LINC02907 (long intergenic non-protein coding RNA 2907)

Gene: LINC02907 (long intergenic non-protein coding RNA 2907) Homo sapiens

Analyze

Symbol:

LINC02907

Name:

long intergenic non-protein coding RNA 2907

RGD ID:

1343208

HGNC Page

HGNC:28581

Description:

ASSOCIATED WITH Adams-Oliver Syndrome 5; developmental and epileptic encephalopathy 14; Ehlers-Danlos syndrome classic type 1; INTERACTS WITH aflatoxin B1; silicon dioxide; valproic acid

Type:

ncrna (Ensembl: lncRNA)

RefSeq Status:

VALIDATED

Previously known as:

C9orf62; chromosome 9 open reading frame 62; chromosome 9 putative open reading frame 62; MGC35463; putative uncharacterized protein C9orf62; RP11-555H7.1

RGD Orthologs

Bonobo

Alliance Genes

More Info

more info ...

Allele / Splice:

See ClinVar data

Latest Assembly:

GRCh38 - Human Genome Assembly GRCh38

Position:

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	9	135,343,249 - 135,346,562 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	9	135,343,249 - 135,346,562 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	9	138,235,095 - 138,238,408 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	9	137,375,066 - 137,376,074 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	9	108,748,379 - 108,751,686 (+)	NCBI		Celera
Cytogenetic Map	9	q34.3	NCBI
HuRef	9	107,692,991 - 107,696,304 (+)	NCBI		HuRef
CHM1_1	9	138,384,054 - 138,387,367 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	9	147,567,675 - 147,570,988 (+)	NCBI		T2T-CHM13v2.0

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Adams-Oliver Syndrome 5 (IAGP)

developmental and epileptic encephalopathy 14 (IAGP)

Ehlers-Danlos syndrome classic type 1 (IAGP)

Kleefstra syndrome 1 (IAGP)

Leigh disease (IAGP)

primary coenzyme Q10 deficiency 7 (IAGP)

Rafiq syndrome (IAGP)

tuberous sclerosis 1 (IAGP)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

aflatoxin B1 (EXP)

silicon dioxide (EXP)

valproic acid (EXP)

References

References - curated

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
2.	Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.	Strausberg RL, etal., Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16899-903. Epub 2002 Dec 11.

Additional References at PubMed

PMID:27229929	PMID:35256949

Genomics

Comparative Map Data

LINC02907
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	9	135,343,249 - 135,346,562 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	9	135,343,249 - 135,346,562 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	9	138,235,095 - 138,238,408 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	9	137,375,066 - 137,376,074 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	9	108,748,379 - 108,751,686 (+)	NCBI		Celera
Cytogenetic Map	9	q34.3	NCBI
HuRef	9	107,692,991 - 107,696,304 (+)	NCBI		HuRef
CHM1_1	9	138,384,054 - 138,387,367 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	9	147,567,675 - 147,570,988 (+)	NCBI		T2T-CHM13v2.0

LINC02907
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	11	3,977,409 - 3,978,415 (-)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	9	3,979,742 - 3,980,748 (-)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	9	106,481,811 - 106,482,817 (+)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	9	135,476,909 - 135,477,915 (+)	NCBI	panpan1.1	PanPan1.1	panPan2

