CHST6 (carbohydrate sulfotransferase 6) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: CHST6 (carbohydrate sulfotransferase 6) Homo sapiens
Analyze
Symbol: CHST6
Name: carbohydrate sulfotransferase 6
RGD ID: 1342606
HGNC Page HGNC:6938
Description: Enables N-acetylglucosamine 6-O-sulfotransferase activity and keratan sulfotransferase activity. Involved in N-acetylglucosamine metabolic process and keratan sulfate biosynthetic process. Predicted to be located in Golgi membrane. Predicted to be active in trans-Golgi network. Implicated in macular corneal dystrophy.
Type: protein-coding
RefSeq Status: REVIEWED
Previously known as: C-GlcNAc6ST; carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6; corneal N-acetylglucosamine 6-sulfotransferase; corneal N-acetylglucosamine-6-O-sulfotransferase; galactose/N-acetylglucosamine/N-acetylglucosamine 6-O-sulfotransferase 4-beta; glcNAc6ST-5; gn6st-5; GST4-beta; hCGn6ST; MCDC1; N-acetylglucosamine 6-O-sulfotransferase 5; N-acetylglucosamine 6-sulfotransferase
RGD Orthologs
Mouse
Rat
Bonobo
Dog
Pig
Green Monkey
Naked Mole-Rat
Alliance Genes
More Info more info ...
Allele / Splice: See ClinVar data
Latest Assembly: GRCh38 - Human Genome Assembly GRCh38
Position:
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh381675,472,042 - 75,495,441 (-)NCBIGRCh38GRCh38hg38GRCh38
GRCh38.p13 Ensembl1675,472,052 - 75,495,445 (-)EnsemblGRCh38hg38GRCh38
GRCh371675,505,940 - 75,529,339 (-)NCBIGRCh37GRCh37hg19GRCh37
Build 361674,064,523 - 74,086,427 (-)NCBINCBI36hg18NCBI36
Build 341674,064,525 - 74,086,427NCBI
Celera1659,801,332 - 59,823,234 (-)NCBI
Cytogenetic Map16q23.1NCBI
HuRef1661,258,395 - 61,267,163 (-)NCBIHuRef
CHM1_11676,919,368 - 76,941,254 (-)NCBICHM1_1
T2T-CHM13v2.01681,520,232 - 81,543,637 (-)NCBI
JBrowse: View Region in Genome Browser (JBrowse)
Model


Disease Annotations     Click to see Annotation Detail View

Gene Ontology Annotations     Click to see Annotation Detail View

Biological Process

Cellular Component

Molecular Function

Molecular Pathway Annotations     Click to see Annotation Detail View
References

References - curated
# Reference Title Reference Citation
1. GOAs Human GO annotations GOA_HUMAN data from the GO Consortium
2. OMIM Disease Annotation Pipeline OMIM Disease Annotation Pipeline
3. KEGG Annotation Import Pipeline Pipeline to import KEGG annotations from KEGG into RGD
4. ClinVar Automated Import and Annotation Pipeline RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
5. Data Import for Chemical-Gene Interactions RGD automated import pipeline for gene-chemical interactions
6. RGD HPO Phenotype Annotation Pipeline RGD automated import pipeline for human HPO-to-gene-to-disease annotations
Additional References at PubMed
PMID:1433500   PMID:8419650   PMID:8644739   PMID:10913333   PMID:11017086   PMID:11087716   PMID:11139648   PMID:11181564   PMID:11278593   PMID:11352640   PMID:11818380   PMID:12218059  
PMID:12477932   PMID:12824236   PMID:12882769   PMID:12882775   PMID:12883341   PMID:14609920   PMID:14735064   PMID:14984470   PMID:15013869   PMID:15220337   PMID:15489334   PMID:15652851  
PMID:15953452   PMID:16207214   PMID:16568029   PMID:17093400   PMID:17690104   PMID:17846354   PMID:17896316   PMID:17962390   PMID:18500531   PMID:18849568   PMID:19204788   PMID:19223992  
PMID:19365571   PMID:19844255   PMID:20539220   PMID:21242781   PMID:21873635   PMID:21887843   PMID:22261655   PMID:24311932   PMID:24801599   PMID:24926691   PMID:25081284   PMID:25086665  
PMID:26604660   PMID:27439461   PMID:27829782   PMID:28514442   PMID:30716718   PMID:32472422   PMID:33961781   PMID:34645431   PMID:34826417   PMID:35627129  


Genomics

Comparative Map Data
CHST6
(Homo sapiens - human)
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh381675,472,042 - 75,495,441 (-)NCBIGRCh38GRCh38hg38GRCh38
GRCh38.p13 Ensembl1675,472,052 - 75,495,445 (-)EnsemblGRCh38hg38GRCh38
GRCh371675,505,940 - 75,529,339 (-)NCBIGRCh37GRCh37hg19GRCh37
Build 361674,064,523 - 74,086,427 (-)NCBINCBI36hg18NCBI36
Build 341674,064,525 - 74,086,427NCBI
Celera1659,801,332 - 59,823,234 (-)NCBI
Cytogenetic Map16q23.1NCBI
HuRef1661,258,395 - 61,267,163 (-)NCBIHuRef
CHM1_11676,919,368 - 76,941,254 (-)NCBICHM1_1
T2T-CHM13v2.01681,520,232 - 81,543,637 (-)NCBI
Chst5
(Mus musculus - house mouse)
Mouse AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCm398112,615,767 - 112,636,831 (-)NCBIGRCm39mm39
GRCm39 Ensembl8112,615,768 - 112,637,079 (-)Ensembl
GRCm388111,889,135 - 111,910,199 (-)NCBIGRCm38GRCm38mm10GRCm38
GRCm38.p6 Ensembl8111,889,136 - 111,910,447 (-)EnsemblGRCm38mm10GRCm38
MGSCv378114,413,035 - 114,434,099 (-)NCBIGRCm37mm9NCBIm37
MGSCv368114,775,809 - 114,815,449 (-)NCBImm8
Celera8116,117,689 - 116,138,892 (-)NCBICelera
Cytogenetic Map8E1NCBI
Chst5
(Rattus norvegicus - Norway rat)
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
mRatBN7.21939,860,729 - 39,881,019 (-)NCBImRatBN7.2
mRatBN7.2 Ensembl1939,860,501 - 39,881,064 (-)Ensembl
Rnor_6.01944,115,065 - 44,136,092 (-)NCBIRnor6.0Rnor_6.0rn6Rnor6.0
Rnor_6.0 Ensembl1944,115,120 - 44,135,387 (-)EnsemblRnor6.0rn6Rnor6.0
Rnor_5.01954,922,189 - 54,942,505 (-)NCBIRnor5.0Rnor_5.0rn5Rnor5.0
RGSC_v3.41941,830,419 - 41,850,686 (-)NCBIRGSC3.4rn4RGSC3.4
Celera1939,220,192 - 39,241,612 (-)NCBICelera
Cytogenetic Map19q12NCBI
CHST6
(Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
PanPan1.11675,389,610 - 75,410,263 (-)NCBIpanpan1.1PanPan1.1panPan2
PanPan1.1 Ensembl1675,394,187 - 75,395,374 (-)Ensemblpanpan1.1panPan2
Mhudiblu_PPA_v01656,041,518 - 56,062,463 (-)NCBIMhudiblu_PPA_v0panPan3
LOC489707
(Canis lupus familiaris - dog)
Dog AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
CanFam3.1575,266,932 - 75,280,790 (+)NCBICanFam3.1CanFam3.1canFam3CanFam3.1
Dog10K_Boxer_Tasha575,243,924 - 75,257,918 (+)NCBI
ROS_Cfam_1.0575,580,429 - 75,594,782 (+)NCBI
UMICH_Zoey_3.1575,516,316 - 75,530,593 (+)NCBI
UNSW_CanFamBas_1.0575,351,643 - 75,365,789 (+)NCBI
UU_Cfam_GSD_1.0575,842,944 - 75,856,924 (+)NCBI
LOC100522551
(Sus scrofa - pig)
Pig AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Sscrofa11.1612,166,178 - 12,188,165 (+)NCBISscrofa11.1Sscrofa11.1susScr11Sscrofa11.1
Sscrofa10.2612,006,544 - 12,029,057 (+)NCBISscrofa10.2Sscrofa10.2susScr3
CHST6
(Chlorocebus sabaeus - green monkey)
Green Monkey AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChlSab1.1560,962,903 - 60,979,834 (-)NCBIChlSab1.1chlSab2
Vero_WHO_p1.0NW_02366604715,080,448 - 15,098,439 (+)NCBIVero_WHO_p1.0
Chst6
(Heterocephalus glaber - naked mole-rat)
Naked Mole-rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HetGla 1.0NW_00462474611,429,970 - 11,444,277 (+)NCBIHetGla_female_1.0hetGla2

