518 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.*605T>C |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001129691] |
Chr2:113133476 [GRCh38] Chr2:113891053 [GRCh37] Chr2:2q14.1 |
uncertain significance |
GRCh37/hg19 2q13(chr2:113853399-114095549)x1 |
copy number loss |
not provided [RCV001259646] |
Chr2:113853399..114095549 [GRCh37] Chr2:2q13 |
pathogenic |
NM_173842.3(IL1RN):c.*303C>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001134696] |
Chr2:113133174 [GRCh38] Chr2:113890751 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.449T>C (p.Met150Thr) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001298499] |
Chr2:113132786 [GRCh38] Chr2:113890363 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.318+3A>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001301399] |
Chr2:113131160 [GRCh38] Chr2:113888737 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.212T>C (p.Ile71Thr) |
single nucleotide variant |
Microvascular complications of diabetes, susceptibility to, 4 [RCV002486231]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001314665] |
Chr2:113131051 [GRCh38] Chr2:113888628 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NC_000002.11:g.(?_113877623)_(113877725_?)del |
deletion |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001348882] |
Chr2:113877623..113877725 [GRCh37] Chr2:2q13 |
uncertain significance |
NM_173842.3(IL1RN):c.267G>C (p.Lys89Asn) |
single nucleotide variant |
Inborn genetic diseases [RCV003166714]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001303678] |
Chr2:113131106 [GRCh38] Chr2:113888683 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.197A>G (p.Asn66Ser) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001294372] |
Chr2:113129656 [GRCh38] Chr2:113887233 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.528C>T (p.Asp176=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001397160] |
Chr2:113132865 [GRCh38] Chr2:113890442 [GRCh37] Chr2:2q14.1 |
likely benign |
NM_173842.3(IL1RN):c.379C>T (p.Arg127Cys) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001360906] |
Chr2:113132716 [GRCh38] Chr2:113890293 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.500T>A (p.Met167Lys) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001361455] |
Chr2:113132837 [GRCh38] Chr2:113890414 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.249G>A (p.Leu83=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001363277] |
Chr2:113131088 [GRCh38] Chr2:113888665 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.386_389del (p.Asp129fs) |
deletion |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001363468] |
Chr2:113132720..113132723 [GRCh38] Chr2:113890297..113890300 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.490G>A (p.Glu164Lys) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001363615] |
Chr2:113132827 [GRCh38] Chr2:113890404 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.298G>A (p.Glu100Lys) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001324731] |
Chr2:113131137 [GRCh38] Chr2:113888714 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.388A>G (p.Ser130Gly) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001340372] |
Chr2:113132725 [GRCh38] Chr2:113890302 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.206-4C>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001413267] |
Chr2:113131041 [GRCh38] Chr2:113888618 [GRCh37] Chr2:2q14.1 |
likely benign |
NM_173842.3(IL1RN):c.219G>A (p.Val73=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001502332] |
Chr2:113131058 [GRCh38] Chr2:113888635 [GRCh37] Chr2:2q14.1 |
likely benign |
NM_173842.3(IL1RN):c.141C>G (p.Thr47=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001500332] |
Chr2:113129600 [GRCh38] Chr2:113887177 [GRCh37] Chr2:2q14.1 |
likely benign |
NM_173841.3(IL1RN):c.73+19C>T |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001511046] |
Chr2:113120147 [GRCh38] Chr2:113877724 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.336C>T (p.Asp112=) |
single nucleotide variant |
Autoinflammatory syndrome [RCV002264327]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001452031] |
Chr2:113132673 [GRCh38] Chr2:113890250 [GRCh37] Chr2:2q14.1 |
likely benign|uncertain significance |
NM_173842.3(IL1RN):c.206-65G>A |
single nucleotide variant |
not provided [RCV001534749] |
Chr2:113130980 [GRCh38] Chr2:113888557 [GRCh37] Chr2:2q14.1 |
benign |
NM_173841.3(IL1RN):c.10+148C>G |
single nucleotide variant |
not provided [RCV001671096] |
Chr2:113118176 [GRCh38] Chr2:113875753 [GRCh37] Chr2:2q14.1 |
benign |
NM_173841.3(IL1RN):c.10+168A>G |
single nucleotide variant |
not provided [RCV001619180] |
Chr2:113118196 [GRCh38] Chr2:113875773 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.205+32G>A |
single nucleotide variant |
not provided [RCV001613596] |
Chr2:113129696 [GRCh38] Chr2:113887273 [GRCh37] Chr2:2q14.1 |
benign |
Single allele |
single nucleotide variant |
not provided [RCV001650019] |
Chr2:113117640 [GRCh38] Chr2:113875217 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.205+135G>A |
single nucleotide variant |
not provided [RCV001690382] |
Chr2:113129799 [GRCh38] Chr2:113887376 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.318+19T>G |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001510570] |
Chr2:113131176 [GRCh38] Chr2:113888753 [GRCh37] Chr2:2q14.1 |
benign |
NM_173842.3(IL1RN):c.186A>G (p.Gly62=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001482386] |
Chr2:113129645 [GRCh38] Chr2:113887222 [GRCh37] Chr2:2q14.1 |
likely benign |
NM_173842.3(IL1RN):c.384A>T (p.Ser128=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001406684] |