Clinical Variants

Name	Type	Condition(s)	Position(s)	Clinical significance
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138179445)x3	copy number gain	See cases [RCV000050348]	Chr9:193412..138179445 [GRCh38] Chr9:204193..141073897 [GRCh37] Chr9:194193..140193718 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9q33.2-34.3(chr9:121112395-138075224)x3	copy number gain	See cases [RCV000051009]	Chr9:121112395..138075224 [GRCh38] Chr9:123874673..140969676 [GRCh37] Chr9:122914494..140089497 [NCBI36] Chr9:9q33.2-34.3	pathogenic
GRCh38/hg38 9q33.2-34.3(chr9:122792658-138124532)x3	copy number gain	See cases [RCV000051040]	Chr9:122792658..138124532 [GRCh38] Chr9:125554937..141018984 [GRCh37] Chr9:124594758..140138805 [NCBI36] Chr9:9q33.2-34.3	pathogenic
GRCh38/hg38 9q34.2-34.3(chr9:134428674-138154922)x1	copy number loss	See cases [RCV000052936]	Chr9:134428674..138154922 [GRCh38] Chr9:137320520..141049374 [GRCh37] Chr9:136460341..140169195 [NCBI36] Chr9:9q34.2-34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138124532)x3	copy number gain	See cases [RCV000053745]	Chr9:193412..138124532 [GRCh38] Chr9:204193..141018984 [GRCh37] Chr9:194193..140138805 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9q34.11-34.3(chr9:129068560-136495351)x3	copy number gain	See cases [RCV000053779]	Chr9:129068560..136495351 [GRCh38] Chr9:131830839..139389803 [GRCh37] Chr9:130870660..138509624 [NCBI36] Chr9:9q34.11-34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138114463)x3	copy number gain	See cases [RCV000053746]	Chr9:193412..138114463 [GRCh38] Chr9:214367..141008915 [GRCh37] Chr9:204367..140128736 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9q34.2-34.3(chr9:134174698-138138735)x3	copy number gain	See cases [RCV000053814]	Chr9:134174698..138138735 [GRCh38] Chr9:137091194..141033187 [GRCh37] Chr9:136029641..140153008 [NCBI36] Chr9:9q34.2-34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138179445)x3	copy number gain	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053748]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053748]\|See cases [RCV000053748]	Chr9:193412..138179445 [GRCh38] Chr9:266045..141073897 [GRCh37] Chr9:256045..140193718 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9q33.2-34.3(chr9:121586837-138179445)x3	copy number gain	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053776]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053776]\|See cases [RCV000053776]	Chr9:121586837..138179445 [GRCh38] Chr9:124349116..141073897 [GRCh37] Chr9:123388937..140193718 [NCBI36] Chr9:9q33.2-34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:204193-138179445)	copy number gain	See cases [RCV000133791]	Chr9:204193..138179445 [GRCh38] Chr9:204193..141073897 [GRCh37] Chr9:194193..140193718 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9q34.11-34.3(chr9:130513207-138124532)x3	copy number gain	See cases [RCV000133778]	Chr9:130513207..138124532 [GRCh38] Chr9:133388594..141018984 [GRCh37] Chr9:132378415..140138805 [NCBI36] Chr9:9q34.11-34.3	pathogenic
GRCh38/hg38 9q34.3(chr9:135265814-135391712)x3	copy number gain	See cases [RCV000134368]	Chr9:135265814..135391712 [GRCh38] Chr9:138157660..138283558 [GRCh37] Chr9:137297481..137423379 [NCBI36] Chr9:9q34.3	benign
GRCh38/hg38 9q34.3(chr9:135164984-136437047)x3	copy number gain	See cases [RCV000134910]	Chr9:135164984..136437047 [GRCh38] Chr9:138056830..139331499 [GRCh37] Chr9:137196651..138451320 [NCBI36] Chr9:9q34.3	uncertain significance
GRCh38/hg38 9q34.11-34.3(chr9:129068560-138179445)x3	copy number gain	See cases [RCV000134916]	Chr9:129068560..138179445 [GRCh38] Chr9:131830839..141073897 [GRCh37] Chr9:130870660..140193718 [NCBI36] Chr9:9q34.11-34.3	pathogenic