Position Markers
SHGC-144645  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371675,520,144 - 75,520,484UniSTSGRCh37
Build 361674,077,645 - 74,077,985RGDNCBI36
Celera1659,814,452 - 59,814,792RGD
Cytogenetic Map16q22UniSTS
HuRef1661,271,517 - 61,271,857UniSTS
TNG Radiation Hybrid Map1634006.0UniSTS
CHST6_8463  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371675,506,884 - 75,507,706UniSTSGRCh37
Build 361674,064,385 - 74,065,207RGDNCBI36
Celera1659,801,194 - 59,802,016RGD
HuRef1661,258,257 - 61,259,079UniSTS
D5S2354  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map1q21UniSTS
Cytogenetic Map9q33.3UniSTS
Cytogenetic Map21q22.3UniSTS
Cytogenetic Map19p13.3UniSTS
Cytogenetic Map19q13.3UniSTS
Cytogenetic Map7q21.13UniSTS
Cytogenetic Map19p13.11UniSTS
Cytogenetic Map17q25.2UniSTS
Cytogenetic Map5q12.1UniSTS
Cytogenetic Map1p36.22UniSTS
Cytogenetic Map7q22.1UniSTS
Cytogenetic Map1p35.1UniSTS
Cytogenetic Map12p13.2UniSTS
Cytogenetic Map12q13.3UniSTS
Cytogenetic Map19q13.1UniSTS
Cytogenetic Map7p11.2UniSTS
Cytogenetic Map18p11.21UniSTS
Cytogenetic Map3p24.2UniSTS
Cytogenetic Map18p11.32UniSTS
Cytogenetic Map9p12UniSTS
Cytogenetic Map13q12.11UniSTS
Cytogenetic Map8p21.2UniSTS
Cytogenetic Map14q24.3UniSTS
Cytogenetic Map17q12UniSTS
Cytogenetic Map16q22UniSTS
Cytogenetic Map7q11.23UniSTS
Cytogenetic Map3p21.31UniSTS
Cytogenetic Map2p15UniSTS
Cytogenetic Map19p13.2UniSTS
Cytogenetic Map19p13.13UniSTS
Cytogenetic Map16p11.2UniSTS
Cytogenetic Map19q13.33-q13.41UniSTS
Cytogenetic Map6p23UniSTS
Cytogenetic Map12q14.1UniSTS
Cytogenetic Map1p36.3UniSTS
Cytogenetic Map19q13.41UniSTS
Cytogenetic Map1q21.3UniSTS
Cytogenetic Map6pter-p12.1UniSTS
Cytogenetic Map5q35.3UniSTS
Cytogenetic Map12q24.11UniSTS
D10S16   No map positions available.
GDB:313261  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map21q22.3UniSTS
Cytogenetic Map9p13.3UniSTS
Cytogenetic Map7q21.2UniSTS
Cytogenetic Map3q23UniSTS
Cytogenetic Map1p35.3-p33UniSTS
Cytogenetic Map8p11.22UniSTS
Cytogenetic Map20p13UniSTS
Cytogenetic MapXp22.33UniSTS
Cytogenetic MapYp11.32UniSTS
Cytogenetic Map12q12UniSTS
Cytogenetic Map11q22-q23UniSTS
Cytogenetic Map1q32UniSTS
Cytogenetic Map16q22UniSTS
Cytogenetic Map1p13.3UniSTS
Cytogenetic Map12q24.31UniSTS
Cytogenetic Map3q21.1UniSTS
Cytogenetic Map19p13.3UniSTS
Cytogenetic Map5q31UniSTS
Cytogenetic Map4q12UniSTS
GDB:631802  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map10q25.3UniSTS
Cytogenetic Map15q13UniSTS
Cytogenetic Map11p15.4UniSTS
Cytogenetic Map1p36.32UniSTS
Cytogenetic Map14q13.2UniSTS
Cytogenetic Map19q13.41UniSTS
Cytogenetic Map1q32UniSTS
Cytogenetic Map17q11UniSTS
Cytogenetic MapXp11.23UniSTS
Cytogenetic Map12q13.13UniSTS
Cytogenetic Map14q23.3UniSTS
Cytogenetic Map3q27UniSTS
Cytogenetic Map19q13.12UniSTS
Cytogenetic Map19q13.2UniSTS
Cytogenetic Map9p13.3-p12UniSTS
Cytogenetic Map16q11.2UniSTS
Cytogenetic Map3q12.3UniSTS
Cytogenetic Map14q22UniSTS
Cytogenetic Map5q21-q22UniSTS
Cytogenetic Map5q23.3UniSTS
Cytogenetic Map2q33-q34UniSTS
Cytogenetic Map4q31.3UniSTS
Cytogenetic Map1p31.3UniSTS
Cytogenetic Map14q11.2UniSTS
Cytogenetic Map19q13.43UniSTS
Cytogenetic MapXp11.3UniSTS
Cytogenetic Map4q12UniSTS
Cytogenetic Map8p11.21UniSTS
Cytogenetic Map3p21.31UniSTS
Cytogenetic Map19p13.2UniSTS
Cytogenetic Map5q14.1UniSTS
Cytogenetic Map17q22.2UniSTS
Cytogenetic Map22q13.1UniSTS
Cytogenetic Map19p13UniSTS
Cytogenetic Map22q13.31-q13.33UniSTS
Cytogenetic Map14q24.3UniSTS
Cytogenetic Map11q13UniSTS
Cytogenetic Map10p11UniSTS
Cytogenetic Map7q22.1UniSTS
Cytogenetic Map19q13.32UniSTS
Cytogenetic Map1q44UniSTS
Cytogenetic Map15q22.31UniSTS
Cytogenetic Map2q31.1UniSTS
Cytogenetic Map5q31.1UniSTS
Cytogenetic Map1p36.31UniSTS
Cytogenetic MapXq24UniSTS
Cytogenetic Map19q13.4UniSTS
Cytogenetic Map16p13.3UniSTS
Cytogenetic Map19p12UniSTS
Cytogenetic Map3p25.3UniSTS
Cytogenetic Map1q21.2UniSTS
Cytogenetic Map12q22UniSTS
Cytogenetic Map19q13.3UniSTS
Cytogenetic Map1q21-q23UniSTS
Cytogenetic Map16p11.2UniSTS
Cytogenetic Map1p35.3UniSTS
Cytogenetic Map1p35.1UniSTS
Cytogenetic Map1p34.3UniSTS
Cytogenetic Map1p36.22UniSTS
Cytogenetic Map1p35.3-p33UniSTS
Cytogenetic Map1q21UniSTS
Cytogenetic Map17q24.1UniSTS
Cytogenetic Map7q36.3UniSTS
Cytogenetic Map17q11.2UniSTS
Cytogenetic Map22q13.2UniSTS
Cytogenetic Map22q11.23UniSTS
Cytogenetic Map18q11.2UniSTS
Cytogenetic Map1p31UniSTS
Cytogenetic Map19q13.1UniSTS
Cytogenetic Map8p22UniSTS
Cytogenetic Map1p13.3UniSTS
Cytogenetic Map20p13UniSTS
Cytogenetic Map10q24.32UniSTS
Cytogenetic Map2q33.2UniSTS
Cytogenetic Map6q23.3UniSTS
Cytogenetic Map21q22.3UniSTS
Cytogenetic Map2q14.3UniSTS
Cytogenetic Map1p22.2UniSTS
Cytogenetic Map17q22UniSTS
Cytogenetic Map2q35UniSTS
Cytogenetic Map22q11.21UniSTS
Cytogenetic Map17qterUniSTS
Cytogenetic Map16q22.2UniSTS
Cytogenetic MapXp22.33UniSTS
Cytogenetic MapYp11.32UniSTS
Cytogenetic Map18q12.1UniSTS
Cytogenetic Map10p15.1UniSTS
Cytogenetic Map19p13.11UniSTS
Cytogenetic Map15q23UniSTS
Cytogenetic MapXp11.22UniSTS
Cytogenetic Map6p21.1UniSTS
Cytogenetic Map2p16.1UniSTS
Cytogenetic Map1p32UniSTS
Cytogenetic Map11q13.4UniSTS
Cytogenetic Map8q13UniSTS
Cytogenetic Map5q31.2-q34UniSTS
Cytogenetic Map2q11.2UniSTS
Cytogenetic Map1p36.13UniSTS
Cytogenetic Map3q21-q22UniSTS
Cytogenetic Map11q22-q23UniSTS
Cytogenetic Map3q21UniSTS
Cytogenetic Map7p11.2UniSTS
Cytogenetic Map1p32.3UniSTS
Cytogenetic Map14q21UniSTS
Cytogenetic Map16q22UniSTS
Cytogenetic Map22q13.33UniSTS
Cytogenetic Map1q25.3UniSTS
Cytogenetic Map19q13UniSTS
Cytogenetic Map7q11.23UniSTS
Cytogenetic Map19q13.42UniSTS
Cytogenetic Map2p11.2UniSTS
Cytogenetic Map1q32.1UniSTS
Cytogenetic Map12q24.31UniSTS
Cytogenetic Map11p15.5UniSTS
Cytogenetic Map6q25.1UniSTS
Cytogenetic Map1p36-p35UniSTS
Cytogenetic Map17q11-q21UniSTS
Cytogenetic Map21q22.1UniSTS
Cytogenetic MapXq13.1UniSTS
Cytogenetic Map6p21.31UniSTS
Cytogenetic Map4q13.3UniSTS
Cytogenetic Map19p13.3UniSTS
Cytogenetic Map18p11.22-p11.21UniSTS
Cytogenetic Map1q41UniSTS
Cytogenetic Map3q23UniSTS
Cytogenetic Map1p36.21UniSTS
Cytogenetic Map6q21UniSTS
Cytogenetic Map2p14UniSTS
Cytogenetic Map17q21UniSTS
Cytogenetic Map2q12.2UniSTS
Cytogenetic Map7p22.1UniSTS
Cytogenetic Map2q21UniSTS
Cytogenetic Map3p14.3UniSTS
Cytogenetic Map16p13.2UniSTS
Cytogenetic Map1p13.2UniSTS
Cytogenetic MapXq26.3UniSTS
Cytogenetic Map15q24.1UniSTS
Cytogenetic Map4q22.1UniSTS
Cytogenetic Map17q21.2UniSTS
Cytogenetic Map16q22.1UniSTS
Cytogenetic Map8q12.1UniSTS
Cytogenetic Map12q14.3UniSTS
Cytogenetic Map2q36.3UniSTS
Cytogenetic Map16q23.1UniSTS
Cytogenetic Map9q32UniSTS
Cytogenetic Map2q12UniSTS
Cytogenetic Map11cen-q12UniSTS
Cytogenetic Map20q11.22UniSTS
Cytogenetic Map15q13.3UniSTS
Cytogenetic MapXp21.1UniSTS
Cytogenetic Map5q31UniSTS
Cytogenetic Map20p11.2UniSTS
Cytogenetic Map3p22.3UniSTS
Cytogenetic Map17q21.31UniSTS
Cytogenetic Map15q15.1UniSTS
Cytogenetic Map9p13.3UniSTS
Cytogenetic Map2p24.1UniSTS
L17688  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map21q22.2UniSTS
Cytogenetic Map8q24.3UniSTS
Cytogenetic Map20q11.22UniSTS
Cytogenetic Map14q24.2UniSTS
Cytogenetic Map19p13UniSTS
Cytogenetic Map19p13.2UniSTS
Cytogenetic Map16p11.2UniSTS
Cytogenetic Map22q13.33UniSTS
Cytogenetic Map7q22.1UniSTS
Cytogenetic Map8p11.22UniSTS
Cytogenetic Map11q23UniSTS
Cytogenetic Map3p25.3UniSTS
Cytogenetic Map19p13.3UniSTS
Cytogenetic Map19q13.1UniSTS
Cytogenetic Map7q32.1UniSTS
Cytogenetic Map1p36.33UniSTS
Cytogenetic Map7q31.1-q31.3UniSTS
Cytogenetic Map5q31.1UniSTS
Cytogenetic Map17q25.1UniSTS
Cytogenetic Map16p13.3UniSTS
Cytogenetic Map16q22UniSTS
Cytogenetic Map8q22.3UniSTS
Cytogenetic Map20q13.31UniSTS
Cytogenetic Map1p36.31UniSTS
Cytogenetic Map11q12.2UniSTS
Cytogenetic Map12q13UniSTS
Cytogenetic Map22q11.23UniSTS
Cytogenetic Map8p11.23UniSTS
Cytogenetic Map18q21.33UniSTS
Cytogenetic Map6q21UniSTS
Cytogenetic Map22q13.1UniSTS
Cytogenetic Map20q11.23UniSTS
Cytogenetic Map3q27.1UniSTS
Cytogenetic Map1q21.1UniSTS
Cytogenetic Map19q13.31UniSTS
Cytogenetic Map4p16.3UniSTS
Cytogenetic Map19q13.43UniSTS
Cytogenetic Map19p12UniSTS
Cytogenetic Map6p24.1UniSTS
Cytogenetic Map1q32UniSTS
L17971  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map1q21UniSTS
Cytogenetic Map17q25.3UniSTS
Cytogenetic Map17p11.2UniSTS
Cytogenetic Map14q32.3UniSTS
Cytogenetic Map19q13.4UniSTS
Cytogenetic Map17q25UniSTS
Cytogenetic Map10p13UniSTS
Cytogenetic Map3q27UniSTS
Cytogenetic Map9q34.3UniSTS
Cytogenetic Map11q13.1UniSTS
Cytogenetic Map17q21UniSTS
Cytogenetic MapXp11.23UniSTS
Cytogenetic Map9q34.11UniSTS
Cytogenetic Map21q22.3UniSTS
Cytogenetic Map19p13UniSTS
Cytogenetic Map19q13.3UniSTS
Cytogenetic Map19p13.3UniSTS
Cytogenetic Map2p13.1UniSTS
Cytogenetic Map1q42.11UniSTS
Cytogenetic MapXp11.3UniSTS
Cytogenetic Map14q32.33UniSTS
Cytogenetic Map2q37.3UniSTS
Cytogenetic Map4q12UniSTS
Cytogenetic Map1p36.1UniSTS
Cytogenetic Map4q21.23UniSTS
Cytogenetic Map22q11.2UniSTS
Cytogenetic Map22q13.33UniSTS
Cytogenetic Map7q22.1UniSTS
Cytogenetic Map2q37.1UniSTS
Cytogenetic Map19q13.32UniSTS
Cytogenetic Map1p36.21UniSTS
Cytogenetic Map1p36.31UniSTS
Cytogenetic Map3p25.3UniSTS
Cytogenetic Map16p13.3UniSTS
Cytogenetic Map1p34.3UniSTS
Cytogenetic Map3p25UniSTS
Cytogenetic Map9q21.32UniSTS
Cytogenetic Map3q23UniSTS
Cytogenetic Map6p21.3UniSTS
Cytogenetic MapXq22UniSTS
Cytogenetic Map2q13UniSTS
Cytogenetic Map1p36.22UniSTS
Cytogenetic Map4p16.3UniSTS
Cytogenetic Map1p34.2UniSTS
Cytogenetic Map22q13.2UniSTS
Cytogenetic Map17q11.2UniSTS
Cytogenetic Map12q13.3UniSTS
Cytogenetic Map11p15UniSTS
Cytogenetic Map1p21.3UniSTS
Cytogenetic Map19q13.1UniSTS
Cytogenetic Map19q13.12UniSTS
Cytogenetic Map20q13.32UniSTS
Cytogenetic Map7p11.2UniSTS
Cytogenetic Map19q13.31UniSTS
Cytogenetic Map2q14.3UniSTS
Cytogenetic Map17q22UniSTS
Cytogenetic Map1q42.12UniSTS
Cytogenetic Map2p16.1UniSTS
Cytogenetic Map6q22.31UniSTS
Cytogenetic Map10p14UniSTS
Cytogenetic Map17p13.3UniSTS
Cytogenetic Map10p11.23UniSTS
Cytogenetic Map19p13.11UniSTS
Cytogenetic Map7p14.3UniSTS
Cytogenetic Map1p36.33UniSTS
Cytogenetic Map1q32.1UniSTS
Cytogenetic MapXq24UniSTS
Cytogenetic Map6p21.1UniSTS
Cytogenetic Map21q22.13UniSTS
Cytogenetic MapXq21.1UniSTS
Cytogenetic Map15q22UniSTS
Cytogenetic Map18q21.31UniSTS
Cytogenetic Map5q23.2UniSTS
Cytogenetic Map12q13.13UniSTS
Cytogenetic Map11q13.4UniSTS
Cytogenetic Map12q13.11-q14.3UniSTS
Cytogenetic Map3q13.33UniSTS
Cytogenetic Map15q22.31UniSTS
Cytogenetic Map8q24.3UniSTS
Cytogenetic Map14q12UniSTS
Cytogenetic Map11q22-q23UniSTS
Cytogenetic Map1p34.1UniSTS
Cytogenetic Map16q22UniSTS
Cytogenetic Map9p24.3UniSTS
Cytogenetic Map9q21.33UniSTS
Cytogenetic Map20q11.23UniSTS
Cytogenetic Map9q33.3UniSTS
Cytogenetic Map11q13.2UniSTS
Cytogenetic Map4q13.3UniSTS
Cytogenetic Map2p11.2UniSTS
Cytogenetic Map16q22.1UniSTS
Cytogenetic Map11p15.5UniSTS
Cytogenetic Map19p13.2UniSTS
Cytogenetic Map5p13.1UniSTS
Cytogenetic Map9q21.11UniSTS
Cytogenetic Map16q23.1UniSTS
Cytogenetic Map1p13.3UniSTS
Cytogenetic Map19q13UniSTS
Cytogenetic Map7q22.3UniSTS
Cytogenetic Map3q13.2UniSTS
Cytogenetic Map19p12UniSTS
Cytogenetic Map1p36.3-p36.2UniSTS
Cytogenetic Map1p31UniSTS
Cytogenetic Map9p13.2UniSTS
Cytogenetic Map19q13.2UniSTS
Cytogenetic Map19q13.43UniSTS
Cytogenetic Map1q32UniSTS
Cytogenetic Map5q34UniSTS
Cytogenetic Map2q36.1UniSTS
Cytogenetic Map1q42.13UniSTS
Cytogenetic Map1q21.1UniSTS
Cytogenetic Map18q12.2UniSTS
Cytogenetic Map15q13.3UniSTS
Cytogenetic Map6p21.31UniSTS
Cytogenetic Map17q25.1UniSTS
Cytogenetic Map15qUniSTS
Cytogenetic Map9p13.3UniSTS
Cytogenetic Map20p11.1UniSTS
Cytogenetic Map3p21.31UniSTS
Cytogenetic Map2q33.1UniSTS
Cytogenetic Map6q21UniSTS
Cytogenetic Map12q24.31UniSTS
Cytogenetic Map9q34.13UniSTS
D22S296  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic MapXp11.23UniSTS
Cytogenetic Map1p36.11UniSTS
Cytogenetic Map12q24.31UniSTS
Cytogenetic Map19p13.3UniSTS
Cytogenetic Map10p12.31UniSTS