Chr2:113132721 [GRCh38] Chr2:113890298 [GRCh37] Chr2:2q14.1 |
likely benign |
NM_173841.3(IL1RN):c.66C>T (p.Asp22=) |
single nucleotide variant |
Autoinflammatory syndrome [RCV002264317]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001432547] |
Chr2:113120121 [GRCh38] Chr2:113877698 [GRCh37] Chr2:2q14.1 |
likely benign|uncertain significance |
NM_173841.3(IL1RN):c.26A>T (p.Glu9Val) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001306761] |
Chr2:113120081 [GRCh38] Chr2:113877658 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.526G>A (p.Asp176Asn) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001301841] |
Chr2:113132863 [GRCh38] Chr2:113890440 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.331dup (p.Thr111fs) |
duplication |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001343321] |
Chr2:113132667..113132668 [GRCh38] Chr2:113890244..113890245 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.391G>T (p.Gly131Cys) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001370804] |
Chr2:113132728 [GRCh38] Chr2:113890305 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.108A>G (p.Gln36=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001447017] |
Chr2:113127732 [GRCh38] Chr2:113885309 [GRCh37] Chr2:2q14.1 |
likely benign |
GRCh37/hg19 2q13-14.1(chr2:113609489-115817535)x3 |
copy number gain |
not provided [RCV001833062] |
Chr2:113609489..115817535 [GRCh37] Chr2:2q13-14.1 |
uncertain significance |
GRCh37/hg19 2p25.3-q37.3(chr2:1-243199373) |
copy number gain |
Mosaic trisomy 2 [RCV002280628] |
Chr2:1..243199373 [GRCh37] Chr2:2p25.3-q37.3 |
pathogenic |
NM_173842.3(IL1RN):c.173G>T (p.Gly58Val) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001873903] |
Chr2:113129632 [GRCh38] Chr2:113887209 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.342C>T (p.Ser114=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001913922] |
Chr2:113132679 [GRCh38] Chr2:113890256 [GRCh37] Chr2:2q14.1 |
likely benign|uncertain significance |
NM_173842.3(IL1RN):c.380G>T (p.Arg127Leu) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001966854] |
Chr2:113132717 [GRCh38] Chr2:113890294 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.476C>T (p.Thr159Ile) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001912813] |
Chr2:113132813 [GRCh38] Chr2:113890390 [GRCh37] Chr2:2q14.1 |
uncertain significance |
GRCh37/hg19 2q13(chr2:113295194-114085649)x3 |
copy number gain |
not provided [RCV001834499] |
Chr2:113295194..114085649 [GRCh37] Chr2:2q13 |
uncertain significance |
GRCh37/hg19 2q13-22.3(chr2:111484468-146333604)x3 |
copy number gain |
not provided [RCV001832896] |
Chr2:111484468..146333604 [GRCh37] Chr2:2q13-22.3 |
pathogenic |
NM_173842.3(IL1RN):c.377T>C (p.Ile126Thr) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002034259] |
Chr2:113132714 [GRCh38] Chr2:113890291 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.366C>T (p.Arg122=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001937416] |
Chr2:113132703 [GRCh38] Chr2:113890280 [GRCh37] Chr2:2q14.1 |
likely benign |
NC_000002.11:g.(?_113817016)_(113890448_?)del |
deletion |
Generalized pustular psoriasis [RCV003120785]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001963059] |
Chr2:113817016..113890448 [GRCh37] Chr2:2q13 |
pathogenic |
NM_173842.3(IL1RN):c.259G>A (p.Gly87Arg) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001958565] |
Chr2:113131098 [GRCh38] Chr2:113888675 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173841.3(IL1RN):c.16T>G (p.Leu6Val) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001926021] |
Chr2:113120071 [GRCh38] Chr2:113877648 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.526G>T (p.Asp176Tyr) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002014700] |
Chr2:113132863 [GRCh38] Chr2:113890440 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173841.3(IL1RN):c.20A>G (p.Tyr7Cys) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001919553] |
Chr2:113120075 [GRCh38] Chr2:113877652 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.210G>T (p.Lys70Asn) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001877297] |
Chr2:113131049 [GRCh38] Chr2:113888626 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.99C>G (p.Ser33Arg) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002018397] |
Chr2:113127723 [GRCh38] Chr2:113885300 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.77G>A (p.Arg26Gln) |
single nucleotide variant |
Autoinflammatory syndrome [RCV002264444]|Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001991725] |
Chr2:113127701 [GRCh38] Chr2:113885278 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.343G>A (p.Glu115Lys) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002030838] |
Chr2:113132680 [GRCh38] Chr2:113890257 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173842.3(IL1RN):c.241C>G (p.Leu81Val) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV001953276] |
Chr2:113131080 [GRCh38] Chr2:113888657 [GRCh37] Chr2:2q14.1 |
uncertain significance |
NM_173841.3(IL1RN):c.11-16A>C |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002109789] |
Chr2:113120050 [GRCh38] Chr2:113877627 [GRCh37] Chr2:2q14.1 |
likely benign |
NM_173842.3(IL1RN):c.243G>A (p.Leu81=) |
single nucleotide variant |
Sterile multifocal osteomyelitis with periostitis and pustulosis [RCV002088659] |
Chr2:113131082 [GRCh38] Chr2:113888659 [GRCh37] Chr2:2q14.1 |
likely benign |
GRCh37/hg19 2q13-14.3(chr2:113188197-128144700) |
copy number loss |
not specified [RCV002053220] |
Chr2:113188197..128144700 [GRCh37] Chr2:2q13-14.3 |
pathogenic |
NC_000002.12:g.(?_112924872)_(113105404_?)del |
deletion |
Endometriosis [RCV001824107] |
Chr |