GRCh38/hg38 9q33.2-34.3(chr9:121073102-138179445)x3	copy number gain	See cases [RCV000134920]	Chr9:121073102..138179445 [GRCh38] Chr9:123835380..141073897 [GRCh37] Chr9:122875201..140193718 [NCBI36] Chr9:9q33.2-34.3	pathogenic
GRCh38/hg38 9q34.3(chr9:135290089-135405669)x3	copy number gain	See cases [RCV000136239]	Chr9:135290089..135405669 [GRCh38] Chr9:138181935..138297515 [GRCh37] Chr9:137321756..137437336 [NCBI36] Chr9:9q34.3	benign
GRCh38/hg38 9q34.2-34.3(chr9:134492275-135456038)x3	copy number gain	See cases [RCV000136609]	Chr9:134492275..135456038 [GRCh38] Chr9:137384121..138347884 [GRCh37] Chr9:136523942..137487705 [NCBI36] Chr9:9q34.2-34.3	uncertain significance
GRCh38/hg38 9q34.13-34.3(chr9:132986903-138114463)x3	copy number gain	See cases [RCV000136790]	Chr9:132986903..138114463 [GRCh38] Chr9:135862290..141008915 [GRCh37] Chr9:134852111..140128736 [NCBI36] Chr9:9q34.13-34.3	pathogenic
GRCh38/hg38 9q34.2-34.3(chr9:133504071-138159073)x3	copy number gain	See cases [RCV000137825]	Chr9:133504071..138159073 [GRCh38] Chr9:136324358..141053525 [GRCh37] Chr9:135314179..140173346 [NCBI36] Chr9:9q34.2-34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138124524)x3	copy number gain	See cases [RCV000138783]	Chr9:193412..138124524 [GRCh38] Chr9:204090..141018976 [GRCh37] Chr9:194090..140138797 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9p11.2-q34.3(chr9:193412-138159073)x3	copy number gain	See cases [RCV000139207]	Chr9:193412..138159073 [GRCh38] Chr9:68420641..141053525 [GRCh37] Chr9:67910461..140173346 [NCBI36] Chr9:9p11.2-q34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138159073)x3	copy number gain	See cases [RCV000138962]	Chr9:193412..138159073 [GRCh38] Chr9:204104..141053525 [GRCh37] Chr9:194104..140173346 [NCBI36] Chr9:9p24.3-q34.3	pathogenic\|conflicting data from submitters
GRCh38/hg38 9q34.2-34.3(chr9:133996227-138124524)x3	copy number gain	See cases [RCV000139807]	Chr9:133996227..138124524 [GRCh38] Chr9:136861349..141018976 [GRCh37] Chr9:135851170..140138797 [NCBI36] Chr9:9q34.2-34.3	pathogenic
GRCh38/hg38 9q34.3(chr9:135239066-135391712)x3	copy number gain	See cases [RCV000140597]	Chr9:135239066..135391712 [GRCh38] Chr9:138130912..138283558 [GRCh37] Chr9:137270733..137423379 [NCBI36] Chr9:9q34.3	benign
GRCh38/hg38 9p24.3-q34.3(chr9:203861-138125937)x3	copy number gain	See cases [RCV000141876]	Chr9:203861..138125937 [GRCh38] Chr9:203861..141020389 [GRCh37] Chr9:193861..140140210 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9q34.2-34.3(chr9:133918071-138159073)x3	copy number gain	See cases [RCV000142955]	Chr9:133918071..138159073 [GRCh38] Chr9:136783193..141053525 [GRCh37] Chr9:135773014..140173346 [NCBI36] Chr9:9q34.2-34.3	pathogenic
GRCh38/hg38 9q34.13-34.3(chr9:132386553-138059695)x3	copy number gain	See cases [RCV000142636]	Chr9:132386553..138059695 [GRCh38] Chr9:135261940..140954147 [GRCh37] Chr9:134251761..140073968 [NCBI36] Chr9:9q34.13-34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:203862-138125937)x3	copy number gain	See cases [RCV000143476]	Chr9:203862..138125937 [GRCh38] Chr9:203862..141020389 [GRCh37] Chr9:193862..140140210 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138179445)x3	copy number gain	See cases [RCV000148113]	Chr9:193412..138179445 [GRCh38] Chr9:204193..141073897 [GRCh37] Chr9:194193..140193718 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9q34.3(chr9:138149166-138237120)x3	copy number gain	Premature ovarian failure [RCV000225237]	Chr9:138149166..138237120 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9p24.3-q34.3(chr9:163131-141122114)x3	copy number gain	See cases [RCV000240081]	Chr9:163131..141122114 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:62525-141006407)	copy number gain	See cases [RCV000449375]	Chr9:62525..141006407 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:203861-141020389)x3	copy number gain	not specified [RCV003986800]	Chr9:203861..141020389 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9q33.3-34.3(chr9:128652785-141044751)x3	copy number gain	See cases [RCV000447080]	Chr9:128652785..141044751 [GRCh37] Chr9:9q33.3-34.3	pathogenic