Cytogenetic Map11q13UniSTS
Cytogenetic Map12q24.13UniSTS
Cytogenetic Map19p13.11UniSTS
Cytogenetic Map13q12.13UniSTS
Cytogenetic Map10q23-q24UniSTS
Cytogenetic Map8q24.3UniSTS
Cytogenetic Map15q24.1UniSTS
Cytogenetic Map9q33.2UniSTS
Cytogenetic Map12q21.1UniSTS
Cytogenetic Map3q13.13UniSTS
Cytogenetic Map3p21UniSTS
Cytogenetic Map5q35.3UniSTS
Cytogenetic Map16q22UniSTS
Cytogenetic Map17p13.1UniSTS
Cytogenetic Map8q21.2UniSTS
Cytogenetic Map10p15-p14UniSTS
Cytogenetic Map16p13.1UniSTS
Cytogenetic Map7q22.1UniSTS
Cytogenetic Map19q13.2UniSTS
Cytogenetic Map19p13.2UniSTS
Cytogenetic Map16q24.3UniSTS
Cytogenetic Map6p21UniSTS
Cytogenetic Map13q22.1UniSTS
Cytogenetic Map19q13.43UniSTS
Cytogenetic Map2q31.1UniSTS
Cytogenetic Map19p12UniSTS
Cytogenetic Map9q21.13UniSTS
Cytogenetic Map20q13.32UniSTS
D1S1423  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map10p12.1UniSTS
Cytogenetic Map10p12.1-p11.2UniSTS
Cytogenetic Map9q34.13UniSTS
Cytogenetic Map16q22.1UniSTS
Cytogenetic Map21q22.2UniSTS
Cytogenetic Map3p24.2UniSTS
Cytogenetic Map9q32UniSTS
Cytogenetic Map1q24UniSTS
Cytogenetic Map1q21UniSTS
Cytogenetic Map1p36.33UniSTS
Cytogenetic Map7p15.2UniSTS
Cytogenetic Map6p21UniSTS
Cytogenetic Map5q31UniSTS
Cytogenetic Map6p22.3-p21.32UniSTS
Cytogenetic Map6q22.33UniSTS
Cytogenetic Map3q29UniSTS
Cytogenetic Map17p11.2UniSTS
Cytogenetic Map19q13.3UniSTS
Cytogenetic Map1p36.13UniSTS
Cytogenetic Map5q33.3UniSTS
Cytogenetic Map22q11.22UniSTS
Cytogenetic Map11q13.2-q13.3UniSTS
Cytogenetic Map3q22-q24UniSTS
Cytogenetic Map8p21.3UniSTS
Cytogenetic Map7q32UniSTS
Cytogenetic Map1p32.3UniSTS
Cytogenetic Map19p13.12UniSTS
Cytogenetic Map4q21.1UniSTS
Cytogenetic Map12q13.13UniSTS
Cytogenetic Map7q11.2UniSTS
Cytogenetic Map1p22.1UniSTS
Cytogenetic Map2q32UniSTS
Cytogenetic MapXq13.1UniSTS
Cytogenetic Map9q12UniSTS
Cytogenetic Map3q26.2UniSTS
Cytogenetic Map22q11.21UniSTS
Cytogenetic Map10q23-q24UniSTS
Cytogenetic Map17q12UniSTS
Cytogenetic Map1p36.21UniSTS
Cytogenetic Map19p13.2UniSTS
Cytogenetic Map16q24.3UniSTS
Cytogenetic Map9q34.3UniSTS
Cytogenetic Map4p14UniSTS
Cytogenetic Map2p12UniSTS
Cytogenetic Map16p11.2UniSTS
Cytogenetic Map3q23UniSTS
Cytogenetic Map18q22.1UniSTS
Cytogenetic Map13q12UniSTS
Cytogenetic Map10p14-p13UniSTS
Cytogenetic Map12p13.31UniSTS
Cytogenetic Map14q24.3UniSTS
Cytogenetic Map22q13.2UniSTS
Cytogenetic Map19q13.11UniSTS
Cytogenetic Map11q23-q24UniSTS
Cytogenetic Map11q13.1UniSTS
Cytogenetic Map12q24.31UniSTS
Cytogenetic Map17q25UniSTS
Cytogenetic Map16q24.1UniSTS
Cytogenetic Map5q23.3UniSTS
Cytogenetic Map19q13.43UniSTS
Cytogenetic Map17q11.2UniSTS
Cytogenetic Map20q13.12UniSTS
Cytogenetic MapXp11.23UniSTS
Cytogenetic Map19q13.42UniSTS
Cytogenetic Map16q13UniSTS
Cytogenetic Map11q25UniSTS
Cytogenetic Map22cen-q12.3UniSTS
Cytogenetic Map10p13UniSTS
Cytogenetic Map2p11.2UniSTS
Cytogenetic Map15q11.2-q21.3UniSTS
Cytogenetic Map1p21.2UniSTS
Cytogenetic Map19p13UniSTS
Cytogenetic Map7q21.13UniSTS
Cytogenetic Map7q31.1UniSTS
Cytogenetic Map17p13.3UniSTS
Cytogenetic Map1p35.1UniSTS
Cytogenetic Map16q24UniSTS
Cytogenetic Map3q25UniSTS
Cytogenetic Map2q24.2UniSTS
Cytogenetic Map1p31.3UniSTS
Cytogenetic Map14q31.1UniSTS
Cytogenetic Map22q13.1UniSTS
Cytogenetic Map20q13.31UniSTS
Cytogenetic Map19p13.3UniSTS
Cytogenetic Map6p12.1UniSTS
Cytogenetic Map6q25.3UniSTS
Cytogenetic Map1q32.1UniSTS
Cytogenetic Map11q24.2UniSTS
Cytogenetic Map10p15.1UniSTS
Cytogenetic Map2p13.1UniSTS
Cytogenetic Map19q13.12UniSTS
Cytogenetic Map12p13.32UniSTS
Cytogenetic Map4q35.1UniSTS
Cytogenetic Map2p13.3UniSTS
Cytogenetic Map1p22UniSTS
Cytogenetic Map2q14UniSTS
Cytogenetic Map4q12UniSTS
Cytogenetic Map16p13.3UniSTS
Cytogenetic Map14q32.33UniSTS
Cytogenetic Map1p36.1UniSTS
Cytogenetic Map8p11.21UniSTS
Cytogenetic MapXq26.3UniSTS
Cytogenetic Map8q24.11UniSTS
Cytogenetic Map9q22.31UniSTS
Cytogenetic Map7q11.23UniSTS
Cytogenetic Map2p15UniSTS
Cytogenetic Map5q31.1UniSTS
Cytogenetic Map8q24.13UniSTS
Cytogenetic Map17p13UniSTS
Cytogenetic Map8p11.22UniSTS
Cytogenetic Map4q28UniSTS
Cytogenetic Map15q24.1UniSTS
Cytogenetic Map1q41-q42UniSTS
Cytogenetic Map10q22UniSTS
Cytogenetic Map5q35.3UniSTS
Cytogenetic Map20q11.21UniSTS
Cytogenetic Map8q24.3UniSTS
Cytogenetic Map12p13.1-p12.3UniSTS
Cytogenetic Map6p21.33UniSTS
Cytogenetic Map22q13.33UniSTS
Cytogenetic Map19p12UniSTS
Cytogenetic Map1p13.1UniSTS
Cytogenetic Map7q22.1UniSTS
Cytogenetic Map14q12UniSTS
Cytogenetic Map19q13.32UniSTS
Cytogenetic Map11q13.2UniSTS
Cytogenetic Map15q22.31UniSTS
Cytogenetic Map5q12.3UniSTS
Cytogenetic Map7q33UniSTS
Cytogenetic Map17q21.2UniSTS
Cytogenetic Map4q23UniSTS
Cytogenetic Map12q13.12UniSTS
Cytogenetic Map18p11.21UniSTS
Cytogenetic Map10q26.11UniSTS
Cytogenetic Map14q32.12UniSTS
Cytogenetic Map11q24.1UniSTS
Cytogenetic Map18q23UniSTS
Cytogenetic Map2q31.1UniSTS
Cytogenetic Map18p11.31UniSTS
Cytogenetic Map2q24.3UniSTS
Cytogenetic Map11q23UniSTS
Cytogenetic Map17q21.31UniSTS
Cytogenetic Map13q34UniSTS
Cytogenetic Map1p34.3UniSTS
Cytogenetic Map10p14UniSTS
Cytogenetic Map15q22.2UniSTS
Cytogenetic Map17q25.1UniSTS
Cytogenetic Map5q32UniSTS
Cytogenetic Map4p16.3UniSTS
Cytogenetic Map12q23.2UniSTS
Cytogenetic Map11q12.3UniSTS
Cytogenetic Map16q12.2UniSTS
Cytogenetic Map9q22.2UniSTS
Cytogenetic Map1q21.3UniSTS
Cytogenetic Map1p35.3UniSTS
Cytogenetic Map19q13.2UniSTS
Cytogenetic Map11p15.5UniSTS
Cytogenetic Map7q22UniSTS
Cytogenetic Map18p11.31-p11.21UniSTS
Cytogenetic Map3p25.3UniSTS
Cytogenetic Map3q13UniSTS
Cytogenetic Map21q22.3UniSTS
Cytogenetic Map1q43UniSTS
Cytogenetic Map19p13.11UniSTS
Cytogenetic Map19q13.41UniSTS
Cytogenetic Map7p21.2UniSTS
Cytogenetic Map12q21.1UniSTS
Cytogenetic Map15q15.1UniSTS
Cytogenetic Map15q13.1UniSTS
Cytogenetic Map1q42.1UniSTS
Cytogenetic Map5q31.2UniSTS
Cytogenetic Map1q21.2UniSTS
Cytogenetic Map17p13.1UniSTS
Cytogenetic Map1p34-p33UniSTS
Cytogenetic Map3q22.1UniSTS
Cytogenetic Map7p14UniSTS
Cytogenetic Map15q21UniSTS
Cytogenetic Map12q24.2UniSTS
Cytogenetic Map20q13UniSTS
Cytogenetic Map19q13.3-q13.4UniSTS
Cytogenetic Map17q21.32UniSTS
Cytogenetic Map15q11.2UniSTS
Cytogenetic Map8p23-p22UniSTS
Cytogenetic Map1p12UniSTS
Cytogenetic Map3q13.33UniSTS
Cytogenetic Map10p12.33UniSTS
Cytogenetic Map5q13.2UniSTS
Cytogenetic Map3q26UniSTS
Cytogenetic Map9p21.2UniSTS
Cytogenetic Map2p16.1UniSTS
Cytogenetic Map5q21.3UniSTS
Cytogenetic Map1p36.22UniSTS
Cytogenetic Map1p34.2UniSTS
Cytogenetic Map3q26.31UniSTS
Cytogenetic MapXp22.33UniSTS
Cytogenetic MapYp11.3UniSTS
Cytogenetic Map17q24.1UniSTS
Cytogenetic Map9q21.11UniSTS
Cytogenetic Map6q22.31UniSTS
Cytogenetic Map9q21.13UniSTS
Cytogenetic Map10q11.22UniSTS
Cytogenetic Map22q13.31UniSTS
Cytogenetic Map17p12UniSTS
Cytogenetic Map17q21.33UniSTS
Cytogenetic Map5p13.3UniSTS
Cytogenetic Map10q21.3UniSTS
Cytogenetic Map10q22.1UniSTS
Cytogenetic Map1p34UniSTS
Cytogenetic MapXp22UniSTS
Cytogenetic Map20p12.3-p11.21UniSTS
Cytogenetic Map2q37.1UniSTS
Cytogenetic Map6p25UniSTS
Cytogenetic MapXq27.2UniSTS
Cytogenetic Map4q31.1UniSTS
Cytogenetic Map4q31UniSTS
Cytogenetic Map22q13.1-q13.2UniSTS
Cytogenetic MapXq28UniSTS
Cytogenetic Map1p36.11UniSTS
Cytogenetic Map12q13.3UniSTS
Cytogenetic Map3q26.33UniSTS
Cytogenetic Map19q13.4UniSTS
Cytogenetic Map14q32UniSTS
Cytogenetic Map10q24.3UniSTS
Cytogenetic Map16q21UniSTS
Cytogenetic Map2p13UniSTS
Cytogenetic Map19q13.1UniSTS
Cytogenetic Map7q21-q22UniSTS
Cytogenetic Map2q11.2UniSTS
Cytogenetic Map17q25.3UniSTS
Cytogenetic Map4q22.1UniSTS
Cytogenetic Map11q22.1UniSTS
Cytogenetic Map12q14.2UniSTS
Cytogenetic Map20p13UniSTS
Cytogenetic Map7q36.3UniSTS
Cytogenetic Map20q11.21-q11.23UniSTS
Cytogenetic Map2q33.2UniSTS
Cytogenetic Map12q22UniSTS
Cytogenetic Map20q13.13UniSTS
Cytogenetic Map21p11.1UniSTS
Cytogenetic Map1p35-p34.3UniSTS
Cytogenetic Map7p11.2UniSTS
Cytogenetic Map13q14UniSTS
Cytogenetic Map7q36.1UniSTS
Cytogenetic Map12q24.31-q24.32UniSTS
Cytogenetic Map17q21.1UniSTS
Cytogenetic Map3q12.3UniSTS
Cytogenetic Map12qUniSTS
Cytogenetic Map11q13.5UniSTS
Cytogenetic Map2p14UniSTS
Cytogenetic Map2q14.3UniSTS
Cytogenetic Map7q34UniSTS
Cytogenetic Map14q32.1UniSTS
Cytogenetic Map21q22.11UniSTS
Cytogenetic Map3p14.1UniSTS
Cytogenetic Map16q23.2UniSTS
Cytogenetic Map7q32.1UniSTS
Cytogenetic Map17q22UniSTS
Cytogenetic Map4q31.23UniSTS
Cytogenetic Map11p15.3UniSTS
Cytogenetic Map3q27.1UniSTS
Cytogenetic Map2p22.3UniSTS
Cytogenetic Map22q13UniSTS
Cytogenetic Map1q32UniSTS
Cytogenetic Map11q14UniSTS
Cytogenetic MapXq13.2UniSTS
Cytogenetic Map16p13.12UniSTS
Cytogenetic MapXq22.3UniSTS
Cytogenetic Map9p12UniSTS
Cytogenetic Map4p16.1UniSTS
Cytogenetic Map11q23.1UniSTS
Cytogenetic Map3q27.3UniSTS
Cytogenetic Map16q23.1UniSTS
Cytogenetic Map15q15.2UniSTS
Cytogenetic Map2p21UniSTS
Cytogenetic Map13q33.3UniSTS
Cytogenetic Map15q22-q24UniSTS
Cytogenetic Map14q32.11UniSTS
Cytogenetic Map7p14.3UniSTS
Cytogenetic Map14q21.2UniSTS
Cytogenetic Map15q25.2UniSTS
Cytogenetic Map15q23UniSTS
Cytogenetic Map2p23.3UniSTS
Cytogenetic Map4p15.31UniSTS
Cytogenetic Map1q22UniSTS
Cytogenetic Map20q13.1UniSTS
Cytogenetic Map15q21.3UniSTS
Cytogenetic Map10q23.33UniSTS
Cytogenetic Map4q26UniSTS
Cytogenetic MapXq24UniSTS
Cytogenetic Map10q23.1UniSTS
Cytogenetic Map6p21.1UniSTS
Cytogenetic Map15q22.1-q22.31UniSTS
Cytogenetic Map1q31-q41UniSTS
Cytogenetic Map6q23.3UniSTS
Cytogenetic Map7q21.2UniSTS
Cytogenetic Map14q23UniSTS
Cytogenetic Map12q11-q12UniSTS
Cytogenetic Map17q23.3UniSTS
Cytogenetic Map4q24UniSTS
Cytogenetic Map1p32UniSTS
Cytogenetic Map3p21.1-p14.2UniSTS
Cytogenetic Map12q22-q23.1UniSTS
Cytogenetic Map6p22.1UniSTS
Cytogenetic Map6q24.2UniSTS
Cytogenetic Map9p13.3UniSTS
Cytogenetic Map6p24.1UniSTS
Cytogenetic Map19q13UniSTS
Cytogenetic Map20q11.22-q11.23UniSTS
Cytogenetic Map3p22.3UniSTS
Cytogenetic Map12q12UniSTS
Cytogenetic MapXq13-q21UniSTS
Cytogenetic Map9q34.11UniSTS
Cytogenetic Map16p13.13UniSTS
Cytogenetic Map10pter-q25.3UniSTS
Cytogenetic Map9p24.1UniSTS
Cytogenetic Map12p13.2UniSTS
Cytogenetic Map12q24UniSTS
Cytogenetic Map3q28-q29UniSTS
Cytogenetic Map10q26UniSTS
Cytogenetic Map6p22.2UniSTS
Cytogenetic Map2q13UniSTS
Cytogenetic Map12q24.2-q24.31UniSTS
Cytogenetic Map22q12.2UniSTS
Cytogenetic Map1q32.2-q41UniSTS
Cytogenetic Map11q22-q23UniSTS
Cytogenetic Map12p13.3UniSTS
Cytogenetic Map1p34.1UniSTS
Cytogenetic Map22q11UniSTS
Cytogenetic Map2q21.1UniSTS
Cytogenetic Map16p13.11UniSTS
Cytogenetic Map1q25.1UniSTS
Cytogenetic Map1p36.3UniSTS
Cytogenetic Map9p21UniSTS
Cytogenetic Map6p21.3UniSTS
Cytogenetic Map1q41UniSTS
Cytogenetic Map11q13.1-q13.3UniSTS
Cytogenetic Map16p13UniSTS
Cytogenetic Map15q26UniSTS
Cytogenetic Map18q21UniSTS
Cytogenetic Map4p15.1-p14UniSTS
Cytogenetic Map8q11.2UniSTS
Cytogenetic Map16q22UniSTS
Cytogenetic Map15q11-q13UniSTS
Cytogenetic Map7p12.3UniSTS
Cytogenetic Map7p13UniSTS
Cytogenetic Map15q26.1UniSTS
Cytogenetic Map14q22.1UniSTS
Cytogenetic Map2q12.3UniSTS
Cytogenetic MapXp22.12UniSTS
Cytogenetic Map20q11.23UniSTS
Cytogenetic Map1q21.1UniSTS
Cytogenetic Map1p36.31UniSTS
Cytogenetic Map16q11.2UniSTS
Cytogenetic Map14q32.2UniSTS
Cytogenetic Map11p15.4UniSTS
Cytogenetic Map22q11.1UniSTS
Cytogenetic Map5q33.2UniSTS
Cytogenetic Map14q23.1UniSTS
Cytogenetic Map7q32.3UniSTS
Cytogenetic Map20q13.3UniSTS
Cytogenetic Map10q26.13UniSTS
Cytogenetic Map1p31.1UniSTS
Cytogenetic Map11q13.4UniSTS
Cytogenetic Map11q23.3UniSTS
Cytogenetic Map15q25.1UniSTS
Cytogenetic Map9p13UniSTS
Cytogenetic Map2p24.2UniSTS
Cytogenetic Map9q33.3UniSTS
Cytogenetic Map19q13.31UniSTS
Cytogenetic Map11q12.2UniSTS
Cytogenetic Map7p15.3UniSTS
Cytogenetic Map6p25.2UniSTS
Cytogenetic Map6q25.1UniSTS
Cytogenetic Map3p21.31UniSTS
Cytogenetic Map17q23.2UniSTS
Cytogenetic MapXq25UniSTS
Cytogenetic Map2p25.1UniSTS
Cytogenetic Map1q25.3UniSTS
Cytogenetic Map6p24-p22.3UniSTS
Cytogenetic Map6q21UniSTS
Cytogenetic Map16p12.2UniSTS
Cytogenetic Map3q21-q24UniSTS
Cytogenetic Map4q13UniSTS
Cytogenetic Map11p13UniSTS
Cytogenetic Map9q34UniSTS
Cytogenetic Map8q13.1UniSTS
Cytogenetic Map5q21.2UniSTS
Cytogenetic Map4q34.3UniSTS
Cytogenetic Map3p22.1UniSTS
Cytogenetic Map2q37.3UniSTS
Cytogenetic Map8p23.1UniSTS
Cytogenetic Map1p13.3UniSTS
Cytogenetic Map15q14UniSTS
Cytogenetic Map13q13.3UniSTS
Cytogenetic Map12q13.2UniSTS
Cytogenetic Map1q31UniSTS
Cytogenetic Map7q11.21UniSTS
Cytogenetic Map10q26.3UniSTS
Cytogenetic Map15q15UniSTS
Cytogenetic MapXp11.4UniSTS
Cytogenetic Map8q24.12UniSTS
Cytogenetic Map15q22UniSTS
Cytogenetic Map1q25.2UniSTS
Cytogenetic Map13q11-q12UniSTS
Cytogenetic Map10q24.2UniSTS
Cytogenetic Map15q21.1UniSTS
Cytogenetic Map15q13.2UniSTS
Cytogenetic Map6q25.2UniSTS
Cytogenetic Map14q11.2UniSTS
Cytogenetic Map2q33.1UniSTS
Cytogenetic Map6q14.1UniSTS
Cytogenetic Map3q23-q24UniSTS
Cytogenetic Map2p25.1-p24.1UniSTS
Cytogenetic Map12q14.3UniSTS
Cytogenetic Map6q16.1UniSTS
Cytogenetic Map5p13.1UniSTS
Cytogenetic Map5q13UniSTS
Cytogenetic Map20pter-p12UniSTS
Cytogenetic MapXp22.11UniSTS
Cytogenetic Map16p13.2UniSTS
Cytogenetic Map16q22.3UniSTS
Cytogenetic Map7q31.3UniSTS
Cytogenetic Map21q22.13UniSTS
Cytogenetic Map1p21UniSTS
Cytogenetic Map8p11UniSTS
Cytogenetic Map7p14.2UniSTS
Cytogenetic Map8p11.23UniSTS
Cytogenetic Map18p11.22UniSTS
Cytogenetic Map18q21.33UniSTS
Cytogenetic Map9p24.3UniSTS
Cytogenetic Map11q22.3UniSTS
Cytogenetic Map14q22.2UniSTS
Cytogenetic Map20p11.22-p11.1UniSTS
Cytogenetic Map6p21.31UniSTS
Cytogenetic Map14q22.3UniSTS
Cytogenetic Map12q15UniSTS
Cytogenetic Map7q31UniSTS
Cytogenetic Map2q12.2UniSTS
Cytogenetic Map8p12UniSTS
Cytogenetic Map7p22.1UniSTS
Cytogenetic Map6p12.3UniSTS
Cytogenetic Map11q12-q13UniSTS
Cytogenetic Map18q21.1UniSTS
Cytogenetic Map10p11.21UniSTS
Cytogenetic Map6p22-p21UniSTS
Cytogenetic Map17q21.1-q21.3UniSTS
Cytogenetic Map12q24.33UniSTS
Cytogenetic Map4p15.32UniSTS
Cytogenetic Map1q42.13UniSTS
Cytogenetic Map19q12UniSTS
Cytogenetic Map3p14.3UniSTS
Cytogenetic Map12p13.2-p12.3UniSTS
Cytogenetic Map9q22.32UniSTS
Cytogenetic Map1p36.3-p36.2UniSTS
Cytogenetic Map5q22.2UniSTS
Cytogenetic Map4p15.2UniSTS
Cytogenetic Map4p15.3UniSTS
Cytogenetic Map4q28.1UniSTS
Cytogenetic Map12q13.1-q13.2UniSTS
Cytogenetic Map19q13.33UniSTS
Cytogenetic Map1p31UniSTS
Cytogenetic Map17p13.2UniSTS
Cytogenetic Map15q15.3UniSTS
Cytogenetic Map13q14.11UniSTS
Cytogenetic Map9p22.3UniSTS
Cytogenetic Map8q22.2UniSTS
Cytogenetic Map8q21.11UniSTS
Cytogenetic Map22q12.1UniSTS
Cytogenetic Map3q13.2UniSTS
Cytogenetic Map2q35UniSTS
Cytogenetic Map2q33.3UniSTS
Cytogenetic Map8p22UniSTS
Cytogenetic Map10q22.2UniSTS
Cytogenetic Map20p12.1UniSTS
Cytogenetic Map6q13UniSTS
Cytogenetic Map6q22.32UniSTS
Cytogenetic Map5q34UniSTS
Cytogenetic Map5p15.2UniSTS
Cytogenetic Map5q11.2UniSTS
Cytogenetic Map2q36.1UniSTS
Cytogenetic Map18q11.2UniSTS
Cytogenetic Map18q12.2UniSTS
Cytogenetic Map14q21.3UniSTS
Cytogenetic Map13q33.1UniSTS
Cytogenetic Map12p11.21UniSTS
Cytogenetic Map12q23.1UniSTS
Cytogenetic Map16p12.1UniSTS
Cytogenetic Map2q33UniSTS
Cytogenetic Map5q12.1UniSTS
Cytogenetic Map12q24.13UniSTS
Cytogenetic Map13q14.2UniSTS
Cytogenetic Map7q36UniSTS
Cytogenetic Map10q22.3-q23.2UniSTS
Cytogenetic Map7p15UniSTS
Cytogenetic Map14q32.31UniSTS
Cytogenetic Map11q21UniSTS
Cytogenetic Map4q21.3UniSTS
Cytogenetic Map7p13-p12UniSTS
Cytogenetic Map8p21.2UniSTS
Cytogenetic Map4q22UniSTS
Cytogenetic Map11q13UniSTS
Cytogenetic Map3q12.1UniSTS
Cytogenetic Map7q21.1-q22UniSTS
Cytogenetic Map17q21UniSTS
Cytogenetic Map3q13.13-q13.2UniSTS
Cytogenetic Map3p21.3UniSTS
Cytogenetic Map13q32.2UniSTS
Cytogenetic Map3q26.32UniSTS
Cytogenetic Map15qUniSTS
Cytogenetic Map2p13.2UniSTS
Cytogenetic Map3p12.3UniSTS
Cytogenetic Map10q11.23UniSTS
Cytogenetic Map3q11.2UniSTS
Cytogenetic Map12q13.11UniSTS
Cytogenetic Map13q14.13UniSTS
Cytogenetic Map10q23UniSTS
Cytogenetic Map11p11.2UniSTS
Cytogenetic Map6q16.2UniSTS
Cytogenetic Map3q21.1UniSTS
Cytogenetic Map10q11.21UniSTS
Cytogenetic Map1p13.2UniSTS
Cytogenetic Map6p24.2UniSTS
Cytogenetic Map20q13.33UniSTS
L17877  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map3p24.2UniSTS
Cytogenetic Map1q21UniSTS
Cytogenetic Map17p11.2UniSTS
Cytogenetic Map14q24.3UniSTS
Cytogenetic Map10p13UniSTS
Cytogenetic Map2q11.2UniSTS
Cytogenetic Map19q13.1UniSTS
Cytogenetic Map19p13.2UniSTS
Cytogenetic Map17q21UniSTS
Cytogenetic Map16p11.2UniSTS
Cytogenetic Map19q13.43UniSTS
Cytogenetic Map2p13.1UniSTS
Cytogenetic Map20q13.13UniSTS
Cytogenetic Map19p13UniSTS
Cytogenetic Map8p11.21UniSTS
Cytogenetic Map2q37.3UniSTS
Cytogenetic Map1p36.1UniSTS
Cytogenetic Map5q31.1UniSTS
Cytogenetic Map22q13.1UniSTS
Cytogenetic MapYp11.2UniSTS
Cytogenetic Map19q13.3UniSTS
Cytogenetic Map1q23.1UniSTS
Cytogenetic Map9q32UniSTS
Cytogenetic Map6p22.1UniSTS
Cytogenetic Map22q13.33UniSTS
Cytogenetic Map12q24.31UniSTS
Cytogenetic Map1p36.21UniSTS
Cytogenetic Map2p11.2UniSTS
Cytogenetic Map11q13UniSTS
Cytogenetic Map1p34.2UniSTS
Cytogenetic Map5q32UniSTS
Cytogenetic Map1q21.2UniSTS
Cytogenetic Map1q41UniSTS
Cytogenetic Map19q13.32UniSTS
Cytogenetic Map1p34.1UniSTS
Cytogenetic Map22q13.2UniSTS
Cytogenetic Map2q37.1UniSTS
Cytogenetic Map11q13.2UniSTS
Cytogenetic Map6p22UniSTS
Cytogenetic Map6q14.1UniSTS
Cytogenetic Map7q36.1UniSTS
Cytogenetic Map19q13.12UniSTS
Cytogenetic Map4q22.1UniSTS
Cytogenetic Map17q11.2UniSTS
Cytogenetic Map6p21.1UniSTS
Cytogenetic Map9q33.2UniSTS
Cytogenetic Map3p14.1UniSTS
Cytogenetic Map2q32.3UniSTS
Cytogenetic MapXp22.3UniSTS
Cytogenetic Map17q22UniSTS
Cytogenetic Map1q42.12UniSTS
Cytogenetic Map6q22.31UniSTS
Cytogenetic Map7p13UniSTS
Cytogenetic Map10p14UniSTS
Cytogenetic Map10q24.31UniSTS
Cytogenetic Map17p13.3UniSTS
Cytogenetic Map3q13.13UniSTS
Cytogenetic Map1p36.13UniSTS
Cytogenetic Map10p11.23UniSTS
Cytogenetic Map14q11.2UniSTS
Cytogenetic Map4p15.31UniSTS
Cytogenetic Map5q31.3UniSTS
Cytogenetic MapXq24UniSTS
Cytogenetic MapXq21.1UniSTS
Cytogenetic Map15q22UniSTS
Cytogenetic Map1p36.22UniSTS
Cytogenetic Map6p25UniSTS
Cytogenetic Map18q21.31UniSTS
Cytogenetic Map7q34UniSTS
Cytogenetic Map20pter-q12UniSTS
Cytogenetic Map12q13.11-q14.3UniSTS
Cytogenetic Map9q21.3UniSTS
Cytogenetic Map20q11.22-q11.23UniSTS
Cytogenetic Map6q21UniSTS
Cytogenetic MapXq13-q21UniSTS
Cytogenetic Map3q13.33UniSTS
Cytogenetic Map14q12UniSTS
Cytogenetic Map11q22-q23UniSTS
Cytogenetic Map6p21.3UniSTS
Cytogenetic Map15q26.3UniSTS
Cytogenetic Map16p13.3UniSTS
Cytogenetic Map16q22UniSTS
Cytogenetic Map5q14.1UniSTS
Cytogenetic Map6p25.2UniSTS
Cytogenetic Map9q21.33UniSTS
Cytogenetic Map2q13UniSTS
Cytogenetic Map11q12.2UniSTS
Cytogenetic Map6q25.1UniSTS
Cytogenetic Map2q14.3UniSTS
Cytogenetic Map14q23.2UniSTS
Cytogenetic MapXq13.1UniSTS
Cytogenetic Map10q26.11UniSTS
Cytogenetic Map8q13.2UniSTS
Cytogenetic Map19p13.11UniSTS
Cytogenetic Map16q22.1UniSTS
Cytogenetic Map11p15.5UniSTS
Cytogenetic Map19qUniSTS
Cytogenetic Map4p16UniSTS
Cytogenetic Map15q15.3UniSTS
Cytogenetic MapXp22.12UniSTS
Cytogenetic Map16p13.11UniSTS
Cytogenetic MapXp11.23UniSTS
Cytogenetic Map5p13.1UniSTS
Cytogenetic Map9q31.3UniSTS
Cytogenetic Map5q34UniSTS
Cytogenetic Map1p13.3UniSTS
Cytogenetic Map10p15.3UniSTS
Cytogenetic Map16q23.1UniSTS
Cytogenetic Map3q13.2UniSTS
Cytogenetic Map3q29UniSTS
Cytogenetic Map19p12UniSTS
Cytogenetic Map1p36.3-p36.2UniSTS
Cytogenetic Map19q13.41UniSTS
Cytogenetic Map9p13.2UniSTS
Cytogenetic Map19q13.2UniSTS
Cytogenetic Map1q32UniSTS
Cytogenetic Map12q14.2UniSTS
Cytogenetic Map2q33.1UniSTS
Cytogenetic Map19q13.31UniSTS
Cytogenetic Map18q12.2UniSTS
Cytogenetic Map7q22.1UniSTS
Cytogenetic Map8p23.1UniSTS
Cytogenetic Map13q14.11UniSTS
Cytogenetic Map17q21.31UniSTS
Cytogenetic Map19q13.42UniSTS
Cytogenetic Map15q13.3UniSTS
Cytogenetic Map9p13.3UniSTS
Cytogenetic Map16p12.2UniSTS
Cytogenetic Map17q12UniSTS
Cytogenetic Map11q23.3UniSTS
Cytogenetic Map12p13.31UniSTS
Cytogenetic Map14q32.33UniSTS
Cytogenetic Map17q25.3UniSTS
RH36905  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map5q31.2UniSTS
Cytogenetic Map20p13UniSTS
Cytogenetic Map17q25.1UniSTS
Cytogenetic Map1q32.3UniSTS
Cytogenetic Map12q24.11UniSTS
Cytogenetic Map1p21.2UniSTS
Cytogenetic Map19p13UniSTS
Cytogenetic Map11q23.1UniSTS
Cytogenetic Map5q33.3UniSTS
Cytogenetic Map1p36.13UniSTS
Cytogenetic Map19p13.11UniSTS
Cytogenetic Map1q32.1UniSTS
Cytogenetic Map2p13.3UniSTS
Cytogenetic Map8q24.13UniSTS
Cytogenetic Map7q22.1UniSTS
Cytogenetic Map19q13.3UniSTS
Cytogenetic Map9p24.3UniSTS
Cytogenetic Map10p14UniSTS
Cytogenetic Map19q13.32UniSTS
Cytogenetic Map2p25.1UniSTS
Cytogenetic Map11q12.3UniSTS
Cytogenetic Map17q25UniSTS
Cytogenetic Map17q21.31UniSTS
Cytogenetic Map22q13.2UniSTS
Cytogenetic Map7q36.1UniSTS
Cytogenetic Map12q13.3UniSTS
Cytogenetic Map1p12UniSTS
Cytogenetic Map10p12.33UniSTS
Cytogenetic Map12q13.12UniSTS
Cytogenetic Map3p21.31UniSTS
Cytogenetic Map19q13.2UniSTS
Cytogenetic Map1p34.2UniSTS
Cytogenetic Map10p13UniSTS
Cytogenetic Map18p11.3-p11.2UniSTS
Cytogenetic Map16q24.1UniSTS
Cytogenetic Map14q24.1UniSTS
Cytogenetic Map19p13.2UniSTS
Cytogenetic Map10q24.32UniSTS
Cytogenetic Map20q13.31UniSTS
Cytogenetic Map11q13.5UniSTS
Cytogenetic Map2p11.2UniSTS
Cytogenetic Map3q27-q28UniSTS
Cytogenetic Map5q31UniSTS
Cytogenetic Map3q26.3UniSTS
Cytogenetic Map17q11.2UniSTS
Cytogenetic Map3p21.1UniSTS
Cytogenetic Map14q32.31UniSTS
Cytogenetic MapXp22.33UniSTS
Cytogenetic MapYp11.32UniSTS
Cytogenetic Map5p13.2UniSTS
Cytogenetic Map17p13.3UniSTS
Cytogenetic Map17q21.33UniSTS
Cytogenetic Map14q13.2UniSTS
Cytogenetic Map1p36.33UniSTS
Cytogenetic Map2p21UniSTS
Cytogenetic Map2q11.2UniSTS
Cytogenetic Map15q21UniSTS
Cytogenetic Map12p12UniSTS
Cytogenetic Map6p21.1UniSTS
Cytogenetic Map5q13UniSTS
Cytogenetic Map8p21.2UniSTS
Cytogenetic Map20p11.23UniSTS
Cytogenetic Map6p24.3UniSTS
Cytogenetic Map3q12.2-q12.3UniSTS
Cytogenetic Map11p15.4UniSTS
Cytogenetic Map1q21.2-q21.3UniSTS
Cytogenetic Map18q21UniSTS
Cytogenetic Map12q24.2-q24.31UniSTS
Cytogenetic Map7p11.2UniSTS
Cytogenetic Map15q25.2UniSTS
Cytogenetic Map17q23.3UniSTS
Cytogenetic Map16q22UniSTS
Cytogenetic Map19p12UniSTS
Cytogenetic Map11q12-q13.1UniSTS
Cytogenetic Map11p11.2UniSTS
Cytogenetic Map9q21.33UniSTS
Cytogenetic Map19q13.41UniSTS
Cytogenetic Map11p15.1UniSTS
Cytogenetic Map5q12.3UniSTS
Cytogenetic Map18p11.2UniSTS
Cytogenetic Map19q13.3-q13.4UniSTS
Cytogenetic Map9q31.1UniSTS
Cytogenetic Map5q14.1UniSTS
Cytogenetic Map8p21.1UniSTS
Cytogenetic Map1q25.3UniSTS
Cytogenetic Map6p24-p22.3UniSTS
Cytogenetic Map17q12UniSTS
Cytogenetic Map2p13UniSTS
Cytogenetic Map7q31.1-q31.2UniSTS
Cytogenetic Map8q22.2UniSTS
Cytogenetic Map19p13.3UniSTS
Cytogenetic Map16q21UniSTS
Cytogenetic Map10q21UniSTS
Cytogenetic Map8q24.3UniSTS
Cytogenetic Map1p36.21UniSTS
Cytogenetic Map1p34.3UniSTS
Cytogenetic Map19p13.13UniSTS
Cytogenetic Map10q26.13UniSTS
Cytogenetic Map7q34UniSTS
Cytogenetic Map4q25-q27UniSTS
Cytogenetic Map9q34UniSTS
Cytogenetic Map1q44UniSTS
Cytogenetic Map15q15.3UniSTS
Cytogenetic Map4q28-q32UniSTS
Cytogenetic Map12q13.13UniSTS
Cytogenetic Map10q24.1UniSTS
Cytogenetic Map21q22.3UniSTS
Cytogenetic Map7p14.3UniSTS
Cytogenetic Map19q13.33UniSTS
Cytogenetic Map14q22.3UniSTS
Cytogenetic Map2p14UniSTS
Cytogenetic Map11q14.1UniSTS
Cytogenetic Map17p11.2UniSTS
Cytogenetic Map19q12UniSTS
Cytogenetic Map1p13.2UniSTS
Cytogenetic Map15q14UniSTS
Cytogenetic Map12p11.21UniSTS
Cytogenetic Map7q11.21UniSTS
Cytogenetic Map5q13.2UniSTS
Cytogenetic Map4p14UniSTS
Cytogenetic Map18q23UniSTS
Cytogenetic Map4p16.3UniSTS
Cytogenetic Map2q33.1UniSTS
Cytogenetic Map17p13UniSTS
Cytogenetic Map1p21.3UniSTS
Cytogenetic Map15q21.3UniSTS
Cytogenetic Map10q22.2UniSTS
Cytogenetic Map2q35UniSTS
Cytogenetic Map3q27.1UniSTS
Cytogenetic Map22q11.21UniSTS
Cytogenetic Map1p36.11UniSTS
Cytogenetic Map3p25.1UniSTS
Cytogenetic Map10q25-q26UniSTS
Cytogenetic Map11q13.2UniSTS
Cytogenetic Map19q13.43UniSTS
Cytogenetic Map11q13UniSTS
Cytogenetic Map17q21.2UniSTS