GRCh37/hg19 9q34.3(chr9:138222049-141018925)x1	copy number loss	See cases [RCV000446074]	Chr9:138222049..141018925 [GRCh37] Chr9:9q34.3	pathogenic
GRCh37/hg19 9q34.3(chr9:138222049-138711104)x3	copy number gain	See cases [RCV000448897]	Chr9:138222049..138711104 [GRCh37] Chr9:9q34.3	uncertain significance
GRCh37/hg19 9q34.3(chr9:138147997-138238503)	copy number gain	Abnormal esophagus morphology [RCV000416629]	Chr9:138147997..138238503 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9p24.3-q34.3(chr9:203864-141020389)x3	copy number gain	See cases [RCV000448978]	Chr9:203864..141020389 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9q33.2-34.3(chr9:124642754-141146461)x3	copy number gain	See cases [RCV000448784]	Chr9:124642754..141146461 [GRCh37] Chr9:9q33.2-34.3	pathogenic
GRCh37/hg19 9q34.3(chr9:138209358-141020389)x1	copy number loss	See cases [RCV000510584]	Chr9:138209358..141020389 [GRCh37] Chr9:9q34.3	pathogenic
GRCh37/hg19 9q34.13-34.3(chr9:135377559-141213431)x1	copy number loss	mTOR Inhibitor response [RCV000626442]	Chr9:135377559..141213431 [GRCh37] Chr9:9q34.13-34.3	drug response
GRCh37/hg19 9q21.11-34.3(chr9:71069743-140999928)	copy number gain	Global developmental delay [RCV000626548]	Chr9:71069743..140999928 [GRCh37] Chr9:9q21.11-34.3	likely pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:203862-141020389)	copy number gain	See cases [RCV000512392]	Chr9:203862..141020389 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9q34.13-34.3(chr9:135105971-141020389)x3	copy number gain	not provided [RCV000683160]	Chr9:135105971..141020389 [GRCh37] Chr9:9q34.13-34.3	pathogenic
GRCh37/hg19 9q34.3(chr9:137736478-138563159)x3	copy number gain	not provided [RCV000683146]	Chr9:137736478..138563159 [GRCh37] Chr9:9q34.3	uncertain significance
GRCh37/hg19 9p24.3-q34.3(chr9:10590-141122247)x3	copy number gain	not provided [RCV000748055]	Chr9:10590..141122247 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9q34.3(chr9:138149166-138292538)x3	copy number gain	not provided [RCV000749699]	Chr9:138149166..138292538 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138149166-138298164)x3	copy number gain	not provided [RCV000749700]	Chr9:138149166..138298164 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138149166-138302726)x3	copy number gain	not provided [RCV000749701]	Chr9:138149166..138302726 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138149166-138310046)x3	copy number gain	not provided [RCV000749702]	Chr9:138149166..138310046 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138149166-138312393)x3	copy number gain	not provided [RCV000749703]	Chr9:138149166..138312393 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138149166-138320042)x3	copy number gain	not provided [RCV000749704]	Chr9:138149166..138320042 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138149317-138239887)x3	copy number gain	not provided [RCV000749705]	Chr9:138149317..138239887 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138149317-138306060)x3	copy number gain	not provided [RCV000749706]	Chr9:138149317..138306060 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138149317-138312393)x3	copy number gain	not provided [RCV000749707]	Chr9:138149317..138312393 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138149317-138318759)x3	copy number gain	not provided [RCV000749708]	Chr9:138149317..138318759 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138159376-138327242)x3	copy number gain	not provided [RCV000749709]	Chr9:138159376..138327242 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138219743-138315859)x3	copy number gain	