Cytogenetic Map5q33.1UniSTS
Cytogenetic Map7p14UniSTS
Cytogenetic Map17q25.3UniSTS
Cytogenetic Map2q31.1UniSTS
Cytogenetic Map16q22.1UniSTS
D8S2279  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map21q22.12UniSTS
Cytogenetic Map15q13UniSTS
Cytogenetic Map9q32UniSTS
Cytogenetic Map15q22.3UniSTS
Cytogenetic Map17p12UniSTS
Cytogenetic Map21q21.3UniSTS
Cytogenetic Map3p22-p21.3UniSTS
Cytogenetic Map1q21.1UniSTS
Cytogenetic Map2q24.2UniSTS
Cytogenetic Map17q24.2UniSTS
Cytogenetic Map1q32UniSTS
Cytogenetic Map3p25.3UniSTS
Cytogenetic Map20q13.3UniSTS
Cytogenetic Map2q31.1UniSTS
Cytogenetic Map1q21UniSTS
Cytogenetic Map3p14.1UniSTS
Cytogenetic Map2q37.3UniSTS
Cytogenetic Map7p14.1UniSTS
Cytogenetic Map2q22.3UniSTS
Cytogenetic Map15q13.2UniSTS
Cytogenetic Map12q24.1UniSTS
Cytogenetic Map7p15.2UniSTS
Cytogenetic Map5q31.2UniSTS
Cytogenetic Map2p25.2UniSTS
Cytogenetic Map3p24.3UniSTS
Cytogenetic Map17q25.3UniSTS
Cytogenetic Map15q22.31UniSTS
Cytogenetic Map5q14UniSTS
Cytogenetic Map5q31UniSTS
Cytogenetic Map1p36.32UniSTS
Cytogenetic Map1q42.12UniSTS
Cytogenetic Map7q21.11UniSTS
Cytogenetic Map9q34.2UniSTS
Cytogenetic Map19q13.3UniSTS
Cytogenetic Map22q13.33UniSTS
Cytogenetic Map8q22.3UniSTS
Cytogenetic Map6p21.1-p12UniSTS
Cytogenetic Map1p36.13UniSTS
Cytogenetic Map7q36.3UniSTS
Cytogenetic Map2p25.1UniSTS
Cytogenetic Map7p21.3UniSTS
Cytogenetic Map4q12UniSTS
Cytogenetic Map22q11.22UniSTS
Cytogenetic Map11p13UniSTS
Cytogenetic Map1q12UniSTS
Cytogenetic Map8p23UniSTS
Cytogenetic Map11q13.2-q13.3UniSTS
Cytogenetic Map13q14.1-q14.3UniSTS
Cytogenetic Map3q22-q24UniSTS
Cytogenetic Map3q13.1-q13.2UniSTS
Cytogenetic Map16q24UniSTS
Cytogenetic Map5q23.3-q31.1UniSTS
Cytogenetic Map8p21.3UniSTS
Cytogenetic Map14q32.3UniSTS
Cytogenetic Map7q11.23UniSTS
Cytogenetic Map7q32UniSTS
Cytogenetic Map14q32.33UniSTS
Cytogenetic Map19p13.2UniSTS
Cytogenetic Map9q34.3UniSTS
Cytogenetic Map1p32.3UniSTS
Cytogenetic Map17q11UniSTS
Cytogenetic Map17p13.1-p12UniSTS
Cytogenetic Map18q21.33UniSTS
Cytogenetic Map19p13.12UniSTS
Cytogenetic Map5q14.1UniSTS
Cytogenetic Map14q24.3UniSTS
Cytogenetic Map1q21-q23UniSTS
Cytogenetic MapXp11.23UniSTS
Cytogenetic Map4q21.1UniSTS
Cytogenetic Map12q13.13UniSTS
Cytogenetic Map14q23.3UniSTS
Cytogenetic Map17p12-p11.2UniSTS
Cytogenetic Map6p21.1UniSTS
Cytogenetic Map1q24UniSTS
Cytogenetic Map1q43UniSTS
Cytogenetic Map9q34.13UniSTS
Cytogenetic Map19q13.4UniSTS
Cytogenetic Map2q32UniSTS
Cytogenetic MapXp22.2UniSTS
Cytogenetic Map19p13.11UniSTS
Cytogenetic Map2q33UniSTS
Cytogenetic Map10p13UniSTS
Cytogenetic Map2q11.2UniSTS
Cytogenetic Map3q27UniSTS
Cytogenetic Map17q25.1UniSTS
Cytogenetic Map4p16.1UniSTS
Cytogenetic Map14q22.3UniSTS
Cytogenetic Map10q23-q24UniSTS
Cytogenetic Map2q37.1UniSTS
Cytogenetic Map17q12UniSTS
Cytogenetic Map14q31-q32UniSTS
Cytogenetic Map5p15.33UniSTS
Cytogenetic Map1q23.2UniSTS
Cytogenetic Map16q24.3UniSTS
Cytogenetic Map4p14UniSTS
Cytogenetic Map2q32.3UniSTS
Cytogenetic Map15q21.1UniSTS
Cytogenetic Map4q32.2UniSTS
Cytogenetic Map10q23UniSTS
Cytogenetic Map5q14.2UniSTS
Cytogenetic Map4q32.1UniSTS
Cytogenetic Map1q25.1UniSTS
Cytogenetic Map11q14.1UniSTS
Cytogenetic Map4p16.3UniSTS
Cytogenetic Map1p34.2UniSTS
Cytogenetic Map11q23.1UniSTS
Cytogenetic Map3p21.1UniSTS
Cytogenetic Map16q22.2UniSTS
Cytogenetic Map14q32.31UniSTS
Cytogenetic Map16q11.2UniSTS
Cytogenetic Map6q22UniSTS
Cytogenetic Map10p15.3UniSTS
Cytogenetic Map11q23UniSTS
Cytogenetic Map22q13.2UniSTS
Cytogenetic Map12q12UniSTS
Cytogenetic Map19q13.42UniSTS
Cytogenetic Map19q13.11UniSTS
Cytogenetic Map12q24.31UniSTS
Cytogenetic Map15q15UniSTS
Cytogenetic Map2q33.1UniSTS
Cytogenetic Map22q12.3UniSTS
Cytogenetic Map20q11UniSTS
Cytogenetic Map22q11.23UniSTS
Cytogenetic Map17q25UniSTS
Cytogenetic Map1p13.3UniSTS
Cytogenetic Map3p22.1UniSTS
Cytogenetic Map8q22.1UniSTS
Cytogenetic Map16q22.1UniSTS
Cytogenetic Map18p11.31UniSTS
Cytogenetic Map19p12UniSTS
Cytogenetic Map11q13.1UniSTS
Cytogenetic Map19p13.3UniSTS
Cytogenetic Map2p22.1UniSTS
Cytogenetic Map16p13.3UniSTS
Cytogenetic Map1p35.2UniSTS
Cytogenetic MapYp11.2UniSTS
Cytogenetic Map13q13.1UniSTS
Cytogenetic Map20q11.22UniSTS
Cytogenetic Map19q13.2UniSTS
Cytogenetic Map18q12UniSTS
Cytogenetic Map17q21.33UniSTS
Cytogenetic Map15q15.1UniSTS
Cytogenetic Map3q27.2UniSTS
Cytogenetic Map3q21.3UniSTS
Cytogenetic Map5p15.2UniSTS
Cytogenetic Map20q13.12UniSTS
Cytogenetic Map17q21UniSTS
Cytogenetic Map1q42UniSTS
Cytogenetic Map14q32.11UniSTS
Cytogenetic Map17q21.2-q21.3UniSTS
Cytogenetic Map5q32-q34UniSTS
Cytogenetic Map15q14UniSTS
Cytogenetic Map16q13UniSTS
Cytogenetic Map3q21.2UniSTS
Cytogenetic Map3p21.3UniSTS
Cytogenetic Map14q24.2UniSTS
Cytogenetic Map12q24.13UniSTS
Cytogenetic Map13q14.11UniSTS
Cytogenetic Map3q27.3UniSTS
Cytogenetic Map1q32.3UniSTS
Cytogenetic Map6p22.1UniSTS
Cytogenetic Map9q34.11UniSTS
Cytogenetic Map6q21UniSTS
Cytogenetic Map6q25.3UniSTS
Cytogenetic Map2p11.2UniSTS
Cytogenetic Map13q14.3UniSTS
Cytogenetic Map17q11.2UniSTS
Cytogenetic Map10p12UniSTS
Cytogenetic Map2q33.3UniSTS
Cytogenetic Map14q21.3UniSTS
Cytogenetic Map8p22-p21UniSTS
Cytogenetic Map18q11.2UniSTS
Cytogenetic Map2p15UniSTS
Cytogenetic Map17q22UniSTS
Cytogenetic Map12q21.33UniSTS
Cytogenetic Map20q13.32UniSTS
Cytogenetic Map1p34.1UniSTS
Cytogenetic Map10q26UniSTS
Cytogenetic Map8p23.1UniSTS
Cytogenetic Map19p13UniSTS
Cytogenetic Map7q21.13UniSTS
Cytogenetic Map7q31.1UniSTS
Cytogenetic Map1p33UniSTS
Cytogenetic Map21q22.3UniSTS
Cytogenetic Map1p35.1UniSTS
Cytogenetic Map22q12.2UniSTS
Cytogenetic Map9q22.3UniSTS
Cytogenetic Map8q13.1UniSTS
Cytogenetic Map3q25UniSTS
Cytogenetic Map1p36.33UniSTS
Cytogenetic Map20q13.33UniSTS
Cytogenetic Map1p31.3UniSTS
Cytogenetic Map14q31.1UniSTS
Cytogenetic Map22q13.1UniSTS
Cytogenetic Map12q13.2UniSTS
Cytogenetic Map22q13.31-q13.33UniSTS
Cytogenetic Map20q13.31UniSTS
Cytogenetic Map11p11.2UniSTS
Cytogenetic Map1q41UniSTS
Cytogenetic Map1p36.11UniSTS
Cytogenetic Map15q25.2UniSTS
Cytogenetic Map14q11.2UniSTS
Cytogenetic Map17q23.2UniSTS
Cytogenetic Map7q32.2UniSTS
Cytogenetic Map19q13.12UniSTS
Cytogenetic Map1q32.1UniSTS
Cytogenetic Map6q25.1UniSTS
Cytogenetic Map19q13.43UniSTS
Cytogenetic Map9p13.3UniSTS
Cytogenetic Map16p11.2UniSTS
Cytogenetic Map2p13.1UniSTS
Cytogenetic Map22q11.21UniSTS
Cytogenetic Map3q29UniSTS
Cytogenetic Map7p13UniSTS
Cytogenetic Map11q23.3UniSTS
Cytogenetic Map14q31-q32.1UniSTS
Cytogenetic Map1q42.11UniSTS
Cytogenetic Map4q35.1UniSTS
Cytogenetic Map2p23.3UniSTS
Cytogenetic Map2p13.3UniSTS
Cytogenetic MapXp11.3UniSTS
Cytogenetic Map2q11.2-q12.1UniSTS
Cytogenetic Map20q13.13UniSTS
Cytogenetic Map1p22UniSTS
Cytogenetic Map6q16.2UniSTS
Cytogenetic Map18q23UniSTS
Cytogenetic Map2q14UniSTS
Cytogenetic Map20p11.23-p11.21UniSTS
Cytogenetic Map16p12.2UniSTS
Cytogenetic Map8p11.23UniSTS
Cytogenetic Map19q13.1UniSTS
Cytogenetic Map19q13UniSTS
Cytogenetic Map8p11.21UniSTS
Cytogenetic Map12q14.3UniSTS
Cytogenetic MapXq26.3UniSTS
Cytogenetic Map8q24.11UniSTS
Cytogenetic Map10q23.1UniSTS
Cytogenetic Map1q44UniSTS
Cytogenetic Map9q22.33UniSTS
Cytogenetic Map3p21.31UniSTS
Cytogenetic Map17p13.2UniSTS
Cytogenetic Map9q21.32UniSTS
Cytogenetic Map7q34UniSTS
Cytogenetic Map9q33.3UniSTS
Cytogenetic Map1p36.1UniSTS
Cytogenetic Map20q12UniSTS
Cytogenetic Map4q21.23UniSTS
Cytogenetic Map5q13.2UniSTS
Cytogenetic Map22q12.1UniSTS
Cytogenetic Map5q31.1UniSTS
Cytogenetic Map2q21.3UniSTS
Cytogenetic Map7q21.2UniSTS
Cytogenetic Map17q22.2UniSTS
Cytogenetic Map17p13UniSTS
Cytogenetic Map12q24.11UniSTS
Cytogenetic Map18q21UniSTS
Cytogenetic Map10q11.1UniSTS
Cytogenetic Map22q11.2UniSTS
Cytogenetic Map19q12UniSTS
Cytogenetic Map7q34-q35UniSTS
Cytogenetic Map15q24.1UniSTS
Cytogenetic Map18p11.21UniSTS
Cytogenetic Map1q23.1UniSTS
Cytogenetic Map19q13.41UniSTS
Cytogenetic Map6p25.1-p23UniSTS
Cytogenetic Map11p15.4UniSTS
Cytogenetic Map10q22UniSTS
Cytogenetic Map5q35.3UniSTS
Cytogenetic Map18q12.1-q21.1UniSTS
Cytogenetic Map12p13.1UniSTS
Cytogenetic Map13q12.1UniSTS
Cytogenetic Map12q15UniSTS
Cytogenetic Map6p21.32UniSTS
Cytogenetic Map8q24.3UniSTS
Cytogenetic Map10p14UniSTS
Cytogenetic Map12p13.1-p12.3UniSTS
Cytogenetic Map3p25.2UniSTS
Cytogenetic Map6p21.33UniSTS
Cytogenetic Map6p21.3UniSTS
Cytogenetic Map3p21.2UniSTS
Cytogenetic Map10q26.3UniSTS
Cytogenetic Map1q21.3UniSTS
Cytogenetic MapXp21.2UniSTS
Cytogenetic Map7q22.1UniSTS
Cytogenetic Map14q12UniSTS
Cytogenetic Map8p11.22UniSTS
Cytogenetic Map19q13.32UniSTS
Cytogenetic Map2q21.1UniSTS
Cytogenetic Map9q21.12UniSTS
Cytogenetic Map15q23UniSTS
Cytogenetic Map7p22.2UniSTS
Cytogenetic Map8p21.2UniSTS
Cytogenetic Map7q33UniSTS
Cytogenetic Map15q15.3UniSTS
Cytogenetic Map4q21.22UniSTS
Cytogenetic Map12q13.12UniSTS
Cytogenetic Map10q24.31UniSTS
Cytogenetic Map12p13.31UniSTS
Cytogenetic Map14q32.12UniSTS
Cytogenetic Map10q24.32UniSTS
Cytogenetic Map11q12.3UniSTS
Cytogenetic Map16p12.3UniSTS
Cytogenetic Map1p34.3UniSTS
Cytogenetic Map1p36.21UniSTS
Cytogenetic Map2q24.3UniSTS
Cytogenetic Map2q33.2UniSTS
Cytogenetic Map16q24.1UniSTS
Cytogenetic Map1p31.1UniSTS
Cytogenetic Map19q13.33UniSTS
Cytogenetic Map1p36.31UniSTS
Cytogenetic Map3q13.31UniSTS
Cytogenetic Map15q22.2UniSTS
Cytogenetic Map5q32UniSTS
Cytogenetic Map6q13UniSTS
Cytogenetic MapXq24UniSTS
Cytogenetic Map6q25UniSTS
Cytogenetic Map6p21UniSTS
Cytogenetic Map2q35UniSTS
Cytogenetic Map12p13-p12UniSTS
Cytogenetic Map9p13.2UniSTS
Cytogenetic Map6p22UniSTS
Cytogenetic Map2q12.1UniSTS
Cytogenetic Map17p13.3UniSTS
Cytogenetic Map9q22.2UniSTS
Cytogenetic Map1q22UniSTS
Cytogenetic Map1p22.1UniSTS
Cytogenetic Map1p36UniSTS
Cytogenetic Map9q13-q21UniSTS
Cytogenetic Map11p15.5UniSTS
Cytogenetic MapXp11.2UniSTS
Cytogenetic Map19pUniSTS
Cytogenetic Map19p13.1-p12UniSTS
Cytogenetic Map7q22UniSTS
Cytogenetic Map12q24.33UniSTS
Cytogenetic Map3q21UniSTS
Cytogenetic Map8q24UniSTS
Cytogenetic Map18p11.31-p11.21UniSTS
Cytogenetic Map11p15.3-p15.1UniSTS
Cytogenetic Map11q13UniSTS
Cytogenetic Map8q22UniSTS
Cytogenetic Map4p15.1UniSTS
Cytogenetic Map1q25.2UniSTS
Cytogenetic Map2p16.3UniSTS
Cytogenetic Map16p13.12UniSTS
Cytogenetic Map7p21.2UniSTS
Cytogenetic Map12q21.1UniSTS
Cytogenetic Map2p14UniSTS
Cytogenetic Map6q24.3UniSTS
Cytogenetic Map10q22.2UniSTS
Cytogenetic Map5q23.1UniSTS
Cytogenetic Map10q23.2UniSTS
Cytogenetic Map7p22.3UniSTS
Cytogenetic Map21q22.2UniSTS
Cytogenetic Map6q22.1UniSTS
Cytogenetic Map1q42.1UniSTS
Cytogenetic Map1q25UniSTS
Cytogenetic Map6p22.3UniSTS
Cytogenetic Map1q21.2UniSTS
Cytogenetic Map15q22.1UniSTS
Cytogenetic Map12p13.2UniSTS
Cytogenetic Map12q22UniSTS
Cytogenetic Map3p21-p12UniSTS
Cytogenetic Map4q35UniSTS
Cytogenetic Map1p34-p33UniSTS
Cytogenetic Map21q22.11UniSTS
Cytogenetic Map3p22-p21.33UniSTS
Cytogenetic Map3q23UniSTS
Cytogenetic Map3q22.1UniSTS
Cytogenetic Map8q21.11UniSTS
Cytogenetic MapXq22.3UniSTS
Cytogenetic Map7p14UniSTS
Cytogenetic Map17q21.1UniSTS
Cytogenetic Map15q21UniSTS
Cytogenetic Map1q42.3UniSTS
Cytogenetic Map9q22UniSTS
Cytogenetic Map2q12.3UniSTS
Cytogenetic Map20q11.2-q13.2UniSTS
Cytogenetic Map17q21.31UniSTS
Cytogenetic Map17q24UniSTS
Cytogenetic Map3q25.31UniSTS
Cytogenetic Map6p24.3UniSTS
Cytogenetic Map2q31.3UniSTS
Cytogenetic Map1q31UniSTS
Cytogenetic Map7q32-q33UniSTS
Cytogenetic Map7q21.1UniSTS
Cytogenetic Map14q23-q24.2UniSTS
Cytogenetic Map19q13.3-q13.4UniSTS
Cytogenetic Map2p24-p21UniSTS
Cytogenetic Map15q11.2UniSTS
Cytogenetic Map15q26.3UniSTS
Cytogenetic Map7p22UniSTS
Cytogenetic Map12p11UniSTS
Cytogenetic Map1p35.3UniSTS
Cytogenetic Map1p12UniSTS
Cytogenetic Map13q32.3UniSTS
Cytogenetic Map5q23.3UniSTS
Cytogenetic Map20q13UniSTS
Cytogenetic Map17q25.2UniSTS
Cytogenetic Map7q36.1UniSTS
Cytogenetic Map10p12.33UniSTS
Cytogenetic Map17q21.32UniSTS
Cytogenetic MapXp11.22UniSTS
Cytogenetic Map12p13.3UniSTS
Cytogenetic MapXq25-q26UniSTS
Cytogenetic Map2q36.1UniSTS
Cytogenetic Map5p13UniSTS
Cytogenetic Map15q25UniSTS
Cytogenetic Map5q12.1UniSTS
Cytogenetic Map5p12UniSTS
Cytogenetic Map1p36.22UniSTS
Cytogenetic Map3q26.31UniSTS
Cytogenetic Map17q22-q23UniSTS
Cytogenetic MapXp22.33UniSTS
Cytogenetic MapYp11.3UniSTS
Cytogenetic Map17p11.2UniSTS
Cytogenetic MapXq13.2UniSTS
Cytogenetic Map12q23.1UniSTS
Cytogenetic Map16q12.2UniSTS
Cytogenetic Map3q26.32UniSTS
Cytogenetic Map6q22.31UniSTS
Cytogenetic Map3q26.2-q27UniSTS
Cytogenetic Map1q25.1-q25.2UniSTS
Cytogenetic Map14q24UniSTS
Cytogenetic Map9q21.13UniSTS
Cytogenetic Map10q11.22UniSTS
Cytogenetic Map22q13.31UniSTS
Cytogenetic Map3p25.1UniSTS
Cytogenetic Map5q21.3UniSTS
Cytogenetic Map5p13.3UniSTS
Cytogenetic Map10q22.1UniSTS
Cytogenetic Map14q12-q13UniSTS
Cytogenetic MapXp22UniSTS
Cytogenetic MapXq23UniSTS
Cytogenetic Map20p12.3-p11.21UniSTS
Cytogenetic Map2p21UniSTS
Cytogenetic Map17q11.2-q12UniSTS
Cytogenetic Map4q32-q34UniSTS
Cytogenetic MapXq25-q26.1UniSTS
Cytogenetic Map2p25-p24UniSTS
Cytogenetic Map2p25UniSTS
Cytogenetic Map11q13.2UniSTS
Cytogenetic MapXp22.2-p22.1UniSTS
Cytogenetic MapXq22.1UniSTS
Cytogenetic Map4q25UniSTS
Cytogenetic Map3p24.2UniSTS
Cytogenetic Map22q13UniSTS
Cytogenetic Map20q11.22-q12UniSTS
Cytogenetic Map4q34.2UniSTS
Cytogenetic Map20p13UniSTS
Cytogenetic Map22q13.1-q13.2UniSTS
Cytogenetic MapXq28UniSTS
Cytogenetic Map12q13-q14UniSTS
Cytogenetic Map6q14.1UniSTS
Cytogenetic Map12q13.3UniSTS
Cytogenetic Map9q31.2UniSTS
Cytogenetic Map11q13.1-q13.2UniSTS
Cytogenetic Map12q13UniSTS
Cytogenetic Map1p32-p31UniSTS
Cytogenetic Map21q21.2UniSTS
Cytogenetic Map10q24.3UniSTS
Cytogenetic Map16q21UniSTS
Cytogenetic Map8q21.1UniSTS
Cytogenetic Map5p13.2UniSTS
Cytogenetic Map1p34UniSTS
Cytogenetic Map1q32.2UniSTS
Cytogenetic Map4q21.3UniSTS
Cytogenetic Map7q21-q22UniSTS
Cytogenetic Map3q26.2UniSTS
Cytogenetic Map2q36.3UniSTS
Cytogenetic Map8p22UniSTS
Cytogenetic Map11q22.1UniSTS
Cytogenetic Map3q25.33UniSTS
Cytogenetic Map10q23.31UniSTS
Cytogenetic Map4p15.32UniSTS
Cytogenetic Map18q12.2UniSTS
Cytogenetic Map15q15.2UniSTS
Cytogenetic Map5q12.3UniSTS
Cytogenetic Map14q24.1UniSTS
Cytogenetic Map12q14.1UniSTS
Cytogenetic Map6p22.3-p22.1UniSTS
Cytogenetic Map7p11.2UniSTS
Cytogenetic Map6q15UniSTS
Cytogenetic Map6q23.3UniSTS
Cytogenetic Map13q14UniSTS
Cytogenetic Map5q35.2UniSTS
Cytogenetic Map10q22.3UniSTS
Cytogenetic Map1p35UniSTS
Cytogenetic Map3q12.3UniSTS
Cytogenetic Map19q13.31UniSTS
Cytogenetic Map8q23.1UniSTS
Cytogenetic Map6q27UniSTS
Cytogenetic Map2q14.3UniSTS
Cytogenetic MapXp11UniSTS
Cytogenetic Map11p15.3UniSTS
Cytogenetic Map20p12UniSTS
Cytogenetic Map15q13.1UniSTS
Cytogenetic MapXp22.3UniSTS
Cytogenetic Map11q13.5UniSTS
Cytogenetic Map19p13.3-p13.2UniSTS
Cytogenetic Map1p36.11-p34.2UniSTS
Cytogenetic Map4q22.1-q23UniSTS
Cytogenetic Map7q22.3UniSTS
Cytogenetic Map9p22UniSTS
Cytogenetic Map17q23.3UniSTS
Cytogenetic Map16q23.2UniSTS
Cytogenetic Map2p16.1UniSTS
Cytogenetic Map3q27.1UniSTS
Cytogenetic Map2p22.3UniSTS
Cytogenetic MapXq26.1UniSTS
Cytogenetic Map4q21.21UniSTS
Cytogenetic Map22q13.3UniSTS
Cytogenetic Map2q32.1UniSTS
Cytogenetic MapYp11.32UniSTS
Cytogenetic Map11p14UniSTS
Cytogenetic Map1p32.1UniSTS
Cytogenetic Map2p25.3UniSTS
Cytogenetic Map4q34.3UniSTS
Cytogenetic Map9p12UniSTS
Cytogenetic Map3q13.13UniSTS
Cytogenetic Map13q34UniSTS
Cytogenetic Map3p21UniSTS
Cytogenetic Map11q23.2UniSTS
Cytogenetic Map20p11.23UniSTS
Cytogenetic Map3p13UniSTS
Cytogenetic Map4p13UniSTS
Cytogenetic Map16q23.1UniSTS
Cytogenetic Map10p11.23UniSTS
Cytogenetic Map8p21.1UniSTS
Cytogenetic Map15q22-q24UniSTS
Cytogenetic Map8q23UniSTS
Cytogenetic Map16q12.1UniSTS
Cytogenetic Map14q13.2UniSTS
Cytogenetic Map18q12.1UniSTS
Cytogenetic Map5q31.3UniSTS
Cytogenetic Map11q14UniSTS
Cytogenetic Map13q33.1UniSTS
Cytogenetic Map14q21.2UniSTS
Cytogenetic Map4q31.3UniSTS
Cytogenetic Map15q21-q22UniSTS
Cytogenetic Map3p14.3UniSTS
Cytogenetic Map17p13.1UniSTS
Cytogenetic Map13q12.11UniSTS
Cytogenetic Map6p21.2UniSTS
Cytogenetic Map15q21.3UniSTS
Cytogenetic Map3q21.1UniSTS
Cytogenetic Map6p21.31UniSTS
Cytogenetic Map10p15.1UniSTS
Cytogenetic Map1q24.2UniSTS
Cytogenetic Map12p12UniSTS
Cytogenetic Map7p22.1UniSTS
Cytogenetic Map11q24UniSTS
Cytogenetic Map21q22.13UniSTS
Cytogenetic Map15q22.1-q22.31UniSTS
Cytogenetic Map15q22UniSTS
Cytogenetic MapXq13UniSTS
Cytogenetic Map1q31-q41UniSTS
Cytogenetic Map6p25UniSTS
Cytogenetic Map14q32.1UniSTS
Cytogenetic Map16q12-q13UniSTS
Cytogenetic MapXq12-q13UniSTS
Cytogenetic Map14q23UniSTS
Cytogenetic Map12q11-q12UniSTS
Cytogenetic Map1q42.1-q43UniSTS
Cytogenetic Map3q13.33UniSTS
Cytogenetic Map7q31UniSTS
Cytogenetic Map12q24UniSTS
Cytogenetic MapXp22.11UniSTS
Cytogenetic Map11q13.4UniSTS
Cytogenetic Map2p25.1-p24.1UniSTS
Cytogenetic Map8q24.21UniSTS
Cytogenetic Map12q13.1UniSTS
Cytogenetic Map12q22-q23.1UniSTS
Cytogenetic Map11q12.2UniSTS
Cytogenetic Map1p13.2UniSTS
Cytogenetic Map5q31.2-q34UniSTS
Cytogenetic Map11p15.1UniSTS
Cytogenetic Map6q24.2UniSTS
Cytogenetic Map22qUniSTS
Cytogenetic Map12q13.11-q14.3UniSTS
Cytogenetic Map7p11UniSTS
Cytogenetic MapXp22.12-p22.11UniSTS
Cytogenetic Map7q11.21UniSTS
Cytogenetic Map20q11.22-q11.23UniSTS
Cytogenetic Map8q24.22UniSTS
Cytogenetic Map8p22-p21.3UniSTS
Cytogenetic Map10q24UniSTS
Cytogenetic Map1q21.2-q21.3UniSTS
Cytogenetic Map1p36.12UniSTS
Cytogenetic Map9p24.1UniSTS
Cytogenetic Map6q25.2-q27UniSTS
Cytogenetic Map9q34UniSTS
Cytogenetic Map5p13.1UniSTS
Cytogenetic Map8q11.2UniSTS
Cytogenetic Map3q28-q29UniSTS
Cytogenetic Map7p14-p13UniSTS
Cytogenetic Map12q24.2UniSTS
Cytogenetic Map6p22.2UniSTS
Cytogenetic Map7q22-qterUniSTS
Cytogenetic Map12q24.2-q24.31UniSTS
Cytogenetic MapXq13.1UniSTS
Cytogenetic Map6p25.2UniSTS
Cytogenetic Map1p21UniSTS
Cytogenetic Map1q32.2-q41UniSTS
Cytogenetic Map11q22-q23UniSTS
Cytogenetic Map3q26.33UniSTS
Cytogenetic Map12q23-q24.1UniSTS
Cytogenetic Map5p15.1-p14.3UniSTS
Cytogenetic Map16p13.11UniSTS
Cytogenetic Map6q22-q23UniSTS
Cytogenetic Map9p21UniSTS
Cytogenetic Map6p12.3UniSTS
Cytogenetic Map3p12.1UniSTS
Cytogenetic Map9q21.11UniSTS
Cytogenetic Map17q24.1UniSTS
Cytogenetic Map10q11.21UniSTS
Cytogenetic Map14q21UniSTS
Cytogenetic Map11p15UniSTS
Cytogenetic Map16q22UniSTS
Cytogenetic Map15q11-q13UniSTS
Cytogenetic Map13q12-q14UniSTS
Cytogenetic Map18q21.1UniSTS
Cytogenetic Map2q24UniSTS
Cytogenetic Map12p13UniSTS
Cytogenetic Map3q28UniSTS
Cytogenetic Map7q32.1UniSTS
Cytogenetic MapXq22.2UniSTS
Cytogenetic Map7p12.3UniSTS
Cytogenetic Map7p15.1UniSTS
Cytogenetic Map2q37.2UniSTS
Cytogenetic Map18q22.3UniSTS
Cytogenetic Map14q32.13UniSTS
Cytogenetic Map14q22.1UniSTS
Cytogenetic Map16p13.1UniSTS
Cytogenetic Map7q31.3UniSTS
Cytogenetic Map20q13.2-q13.3UniSTS
Cytogenetic Map1p21.2UniSTS
Cytogenetic Map9q21.33UniSTS
Cytogenetic Map14q32.2UniSTS
Cytogenetic Map13q13.3UniSTS
Cytogenetic Map10p12.31UniSTS
Cytogenetic Map22q11.1UniSTS
Cytogenetic Map5q33.2UniSTS
Cytogenetic Map13q32.2UniSTS
Cytogenetic Map14q23.1UniSTS
Cytogenetic Map8q21.2UniSTS
Cytogenetic Map2q24.1UniSTS
Cytogenetic Map10q26.13UniSTS
Cytogenetic Map2q23.3UniSTS
Cytogenetic Map19p13.1UniSTS
Cytogenetic Map15q14-q15UniSTS
Cytogenetic Map1q42.13UniSTS
Cytogenetic Map14q31UniSTS
Cytogenetic Map7p21.1UniSTS
Cytogenetic Map8p12-p11UniSTS
Cytogenetic Map18p11.2UniSTS
Cytogenetic Map7p11.1UniSTS
Cytogenetic Map1q31-q32UniSTS
Cytogenetic Map2q12UniSTS
Cytogenetic Map3p21.32UniSTS
Cytogenetic Map2p24.2UniSTS
Cytogenetic Map2q33-q34UniSTS
Cytogenetic Map6q24.1UniSTS
Cytogenetic Map4q22.1UniSTS
Cytogenetic Map15q13.3UniSTS
Cytogenetic Map10q26.11UniSTS
Cytogenetic Map7p15.3UniSTS
Cytogenetic Map10q23.33UniSTS
Cytogenetic Map12p12.1UniSTS
Cytogenetic Map7p13-p12UniSTS
Cytogenetic MapXq25UniSTS
Cytogenetic Map17q11-q21UniSTS
Cytogenetic Map12q23UniSTS
Cytogenetic Map6p24-p22.3UniSTS
Cytogenetic Map14q23.2UniSTS
Cytogenetic Map7q31.1-q31.2UniSTS
Cytogenetic Map8q22.2UniSTS
Cytogenetic Map15q21.2UniSTS
Cytogenetic Map3p26.1-p25.1UniSTS
Cytogenetic Map5q35UniSTS
Cytogenetic Map3q13.2UniSTS
Cytogenetic Map4p15.2UniSTS
Cytogenetic Map6q16.3UniSTS
Cytogenetic Map17q24-q25UniSTS
Cytogenetic MapXq12UniSTS
Cytogenetic MapXq27.1UniSTS
Cytogenetic Map8q12.3UniSTS
Cytogenetic Map5q21.2UniSTS
Cytogenetic Map5q15UniSTS
Cytogenetic Map5q35.1UniSTS
Cytogenetic Map4q13.3UniSTS
Cytogenetic Map4q35.2UniSTS
Cytogenetic Map3p26.1UniSTS
Cytogenetic Map3p11.1UniSTS
Cytogenetic Map17q21.2UniSTS
Cytogenetic Map2q21.2UniSTS
Cytogenetic Map19p13.13UniSTS
Cytogenetic Map18q12.3UniSTS
Cytogenetic Map18p11.3UniSTS
Cytogenetic Map17q11.1UniSTS
Cytogenetic Map15q25.1UniSTS
Cytogenetic Map13q12.3UniSTS
Cytogenetic Map12q23.2UniSTS
Cytogenetic Map12q12-q13UniSTS
Cytogenetic Map12q14UniSTS
Cytogenetic Map5q33.1UniSTS
Cytogenetic Map2q32-q34UniSTS
Cytogenetic Map16q22.3UniSTS
Cytogenetic Map2p15-p13UniSTS
Cytogenetic MapXp11.4UniSTS
Cytogenetic Map19q13.33-q13.41UniSTS
Cytogenetic Map20p11UniSTS
Cytogenetic Map6q23-q24UniSTS
Cytogenetic Map2p12UniSTS
Cytogenetic Map2p13UniSTS
Cytogenetic Map13q11-q12UniSTS
Cytogenetic Map6p12.3-p11.2UniSTS
Cytogenetic Map6q16.1-q16.3UniSTS
Cytogenetic Map22q11UniSTS
Cytogenetic Map7q31.2UniSTS
Cytogenetic Map10q21.3UniSTS
Cytogenetic Map3q25.2UniSTS
Cytogenetic Map3p21.1-p14.3UniSTS
Cytogenetic Map6p12.1UniSTS
Cytogenetic Map3q23-q24UniSTS
Cytogenetic Map3q12UniSTS
Cytogenetic Map7q11.1UniSTS
Cytogenetic Map3q22.3UniSTS
Cytogenetic Map7q21.3UniSTS
Cytogenetic Map4q31.1UniSTS
Cytogenetic Map22q12-q13UniSTS
Cytogenetic Map4q23UniSTS
Cytogenetic MapXp22.12UniSTS
Cytogenetic Map6q16.1UniSTS
Cytogenetic Map13q14.13UniSTS
Cytogenetic Map18q21.3UniSTS
Cytogenetic Map9q33.2UniSTS
Cytogenetic Map11q21UniSTS
Cytogenetic Map8q12UniSTS
Cytogenetic Map4q28-q32UniSTS
Cytogenetic Map17q24.3UniSTS
Cytogenetic Map6p23UniSTS
Cytogenetic Map8p11UniSTS
Cytogenetic Map5q34UniSTS
Cytogenetic Map1q24.3UniSTS
Cytogenetic Map9q33.1UniSTS
Cytogenetic Map1q23.3UniSTS
Cytogenetic Map2p16.2UniSTS
Cytogenetic Map9q22.31UniSTS
Cytogenetic Map9p24.3UniSTS
Cytogenetic Map7q35UniSTS
Cytogenetic Map1p36.2UniSTS
Cytogenetic Map11q22.3UniSTS
Cytogenetic Map16p12UniSTS
Cytogenetic Map1q22-q23UniSTS
Cytogenetic Map13q22.1UniSTS
Cytogenetic Map2q12.2UniSTS
Cytogenetic Map8p12UniSTS
Cytogenetic Map4q21UniSTS
Cytogenetic Map13q12.2UniSTS
Cytogenetic Map9q31-q33UniSTS
Cytogenetic Map6p24.1UniSTS
Cytogenetic Map1q23UniSTS
Cytogenetic Map11q12-q13UniSTS
Cytogenetic Map11q13.3UniSTS
Cytogenetic Map11q24.2UniSTS
Cytogenetic Map11q12.1UniSTS
Cytogenetic Map3p26UniSTS
Cytogenetic Map5q13UniSTS
Cytogenetic Map8p21UniSTS
Cytogenetic Map19q13.1-q13.2UniSTS
Cytogenetic Map1p33-p32UniSTS
Cytogenetic Map7q36.2UniSTS
Cytogenetic Map4q32.3UniSTS
Cytogenetic Map16p13.2UniSTS
Cytogenetic Map14q32UniSTS
Cytogenetic Map10q11.23UniSTS
Cytogenetic Map10q26.1UniSTS
Cytogenetic Map9q32-q33.3UniSTS
Cytogenetic Map9q22.1-q22.2UniSTS
Cytogenetic Map3q26.1-q26.2UniSTS
Cytogenetic Map5q31-q34UniSTS
Cytogenetic Map9q33-q34UniSTS
Cytogenetic Map5q11.2-q13.2UniSTS
Cytogenetic Map13q32UniSTS
Cytogenetic Map9q22.32UniSTS
Cytogenetic Map1p36.3UniSTS
Cytogenetic Map1p36.3-p36.2UniSTS
Cytogenetic Map4q28.1UniSTS
Cytogenetic Map5q22UniSTS
Cytogenetic Map12p11.21UniSTS
Cytogenetic MapXq13.3UniSTS
Cytogenetic Map9q31.3UniSTS
Cytogenetic Map3p26.3UniSTS
Cytogenetic Map2q11.1UniSTS
Cytogenetic Map21q11.2UniSTS
Cytogenetic Map18q21.32UniSTS
Cytogenetic Map15q26.2UniSTS
Cytogenetic Map12q24.23UniSTS
Cytogenetic Map10q25.3UniSTS
Cytogenetic Map20q11.23UniSTS
Cytogenetic Map20p12.1UniSTS
Cytogenetic Map2q31.1-q31.2UniSTS
Cytogenetic MapXp22.31UniSTS
Cytogenetic MapXp21.3UniSTS
Cytogenetic Map5q33.3UniSTS
Cytogenetic Map4q28.2UniSTS
Cytogenetic Map3p14.2UniSTS
Cytogenetic Map3q24UniSTS
Cytogenetic Map2q13UniSTS
Cytogenetic Map20q13.2UniSTS
Cytogenetic Map14q11.2-q12UniSTS
Cytogenetic Map3p24UniSTS
Cytogenetic Map12q23.3UniSTS
Cytogenetic Map11q24.3UniSTS
Cytogenetic Map11q14.3UniSTS
Cytogenetic Map10q25.2UniSTS
Cytogenetic Map3q25.1UniSTS