not provided [RCV000749713]	Chr9:138219743..138315859 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:137816459-141114095)x1	copy number loss	not provided [RCV000748787]	Chr9:137816459..141114095 [GRCh37] Chr9:9q34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:10590-141107672)x3	copy number gain	not provided [RCV000748053]	Chr9:10590..141107672 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9q34.3(chr9:138149166-138275572)x3	copy number gain	not provided [RCV000748789]	Chr9:138149166..138275572 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138149166-138284278)x3	copy number gain	not provided [RCV000748790]	Chr9:138149166..138284278 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138149166-138288052)x3	copy number gain	not provided [RCV000748791]	Chr9:138149166..138288052 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9q34.3(chr9:138149166-138292054)x3	copy number gain	not provided [RCV000748792]	Chr9:138149166..138292054 [GRCh37] Chr9:9q34.3	benign
GRCh37/hg19 9p24.3-q34.3(chr9:46587-141066491)x3	copy number gain	not provided [RCV000748063]	Chr9:46587..141066491 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:10590-141114095)x2	copy number gain	not provided [RCV000748054]	Chr9:10590..141114095 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:203861-141020388)x3	copy number gain	not provided [RCV000845900]	Chr9:203861..141020388 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
NC_000009.11:g.(?_134379574)_(138678377_?)dup	duplication	Ehlers-Danlos syndrome, classic type [RCV000807925]	Chr9:134379574..138678377 [GRCh37] Chr9:9q34.13-34.3	uncertain significance
GRCh37/hg19 9q21.11-34.3(chr9:71416475-141020389)x3	copy number gain	not provided [RCV000847808]	Chr9:71416475..141020389 [GRCh37] Chr9:9q21.11-34.3	pathogenic
GRCh37/hg19 9q34.3(chr9:138023579-138498904)x3	copy number gain	not provided [RCV001006280]	Chr9:138023579..138498904 [GRCh37] Chr9:9q34.3	uncertain significance
GRCh37/hg19 9q34.3(chr9:137880493-138781516)x3	copy number gain	See cases [RCV001194592]	Chr9:137880493..138781516 [GRCh37] Chr9:9q34.3	uncertain significance
GRCh37/hg19 9q34.3(chr9:138225001-141015001)	copy number loss	Microcephaly [RCV001252947]	Chr9:138225001..141015001 [GRCh37] Chr9:9q34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:353349-141020389)	copy number gain	not specified [RCV002053823]	Chr9:353349..141020389 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
NC_000009.11:g.(?_137534034)_(139440238_?)dup	duplication	Adams-Oliver syndrome 5 [RCV003120731]\|Ehlers-Danlos syndrome, classic type, 1 [RCV001872736]	Chr9:137534034..139440238 [GRCh37] Chr9:9q34.3	uncertain significance
NC_000009.11:g.(?_135139626)_(140034216_?)dup	duplication	Developmental and epileptic encephalopathy, 14 [RCV003111109]\|Leigh syndrome [RCV003122287]\|Rafiq syndrome [RCV003122286]\|Tuberous sclerosis 1 [RCV003111108]	Chr9:135139626..140034216 [GRCh37] Chr9:9q34.13-34.3	uncertain significance
NC_000009.11:g.(?_131087402)_(141016451_?)dup	duplication	Neonatal encephalomyopathy-cardiomyopathy-respiratory distress syndrome [RCV003119700]	Chr9:131087402..141016451 [GRCh37] Chr9:9q34.11-34.3	uncertain significance
NC_000009.11:g.(?_136218768)_(141016451_?)dup	duplication	Kleefstra syndrome 1 [RCV003122719]	Chr9:136218768..141016451 [GRCh37] Chr9:9q34.2-34.3	uncertain significance
GRCh38/hg38 9q34.3(chr9:134962336-137240181)x1	copy number loss	See cases [RCV002640756]	Chr9:134962336..137240181 [GRCh38] Chr9:9q34.3	pathogenic
GRCh37/hg19 9q34.2-34.3(chr9:136988996-141020389)x3	copy number gain	not provided [RCV003484786]	Chr9:136988996..141020389 [GRCh37] Chr9:9q34.2-34.3	pathogenic
GRCh37/hg19 9q34.3(chr9:137892345-138866686)x3	copy number gain	not specified [RCV003986834]	Chr9:137892345..138866686 [GRCh37] Chr9:9q34.3	uncertain significance