Cytogenetic Map8q13UniSTS
Cytogenetic Map1p22.2UniSTS
Cytogenetic Map3p22.3UniSTS
Cytogenetic Map18q11.1UniSTS
Cytogenetic Map8q23.3UniSTS
Cytogenetic Map15q24UniSTS
Cytogenetic Map11cen-q12UniSTS
Cytogenetic Map11q25UniSTS
Cytogenetic Map3p22.2UniSTS
Cytogenetic MapXp21.1UniSTS
Cytogenetic Map7q36UniSTS
Cytogenetic Map7p14.3UniSTS
Cytogenetic Map12q21UniSTS
Cytogenetic Map7p15UniSTS
Cytogenetic Map7q22-q31UniSTS
Cytogenetic Map11q22UniSTS
Cytogenetic Map5p15.3UniSTS
Cytogenetic Map20q13.3-qterUniSTS
Cytogenetic Map1p35-p34UniSTS
Cytogenetic Map4p13-p12UniSTS
Cytogenetic Map10q21-q22UniSTS
Cytogenetic Map4q22UniSTS
Cytogenetic Map7p13-p11.1UniSTS
Cytogenetic Map9q31-q34UniSTS
Cytogenetic Map7q21.1-q22UniSTS
Cytogenetic Map15q26.1UniSTS
Cytogenetic Map3q13.13-q13.2UniSTS
Cytogenetic MapXp22.13UniSTS
Cytogenetic Map13q12.12UniSTS
Cytogenetic Map13q14.2UniSTS
Cytogenetic Map12qUniSTS
Cytogenetic Map1pUniSTS
Cytogenetic Map16pUniSTS
Cytogenetic Map15qUniSTS
Cytogenetic Map7qUniSTS
Cytogenetic Map2qUniSTS
Cytogenetic Map5q13.1UniSTS
Cytogenetic Map11p14.1UniSTS
Cytogenetic Map4q32UniSTS
Cytogenetic Map2p22UniSTS
Cytogenetic Map5q14.3UniSTS
Cytogenetic Map10p12.1UniSTS
Cytogenetic Map5q23.2UniSTS
Cytogenetic Map2p24.1UniSTS
Cytogenetic Map8q24.13UniSTS
Cytogenetic Map12p13.32UniSTS
Cytogenetic Map9p21.1UniSTS
Cytogenetic Map9q34.2-q34.3UniSTS
D10S16  
Human AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map3p24.2UniSTS
Cytogenetic Map21q21.3UniSTS
Cytogenetic Map1p36.33UniSTS
Cytogenetic Map16q24.1UniSTS
Cytogenetic Map5q31UniSTS
Cytogenetic Map17p11.2UniSTS
Cytogenetic Map11q24.2UniSTS
Cytogenetic Map5q23.3-q31.1UniSTS
Cytogenetic Map7q32UniSTS
Cytogenetic Map1q21-q23UniSTS
Cytogenetic MapXp11.23UniSTS
Cytogenetic Map2q11.2-q12UniSTS
Cytogenetic Map7p13UniSTS
Cytogenetic Map19q13.4UniSTS
Cytogenetic Map17q25.1UniSTS
Cytogenetic Map1p36.21UniSTS
Cytogenetic Map3p22UniSTS
Cytogenetic Map19p13.2UniSTS
Cytogenetic Map2p12UniSTS
Cytogenetic Map19q13.12UniSTS
Cytogenetic Map9p13.3-p12UniSTS
Cytogenetic Map3p21.1UniSTS
Cytogenetic Map5p13.1UniSTS
Cytogenetic Map14q24.3UniSTS
Cytogenetic Map2p25.2UniSTS
Cytogenetic Map5q21-q22UniSTS
Cytogenetic Map2p22.1UniSTS
Cytogenetic Map1q32.3UniSTS
Cytogenetic Map1p36.11UniSTS
Cytogenetic Map18q12UniSTS
Cytogenetic Map19q13.41UniSTS
Cytogenetic Map17q21UniSTS
Cytogenetic Map3q27.3UniSTS
Cytogenetic Map2q37.3UniSTS
Cytogenetic Map19p13.3UniSTS
Cytogenetic Map2p15UniSTS
Cytogenetic Map20q13.32UniSTS
Cytogenetic Map10q26UniSTS
Cytogenetic Map19q13.3UniSTS
Cytogenetic Map7q21.13UniSTS
Cytogenetic Map1p33UniSTS
Cytogenetic Map1p35.1UniSTS
Cytogenetic Map9q22.3UniSTS
Cytogenetic Map17q11.2UniSTS
Cytogenetic Map12q13.2UniSTS
Cytogenetic Map22q13.31-q13.33UniSTS
Cytogenetic Map1q24.1UniSTS
Cytogenetic Map7q32.2UniSTS
Cytogenetic Map19q13.43UniSTS
Cytogenetic Map1q42.11UniSTS
Cytogenetic Map19p13.11UniSTS
Cytogenetic Map12q24.31UniSTS
Cytogenetic Map19p13.1UniSTS
Cytogenetic Map11q13.5UniSTS
Cytogenetic Map11q24UniSTS
Cytogenetic Map2q11.2-q12.1UniSTS
Cytogenetic Map3q21.2UniSTS
Cytogenetic Map19q13.1UniSTS
Cytogenetic Map19p13UniSTS
Cytogenetic Map8p11.21UniSTS
Cytogenetic Map17p13.2UniSTS
Cytogenetic Map16p13.3UniSTS
Cytogenetic Map20q12UniSTS
Cytogenetic Map2q13UniSTS
Cytogenetic Map5q31.1UniSTS
Cytogenetic Map17q22.2UniSTS
Cytogenetic Map18q21UniSTS
Cytogenetic Map11q14.2UniSTS
Cytogenetic Map16q22.1UniSTS
Cytogenetic Map4q34UniSTS
Cytogenetic Map2p22-p21UniSTS
Cytogenetic Map10q26.3UniSTS
Cytogenetic Map7q22.1UniSTS
Cytogenetic Map11q13.4UniSTS
Cytogenetic Map2q37.1UniSTS
Cytogenetic Map17q21.31UniSTS
Cytogenetic Map1p36.23UniSTS
Cytogenetic Map7p22.2UniSTS
Cytogenetic Map12q24.13UniSTS
Cytogenetic Map8p21.2UniSTS
Cytogenetic Map22q13.33UniSTS
Cytogenetic Map14q32.12UniSTS
Cytogenetic Map2q31.1UniSTS
Cytogenetic Map1p36.31UniSTS
Cytogenetic Map1p32.3UniSTS
Cytogenetic MapXq26.3UniSTS
Cytogenetic Map8p23.1UniSTS
Cytogenetic Map6q13UniSTS
Cytogenetic Map3p21.31UniSTS
Cytogenetic Map9p13.2UniSTS
Cytogenetic Map17q25UniSTS
Cytogenetic Map9q22.2UniSTS
Cytogenetic Map14q32.33UniSTS
Cytogenetic Map1q21.3UniSTS
Cytogenetic Map13q12.11UniSTS
Cytogenetic Map16p13.13UniSTS
Cytogenetic Map11p15.4UniSTS
Cytogenetic Map7q22UniSTS
Cytogenetic Map3q21UniSTS
Cytogenetic Map11q12.3UniSTS
Cytogenetic Map22q13UniSTS
Cytogenetic Map4p16.3UniSTS
Cytogenetic Map11p15.3-p15.1UniSTS
Cytogenetic Map11q13UniSTS
Cytogenetic Map22q11.21UniSTS
Cytogenetic Map10q22.2UniSTS
Cytogenetic Map17p13.3UniSTS
Cytogenetic Map7p22.3UniSTS
Cytogenetic Map3p21UniSTS
Cytogenetic MapXp22.3UniSTS
Cytogenetic Map1q42.3UniSTS
Cytogenetic Map18q11.2UniSTS
Cytogenetic Map6p24.3UniSTS
Cytogenetic Map7q34UniSTS
Cytogenetic Map16p11.2UniSTS
Cytogenetic Map1q25UniSTS
Cytogenetic Map15q11.2UniSTS
Cytogenetic Map19p13.12UniSTS
Cytogenetic Map3q26UniSTS
Cytogenetic Map12p12.1-p11.2UniSTS
Cytogenetic Map11q23.1UniSTS
Cytogenetic Map13q14.11UniSTS
Cytogenetic Map22q13.1UniSTS
Cytogenetic Map7p15.2UniSTS
Cytogenetic Map1q21UniSTS
Cytogenetic Map10q11.22UniSTS
Cytogenetic Map5p12UniSTS
Cytogenetic Map6q21UniSTS
Cytogenetic Map9q21.13UniSTS
Cytogenetic Map5q13.2UniSTS
Cytogenetic Map19q13.2UniSTS
Cytogenetic MapXq23UniSTS
Cytogenetic Map2p21UniSTS
Cytogenetic Map22q11.1UniSTS
Cytogenetic Map16q13UniSTS
Cytogenetic Map16pUniSTS
Cytogenetic Map11q13.2UniSTS
Cytogenetic MapXp11.3UniSTS
Cytogenetic Map1q25.1UniSTS
Cytogenetic Map10q23-q24UniSTS
Cytogenetic Map20p13UniSTS
Cytogenetic Map7q31UniSTS
Cytogenetic Map6q23.3UniSTS
Cytogenetic MapXp22.2UniSTS
Cytogenetic Map9q32UniSTS
Cytogenetic Map1q32.1UniSTS
Cytogenetic Map17q25.3UniSTS
Cytogenetic Map20q11.22UniSTS
Cytogenetic Map4q35.1UniSTS
Cytogenetic Map3q21.3UniSTS
Cytogenetic Map5q12.3UniSTS
Cytogenetic Map6q25.1UniSTS
Cytogenetic Map14q24.1UniSTS
Cytogenetic Map2q33.2UniSTS
Cytogenetic Map20q13.13UniSTS
Cytogenetic Map14q23.2UniSTS
Cytogenetic Map15q24.1UniSTS
Cytogenetic Map3q23UniSTS
Cytogenetic Map8q23.1UniSTS
Cytogenetic Map2q14.3UniSTS
Cytogenetic Map20q13.33UniSTS
Cytogenetic Map21q22.11UniSTS
Cytogenetic Map5p15.1UniSTS
Cytogenetic Map15q13.1UniSTS
Cytogenetic Map15q26.1UniSTS
Cytogenetic Map7q32.1UniSTS
Cytogenetic Map8p21.3UniSTS
Cytogenetic Map1p31.1UniSTS
Cytogenetic Map17qterUniSTS
Cytogenetic Map11q13.1UniSTS
Cytogenetic Map12q22UniSTS
Cytogenetic Map16q22.2UniSTS
Cytogenetic Map14q32UniSTS
Cytogenetic MapXp22.33UniSTS
Cytogenetic MapYp11.32UniSTS
Cytogenetic Map14q24.2UniSTS
Cytogenetic Map3p25.3UniSTS
Cytogenetic Map13q34UniSTS
Cytogenetic Map10p11.23UniSTS
Cytogenetic Map15q15.2UniSTS
Cytogenetic Map8p21.1UniSTS
Cytogenetic Map22q12.2UniSTS
Cytogenetic Map15q22.2UniSTS
Cytogenetic Map15q21UniSTS
Cytogenetic Map6p21.31UniSTS
Cytogenetic Map10q23.1UniSTS
Cytogenetic Map1p36.2UniSTS
Cytogenetic Map2p16.1UniSTS
Cytogenetic Map22q11.2UniSTS
Cytogenetic Map17q23.3UniSTS
Cytogenetic Map12q13.13UniSTS
Cytogenetic Map20q12-q13.12UniSTS
Cytogenetic Map3q26.33UniSTS
Cytogenetic Map5q31.2-q34UniSTS
Cytogenetic Map5q31.2UniSTS
Cytogenetic Map8q24.3UniSTS
Cytogenetic Map5q35.3UniSTS
Cytogenetic MapXq13-q21UniSTS
Cytogenetic Map7q11.23UniSTS
Cytogenetic Map1pter-q31.3UniSTS
Cytogenetic Map15q21.1UniSTS
Cytogenetic Map3q13.33UniSTS
Cytogenetic MapXq13.1UniSTS
Cytogenetic Map3p23-p21UniSTS
Cytogenetic Map11q22-q23UniSTS
Cytogenetic Map1p34.1UniSTS
Cytogenetic Map2q21.1UniSTS
Cytogenetic Map6p21.3UniSTS
Cytogenetic Map7p11.2UniSTS
Cytogenetic Map7p22.1UniSTS
Cytogenetic Map17q21.33UniSTS
Cytogenetic Map14q32.31UniSTS
Cytogenetic Map10q11.21UniSTS
Cytogenetic Map16q22UniSTS
Cytogenetic Map2q24UniSTS
Cytogenetic Map1q23.3UniSTS
Cytogenetic Map3q13.13UniSTS
Cytogenetic Map19p12UniSTS
Cytogenetic Map16p13.1UniSTS
Cytogenetic Map19q13.11UniSTS
Cytogenetic MapXp22.12UniSTS
Cytogenetic Map9q21.33UniSTS
Cytogenetic Map5q32UniSTS
Cytogenetic Map16q11.2UniSTS
Cytogenetic Map10p12.31UniSTS
Cytogenetic Map3q25.33UniSTS
Cytogenetic Map8q21.2UniSTS
Cytogenetic Map10q26.13UniSTS
Cytogenetic Map10q25.3UniSTS
Cytogenetic Map15q14-q15UniSTS
Cytogenetic Map8p11.2UniSTS
Cytogenetic Map1p34.3UniSTS
Cytogenetic Map4p15.2UniSTS
Cytogenetic Map17q12UniSTS
Cytogenetic Map7p15.3UniSTS
Cytogenetic Map7p21.1UniSTS
Cytogenetic Map1p36.32UniSTS
Cytogenetic Map1p36.1-p34UniSTS
Cytogenetic Map4p13UniSTS
Cytogenetic Map7q31.1-q31.2UniSTS
Cytogenetic Map8q22.2UniSTS
Cytogenetic Map15q21.1-q21.2UniSTS
Cytogenetic Map16q21UniSTS
Cytogenetic MapXq12UniSTS
Cytogenetic Map7q36.1UniSTS
Cytogenetic Map7p14.1UniSTS
Cytogenetic Map6p23UniSTS
Cytogenetic Map3p11.1UniSTS
Cytogenetic Map15q21.3UniSTS
Cytogenetic Map13q12UniSTS
Cytogenetic Map12q23.2UniSTS
Cytogenetic Map22q13.2UniSTS
Cytogenetic Map16q22.3UniSTS
Cytogenetic MapXq21UniSTS
Cytogenetic Map15q15UniSTS
Cytogenetic Map4q25UniSTS
Cytogenetic Map3q22.1UniSTS
Cytogenetic Map1q25.2UniSTS
Cytogenetic Map11q14.3UniSTS
Cytogenetic Map10q21.3UniSTS
Cytogenetic Map14q11.2UniSTS
Cytogenetic Map15q24.2UniSTS
Cytogenetic Map2p14UniSTS
Cytogenetic Map7q11.1UniSTS
Cytogenetic Map6p21UniSTS
Cytogenetic Map2p25.1-p24.1UniSTS
Cytogenetic Map16p12.2UniSTS
Cytogenetic Map4q13.3UniSTS
Cytogenetic Map12p11.21UniSTS
Cytogenetic Map18q21.3UniSTS
Cytogenetic Map17p13UniSTS
Cytogenetic Map8q12UniSTS
Cytogenetic Map2q35UniSTS
Cytogenetic Map21q22.13UniSTS
Cytogenetic Map6p21.1UniSTS
Cytogenetic Map17q24.3UniSTS
Cytogenetic Map1p21UniSTS
Cytogenetic MapXq24UniSTS
Cytogenetic Map2q34UniSTS
Cytogenetic Map8p11.23UniSTS
Cytogenetic Map1p36.13UniSTS
Cytogenetic Map9q34.3UniSTS
Cytogenetic Map11q23.3UniSTS
Cytogenetic Map9q33.3UniSTS
Cytogenetic Map16p12UniSTS
Cytogenetic Map2p23.3UniSTS
Cytogenetic Map20q11.23UniSTS
Cytogenetic Map12q15UniSTS
Cytogenetic Map2q12.2UniSTS
Cytogenetic Map8p12UniSTS
Cytogenetic Map7q22.3UniSTS
Cytogenetic Map19q13.42UniSTS
Cytogenetic Map4q35UniSTS
Cytogenetic Map19q13.1-q13.2UniSTS
Cytogenetic Map16p13.12UniSTS
Cytogenetic Map9q34.1UniSTS
Cytogenetic Map7q36.2UniSTS
Cytogenetic Map3p23UniSTS
Cytogenetic Map6p25UniSTS
Cytogenetic Map9q22.1-q22.2UniSTS
Cytogenetic Map3q26.1-q26.2UniSTS
Cytogenetic Map5q31-q34UniSTS
Cytogenetic Map9q34UniSTS
Cytogenetic Map12p13UniSTS
Cytogenetic Map4q26UniSTS
Cytogenetic Map4p15.3UniSTS
Cytogenetic Map2q33.1UniSTS
Cytogenetic Map15q15.1UniSTS
Cytogenetic Map1p32-p31UniSTS
Cytogenetic Map7q36.3UniSTS
Cytogenetic Map4q22.1UniSTS
Cytogenetic Map3q13.2UniSTS
Cytogenetic Map2q33.3UniSTS
Cytogenetic Map8p22UniSTS
Cytogenetic Map22q11.23UniSTS
Cytogenetic Map19q13.32UniSTS
Cytogenetic Map18q21.32UniSTS
Cytogenetic Map15q26.3UniSTS
Cytogenetic Map12q14.2UniSTS
Cytogenetic Map2q31.1-q31.2UniSTS
Cytogenetic Map12q13.11UniSTS
Cytogenetic Map9p13.3UniSTS
Cytogenetic Map9q34.11UniSTS
Cytogenetic Map6p12.3UniSTS
Cytogenetic Map6q22.32UniSTS
Cytogenetic Map5q15UniSTS
Cytogenetic Map3p14.2UniSTS
Cytogenetic Map3p25.1UniSTS
Cytogenetic Map3q27.1UniSTS
Cytogenetic Map2q36.1UniSTS
Cytogenetic Map2q37UniSTS
Cytogenetic Map19q13.31UniSTS
Cytogenetic Map4q23UniSTS
Cytogenetic Map16q24.3UniSTS
Cytogenetic Map15q22.31UniSTS
Cytogenetic Map10q22.1UniSTS
Cytogenetic Map18q11.1UniSTS
Cytogenetic Map16q23.2UniSTS
Cytogenetic Map12q13UniSTS
Cytogenetic Map18q21.1UniSTS
Cytogenetic Map12q12-q13UniSTS
Cytogenetic Map9p22.3UniSTS
Cytogenetic Map6p21.2UniSTS
Cytogenetic Map6p22.1UniSTS
Cytogenetic Map11p15.1UniSTS
Cytogenetic Map19qterUniSTS
Cytogenetic Map20q13.3-qterUniSTS
Cytogenetic Map12q14.1UniSTS
Cytogenetic Map7p11UniSTS
Cytogenetic Map7p15UniSTS
Cytogenetic Map1p13.3UniSTS
Cytogenetic Map16p12.3UniSTS
Cytogenetic Map3q29UniSTS
Cytogenetic Map3p21.3UniSTS
Cytogenetic Map13q14UniSTS
Cytogenetic Map17pUniSTS
Cytogenetic Map11p14.1UniSTS
Cytogenetic Map2p13.2UniSTS
Cytogenetic Map15q25.2UniSTS
Cytogenetic Map10q11.23UniSTS
Cytogenetic Map20q13.12UniSTS
Cytogenetic Map13q22.1UniSTS
Cytogenetic Map17p13.1UniSTS
Cytogenetic Map14q23.3UniSTS
Cytogenetic Map3q26.2UniSTS