miRNA Target Status

Predicted Target Of

	Summary Value
Count of predictions:	883
Count of miRNA genes:	478
Interacting mature miRNAs:	512
Transcripts:	ENST00000320778
Prediction methods:	Microtar, Miranda, Rnahybrid
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Markers in Region

G54620

Human Assembly	Chr	Position (strand)	Source	JBrowse
GRCh37	9	138,233,427 - 138,233,677	UniSTS	GRCh37
Celera	9	108,746,705 - 108,746,955	UniSTS
Cytogenetic Map	9	q34.3	UniSTS
HuRef	9	107,691,323 - 107,691,573	UniSTS

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

alimentary part of gastrointestinal system

circulatory system

endocrine system

exocrine system

hemolymphoid system

hepatobiliary system

integumental system

musculoskeletal system

nervous system

renal system

reproductive system

respiratory system

sensory system

adipose tissue

appendage

High

Medium

Low

Below cutoff

117

166

348

274

122

966

257

459

179

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_171012	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL353615	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC034752	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CP068269	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

ENST00000623103

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	9	135,343,249 - 135,346,562 (+)	Ensembl

RefSeq Acc Id:

NR_171012

RefSeq Status:

VALIDATED

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38	9	135,343,249 - 135,346,562 (+)	NCBI
T2T-CHM13v2.0	9	147,567,675 - 147,570,988 (+)	NCBI

Sequence:

show sequence

CTCCAGCCAGGGCTGAGTGGCAGTGTGGGCACCGCGGCCCGGGACGACAGCCTGGGCTCAGAGT
CAGGCTTGTGGCTTCGCCTCTCAGCTTGCGTCTCCTCCCCTGTGGGATGGGGGATTCCGTGGCA
CCCCCATGATGAACAGGATGCCATGGGCCTCAGCCCAGGGCAGACCTCAGTGTCCTTCCTGTGG
CCGCTGCTGGAGGTGCGTGACCACAACACAGGGAGGGGACTCGTCCCCGCCACTGTGCTGACGC
CTGGGTCTCCAGAGACCCTCCTGGAACTCCGCCAGGCCTTCCTGGGTTCCAGACAGGCCCGCCA
CGGGCATGACGCAGCGCCATCTAGCGGACAGCAGGGCTGCAGCGTGGACAGAACGGCCGGACGC
CCAGTCCTGGGCTGGCGGCTGAGGAACAGCCTCACAGGGCAAGAGGGCAGGCAACACCTGCATC
TTTCCGGCATAAGAACCTCAAGAAAAGCAAAGGAATATAAGCCTGTGTTCTTTGGAGCCACCGA
AATCTCTGTTCTCATGGCAGTCGCTGAAAGTTTAAGGGAGCCGCCACCGCCCCAATGGGGTTGG
TTTCTTTCTTCCCTGTTTTTAAAGATCTTTTAAAATGTCTAGAGAGACCCTGGGATCCAGTGCT
GGACGGATGATGCAGGGCCACACAGAGAGGCTATTGTGTGTCACTTGCTGGGTTAGGAACAGAC
GGATCAGGGCTTCTATGCTGCGTCTGCCTGGTCCTGGGAGAGAGAAACTCACACAACCATCTGC
CTGGAAGACCTGGGCTTCTCAGGCTAGAGGGTCTGCACATGTAGGTGTGTGTGCATGCATACAT
ATGCCTGCGTGTGGATGTCTGTGCTTCACACAAACAAGTGTACTTGTGGGCATATGTGTGTGTG
TGCCTGCATGTGCAGCTCTGGGTATGTGTGTGTGCGCATGCCCCTGAGTCTCTCTGCATGTGAT
GCATTTGTGCATGTGTGTGCCTGTGTGCCCGGGTCTGTGTCTATATATATGCATGCATGGATAT
GCATACGTATGTGCATTTCTGCACATGTGTGCGTATGCCTGTATGTGCCTGGCTATGTGCACAC
ACATGTGAATGTCTGAGCAGCTCCAGAGGGAGGGCCACCACCCTGCATGGTGGACATTAGTTTG
AGCCTGTGAGGACCAGTGTCCCCCAAAGCCCCTCAACTACAGCCCAGCCCAACCCAACCCGGAG
CAGATCACAGGCCCCAGAGACATCTCCAACCCTCACACATGGTTCCCAAACCCGGGCTATCCTT
CACTCTGCAGGGGCGGGCCAGCCCTGCCCACTGCCAGGGACCCGCTCCAAGGCGCCTGCAGGAG
GGCTGTGGGCGACAGTGTGGGCGCCCACCAGCAGGAGGGCCTGTCATGGTCTGTGCACGAAGCT
GGTGCGCTGTCTTCTCCAGGAACTCGCACCTTCGCTCCCCCTCCCCTGCCAGCCAACACTTTCA
GGTTTCTGCCATAAAAGAGAAAAAAATCTCCCTCCCTCTCTACCCGCTCCGCGCCTGCTCCTTC
TCCACTTTTTGCAGATCAAACAGCATGCATGGAGTCGAGCCTGCTGGCTCTGTTCCGAGCTGCA
CTTTGGGCATCCGTGGGCTGCCTTGCTCCTTGTGGGGTGGCTTCAAGAGCAGGTCCCAGGTGTG
CCTGCAGCAGTGCCGACACCCCTGAGAACACAGCGCACCCCAGCTTTCGGCGCCAACCACACAG
CCAGCAACTGGGCTTGGAAGCTTCCCTGAGGTCGACGCTGCCTGGAAATGGACTTTGCTGCCTG
CATTCAGGCCAGGGGCCATGTTTGCTCCCCCATTACAAGTTGGCCTCATATTAACATGTCTGAG
GACTAAGGCTGGTATTCTAGAACACGCCTTTCACTGATTGTGTTAAATAAAAGAGAAAGATGAA
AAAA

hide sequence

Protein Sequences


GenBank Protein	AAH34752	(Get FASTA)	NCBI Sequence Viewer

Additional Information

External Database Links

Database	Acc Id	Source(s)
COSMIC	LINC02907	COSMIC
Ensembl Genes	ENSG00000178243	Ensembl, ENTREZGENE
Ensembl Transcript	ENST00000623103	ENTREZGENE
GTEx	ENSG00000178243	GTEx
HGNC ID	HGNC:28581	ENTREZGENE
Human Proteome Map	LINC02907	Human Proteome Map
NCBI Gene	157927	ENTREZGENE
RNAcentral	URS00007BEBA9	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2021-02-22	LINC02907	long intergenic non-protein coding RNA 2907	C9orf62	chromosome 9 putative open reading frame 62	Symbol and/or name change	19259463	PROVISIONAL
2020-08-10	C9orf62	chromosome 9 putative open reading frame 62	C9orf62	chromosome 9 open reading frame 62	Symbol and/or name change	19259463	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - ClinVar