miRNA Target Status

Predicted Target Of
Summary Value
Count of predictions:1615
Count of miRNA genes:638
Interacting mature miRNAs:719
Transcripts:ENST00000332272, ENST00000390664
Prediction methods:Microtar, Miranda, Rnahybrid
Result types:miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.


Expression


RNA-SEQ Expression
High: > 1000 TPM value   Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM   Below Cutoff: < 0.5 TPM

alimentary part of gastrointestinal system circulatory system endocrine system exocrine system hemolymphoid system hepatobiliary system integumental system musculoskeletal system nervous system renal system reproductive system respiratory system sensory system visual system adipose tissue appendage entire extraembryonic component pharyngeal arch
High
Medium 6 8 65 7 5 2 226 3 283 1 48 41 4 4 1
Low 1502 1736 521 169 524 21 1061 677 3083 64 775 539 155 1 20 951 3 1
Below cutoff 911 1066 944 261 1170 255 2995 1469 368 232 627 1018 15 1133 1791 3

Sequence

Nucleotide Sequences
RefSeq Transcripts NG_016442 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_021615 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NR_163480 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NR_163481 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_005255955 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_011523085 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AC009163 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF219991 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF280086 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC036640 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC041645 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC074834 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC074883 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BF510724 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471114 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CP068262 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  HM026170 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  HM026171 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  HM026172 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  HY106598 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KX099751 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KX099752 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KX099753 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KX099754 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KX099755 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles

Reference Sequences
RefSeq Acc Id: ENST00000332272   ⟹   ENSP00000328983
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1675,472,052 - 75,495,441 (-)Ensembl
RefSeq Acc Id: ENST00000390664   ⟹   ENSP00000375079
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1675,478,452 - 75,495,384 (-)Ensembl
RefSeq Acc Id: ENST00000649341   ⟹   ENSP00000497635
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1675,473,361 - 75,495,445 (-)Ensembl
RefSeq Acc Id: ENST00000649824   ⟹   ENSP00000496806
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1675,473,181 - 75,495,308 (-)Ensembl
RefSeq Acc Id: NM_021615   ⟹   NP_067628
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381675,472,052 - 75,495,441 (-)NCBI
GRCh371675,507,022 - 75,528,926 (-)ENTREZGENE
Build 361674,064,523 - 74,086,427 (-)NCBI Archive
HuRef1661,258,395 - 61,267,163 (-)ENTREZGENE
CHM1_11676,919,368 - 76,941,254 (-)NCBI
T2T-CHM13v2.01681,520,242 - 81,543,637 (-)NCBI
Sequence:
RefSeq Acc Id: NR_163480
RefSeq Status: REVIEWED
Type: NON-CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381675,472,042 - 75,495,441 (-)NCBI
T2T-CHM13v2.01681,520,232 - 81,543,637 (-)NCBI
Sequence:
RefSeq Acc Id: NR_163481
RefSeq Status: REVIEWED
Type: NON-CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381675,472,042 - 75,495,441 (-)NCBI
T2T-CHM13v2.01681,520,232 - 81,543,637 (-)NCBI
Sequence:
Reference Sequences
RefSeq Acc Id: NP_067628   ⟸   NM_021615
- Peptide Label: precursor
- UniProtKB: Q9GZX3 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: ENSP00000497635   ⟸   ENST00000649341
RefSeq Acc Id: ENSP00000496806   ⟸   ENST00000649824
RefSeq Acc Id: ENSP00000328983   ⟸   ENST00000332272
RefSeq Acc Id: ENSP00000375079   ⟸   ENST00000390664
Protein Domains
Sulfotransfer_1

Protein Structures
Name Modeler Protein Id AA Range Protein Structure
AF-Q9GZX3-F1-model_v2 AlphaFold Q9GZX3 1-395 view protein structure

Promoters
RGD ID:6792909
Promoter ID:HG_KWN:24278
Type:CpG-Island
SO ACC ID:SO:0000170
Source:MPROMDB
Tissues & Cell Lines:Lymphoblastoid
Transcripts:NM_021615,   UC002FEG.1,   UC002FEH.1
Position:
Human AssemblyChrPosition (strand)Source
Build 361674,086,506 - 74,087,006 (-)MPROMDB
RGD ID:7232863
Promoter ID:EPDNEW_H22177
Type:initiation region
Name:CHST6_1
Description:carbohydrate sulfotransferase 6
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Experiment Methods:Single-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh381675,495,407 - 75,495,467EPDNEW

Clinical Variants
Name Type Condition(s) Position(s) Clinical significance
NM_021615.5(CHST6):c.294C>G (p.Ser98=) single nucleotide variant Macular corneal dystrophy [RCV000546195] Chr16:75479535 [GRCh38]
Chr16:75513433 [GRCh37]
Chr16:16q23.1
benign
CHST6, REPLACEMENT OF 5-PRIME REGION variation Macular corneal dystrophy, type II [RCV000005377] Chr16:16q22 pathogenic
CHST6, DELETION OF 5-PRIME REGION deletion Macular corneal dystrophy, type II [RCV000005378] Chr16:16q22 pathogenic
NM_021615.5(CHST6):c.521A>G (p.Lys174Arg) single nucleotide variant Macular corneal dystrophy [RCV000005375] Chr16:75479308 [GRCh38]
Chr16:75513206 [GRCh37]
Chr16:16q23.1
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity
NM_021615.5(CHST6):c.609C>A (p.Asp203Glu) single nucleotide variant Macular corneal dystrophy [RCV000005376] Chr16:75479220 [GRCh38]
Chr16:75513118 [GRCh37]
Chr16:16q23.1
pathogenic
NM_021615.5(CHST6):c.599T>G (p.Leu200Arg) single nucleotide variant Macular corneal dystrophy [RCV000005379]|Macular corneal dystrophy, type II [RCV000005380]|not provided [RCV001091757] Chr16:75479230 [GRCh38]
Chr16:75513128 [GRCh37]
Chr16:16q23.1
pathogenic
NM_021615.5(CHST6):c.304T>G (p.Cys102Gly) single nucleotide variant Macular corneal dystrophy [RCV000005381] Chr16:75479525 [GRCh38]
Chr16:75513423 [GRCh37]
Chr16:16q23.1
pathogenic
NM_021615.5(CHST6):c.329A>G (p.Tyr110Cys) single nucleotide variant Macular corneal dystrophy [RCV000005382] Chr16:75479500 [GRCh38]
Chr16:75513398 [GRCh37]
Chr16:16q23.1
pathogenic
NM_021615.5(CHST6):c.827T>C (p.Leu276Pro) single nucleotide variant Macular corneal dystrophy [RCV000005383] Chr16:75479002 [GRCh38]
Chr16:75512900 [GRCh37]
Chr16:16q23.1
pathogenic
NM_021615.5(CHST6):c.277C>A (p.Arg93Ser) single nucleotide variant Macular corneal dystrophy, type II [RCV000005384] Chr16:75479552 [GRCh38]
Chr16:75513450 [GRCh37]
Chr16:16q23.1
pathogenic
GRCh38/hg38 16q22.1-24.3(chr16:70514631-90081985)x3 copy number gain See cases [RCV000052422] Chr16:70514631..90081985 [GRCh38]
Chr16:70548534..90148393 [GRCh37]
Chr16:69106035..88675894 [NCBI36]
Chr16:16q22.1-24.3
pathogenic
GRCh38/hg38 16q21-24.3(chr16:65313395-90081985)x3 copy number gain See cases [RCV000052421] Chr16:65313395..90081985 [GRCh38]
Chr16:65347298..90148393 [GRCh37]
Chr16:63904799..88675894 [NCBI36]
Chr16:16q21-24.3
pathogenic
GRCh38/hg38 16q22.1-23.1(chr16:69918076-76723348)x1 copy number loss See cases [RCV000053356] Chr16:69918076..76723348 [GRCh38]
Chr16:69951979..76757245 [GRCh37]
Chr16:68509480..75314746 [NCBI36]
Chr16:16q22.1-23.1
pathogenic
GRCh38/hg38 16q22.3-23.3(chr16:73049467-82576326)x1 copy number loss See cases [RCV000053357] Chr16:73049467..82576326 [GRCh38]
Chr16:73083366..82609931 [GRCh37]
Chr16:71640867..81167432 [NCBI36]
Chr16:16q22.3-23.3
pathogenic
GRCh38/hg38 16q23.1(chr16:75163906-78064640)x1 copy number loss Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053358]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053358]|See cases [RCV000053358] Chr16:75163906..78064640 [GRCh38]
Chr16:75197804..78098537 [GRCh37]
Chr16:73755305..76656038 [NCBI36]
Chr16:16q23.1
pathogenic
GRCh38/hg38 16q23.1(chr16:75485676-75603079)x3 copy number gain See cases [RCV000053894] Chr16:75485676..75603079 [GRCh38]
Chr16:75519574..75636977 [GRCh37]
Chr16:74077075..74194478 [NCBI36]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.86C>T (p.Pro29Leu) single nucleotide variant Macular corneal dystrophy [RCV000660545] Chr16:75479743 [GRCh38]
Chr16:75513641 [GRCh37]
Chr16:16q23.1
uncertain significance
GRCh38/hg38 16q22.1-24.1(chr16:70414573-84908120)x1 copy number loss See cases [RCV000133814] Chr16:70414573..84908120 [GRCh38]
Chr16:70448476..84941726 [GRCh37]
Chr16:69005977..83499227 [NCBI36]
Chr16:16q22.1-24.1
pathogenic
GRCh38/hg38 16q21-24.1(chr16:62925929-84585795)x3 copy number gain See cases [RCV000135863] Chr16:62925929..84585795 [GRCh38]
Chr16:62959833..84619401 [GRCh37]
Chr16:61517334..83176902 [NCBI36]
Chr16:16q21-24.1
pathogenic
GRCh38/hg38 16q22.1-24.3(chr16:70749398-90096995)x3 copy number gain See cases [RCV000137495] Chr16:70749398..90096995 [GRCh38]
Chr16:70783301..90163403 [GRCh37]
Chr16:69340802..88690904 [NCBI36]
Chr16:16q22.1-24.3
pathogenic
GRCh38/hg38 16q21-24.3(chr16:65511483-90096995)x3 copy number gain See cases [RCV000139426] Chr16:65511483..90096995 [GRCh38]
Chr16:65545386..90163403 [GRCh37]
Chr16:64102887..88690904 [NCBI36]
Chr16:16q21-24.3
pathogenic
GRCh38/hg38 16q23.1-24.3(chr16:75377981-90081992)x3 copy number gain See cases [RCV000139302] Chr16:75377981..90081992 [GRCh38]
Chr16:75411879..90148400 [GRCh37]
Chr16:73969380..88675901 [NCBI36]
Chr16:16q23.1-24.3
pathogenic
GRCh38/hg38 16q23.1(chr16:74811982-75698467)x3 copy number gain See cases [RCV000139130] Chr16:74811982..75698467 [GRCh38]
Chr16:74845880..75732365 [GRCh37]
Chr16:73403381..74289866 [NCBI36]
Chr16:16q23.1
uncertain significance
GRCh38/hg38 16q22.1-23.3(chr16:69053457-83274681)x3 copy number gain See cases [RCV000142038] Chr16:69053457..83274681 [GRCh38]
Chr16:69087360..83308286 [GRCh37]
Chr16:67644861..81865787 [NCBI36]
Chr16:16q22.1-23.3
pathogenic
GRCh38/hg38 16q21-24.3(chr16:64389378-90081985)x3 copy number gain See cases [RCV000142578] Chr16:64389378..90081985 [GRCh38]
Chr16:64423281..90148393 [GRCh37]
Chr16:62980782..88675894 [NCBI36]
Chr16:16q21-24.3
pathogenic|likely pathogenic
GRCh38/hg38 16q12.2-24.3(chr16:52899183-90088654)x3 copy number gain See cases [RCV000143425] Chr16:52899183..90088654 [GRCh38]
Chr16:52933095..90155062 [GRCh37]
Chr16:51490596..88682563 [NCBI36]
Chr16:16q12.2-24.3
pathogenic
GRCh38/hg38 16q23.1(chr16:75227456-75731127)x3 copy number gain See cases [RCV000143189] Chr16:75227456..75731127 [GRCh38]
Chr16:75261354..75765025 [GRCh37]
Chr16:73818855..74322526 [NCBI36]
Chr16:16q23.1
uncertain significance
GRCh38/hg38 16q21-23.3(chr16:65957829-83611443)x3 copy number gain See cases [RCV000143742] Chr16:65957829..83611443 [GRCh38]
Chr16:65991732..83645048 [GRCh37]
Chr16:64549233..82202549 [NCBI36]
Chr16:16q21-23.3
pathogenic
NM_021615.5(CHST6):c.993G>T (p.Gln331His) single nucleotide variant Macular corneal dystrophy [RCV000885002]|not specified [RCV000177326] Chr16:75478836 [GRCh38]
Chr16:75512734 [GRCh37]
Chr16:16q23.1
benign|conflicting interpretations of pathogenicity|uncertain significance
GRCh37/hg19 16q23.1-24.3(chr16:74872514-90274440)x3 copy number gain See cases [RCV000240108] Chr16:74872514..90274440 [GRCh37]
Chr16:16q23.1-24.3
pathogenic
GRCh37/hg19 16q11.2-24.3(chr16:46615804-90142285)x1 copy number loss Ductal breast carcinoma [RCV000207138] Chr16:46615804..90142285 [GRCh37]
Chr16:16q11.2-24.3
uncertain significance
GRCh37/hg19 16q22.2-24.3(chr16:72107834-90142285)x1 copy number loss Ductal breast carcinoma [RCV000207182] Chr16:72107834..90142285 [GRCh37]
Chr16:16q22.2-24.3
uncertain significance
Single allele complex Ductal breast carcinoma [RCV000207314] Chr16:56368689..90141355 [GRCh37]
Chr16:16q12.2-24.3
uncertain significance
GRCh37/hg19 16q23.1(chr16:75411853-75567059)x3 copy number gain not provided [RCV000762775] Chr16:75411853..75567059 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1810C>T single nucleotide variant Macular corneal dystrophy [RCV000299816] Chr16:75476831 [GRCh38]
Chr16:75510729 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4586T>C single nucleotide variant Macular corneal dystrophy [RCV000283489] Chr16:75474055 [GRCh38]
Chr16:75507953 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3742C>T single nucleotide variant Macular corneal dystrophy [RCV000284052] Chr16:75474899 [GRCh38]
Chr16:75508797 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*1058G>A single nucleotide variant Macular corneal dystrophy [RCV000301338] Chr16:75477583 [GRCh38]
Chr16:75511481 [GRCh37]
Chr16:16q23.1
benign|uncertain significance
NM_021615.5(CHST6):c.*3815G>A single nucleotide variant Macular corneal dystrophy [RCV000266321] Chr16:75474826 [GRCh38]
Chr16:75508724 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.718C>A (p.Arg240Ser) single nucleotide variant Macular corneal dystrophy [RCV000267043] Chr16:75479111 [GRCh38]
Chr16:75513009 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2955C>T single nucleotide variant Macular corneal dystrophy [RCV000304329] Chr16:75475686 [GRCh38]
Chr16:75509584 [GRCh37]
Chr16:16q23.1
likely benign|uncertain significance
NM_021615.5(CHST6):c.*2024C>G single nucleotide variant Macular corneal dystrophy [RCV000287771] Chr16:75476617 [GRCh38]
Chr16:75510515 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*1374C>T single nucleotide variant Macular corneal dystrophy [RCV000289703] Chr16:75477267 [GRCh38]
Chr16:75511165 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1407C>G single nucleotide variant Macular corneal dystrophy [RCV000272133] Chr16:75477234 [GRCh38]
Chr16:75511132 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*712G>A single nucleotide variant Macular corneal dystrophy [RCV000272815] Chr16:75477929 [GRCh38]
Chr16:75511827 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3992T>C single nucleotide variant Macular corneal dystrophy [RCV000273216] Chr16:75474649 [GRCh38]
Chr16:75508547 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.*5187T>G single nucleotide variant Macular corneal dystrophy [RCV000274686] Chr16:75473454 [GRCh38]
Chr16:75507352 [GRCh37]
Chr16:16q23.1
benign|uncertain significance
NM_021615.5(CHST6):c.258A>C (p.Ala86=) single nucleotide variant Macular corneal dystrophy [RCV000292878] Chr16:75479571 [GRCh38]
Chr16:75513469 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.*2210C>G single nucleotide variant Macular corneal dystrophy [RCV000293439] Chr16:75476431 [GRCh38]
Chr16:75510329 [GRCh37]
Chr16:16q23.1
likely benign|uncertain significance
NM_021615.5(CHST6):c.*2417C>T single nucleotide variant Macular corneal dystrophy [RCV000275736] Chr16:75476224 [GRCh38]
Chr16:75510122 [GRCh37]
Chr16:16q23.1
likely benign|uncertain significance
NM_021615.5(CHST6):c.*5445G>A single nucleotide variant Macular corneal dystrophy [RCV000275809] Chr16:75473196 [GRCh38]
Chr16:75507094 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*1597T>G single nucleotide variant Macular corneal dystrophy [RCV000259878] Chr16:75477044 [GRCh38]
Chr16:75510942 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*33G>C single nucleotide variant Macular corneal dystrophy [RCV000295708] Chr16:75478608 [GRCh38]
Chr16:75512506 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1526C>T single nucleotide variant Macular corneal dystrophy [RCV000277843] Chr16:75477115 [GRCh38]
Chr16:75511013 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3441A>T single nucleotide variant Macular corneal dystrophy [RCV000296385] Chr16:75475200 [GRCh38]
Chr16:75509098 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*5465C>T single nucleotide variant Macular corneal dystrophy [RCV000296940] Chr16:75473176 [GRCh38]
Chr16:75507074 [GRCh37]
Chr16:16q23.1
benign|uncertain significance
NM_021615.5(CHST6):c.*3621A>G single nucleotide variant Macular corneal dystrophy [RCV000278920] Chr16:75475020 [GRCh38]
Chr16:75508918 [GRCh37]
Chr16:16q23.1
benign|uncertain significance
NM_021615.5(CHST6):c.*2503G>A single nucleotide variant Macular corneal dystrophy [RCV000263310] Chr16:75476138 [GRCh38]
Chr16:75510036 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4085C>T single nucleotide variant Macular corneal dystrophy [RCV000365513] Chr16:75474556 [GRCh38]
Chr16:75508454 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.987C>T (p.Val329=) single nucleotide variant Macular corneal dystrophy [RCV000365962] Chr16:75478842 [GRCh38]
Chr16:75512740 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*242T>C single nucleotide variant Macular corneal dystrophy [RCV000280938] Chr16:75478399 [GRCh38]
Chr16:75512297 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3078G>A single nucleotide variant Macular corneal dystrophy [RCV000366320] Chr16:75475563 [GRCh38]
Chr16:75509461 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*5286A>T single nucleotide variant Macular corneal dystrophy [RCV000366953] Chr16:75473355 [GRCh38]
Chr16:75507253 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*4880G>A single nucleotide variant Macular corneal dystrophy [RCV000323367] Chr16:75473761 [GRCh38]
Chr16:75507659 [GRCh37]
Chr16:16q23.1
likely benign|uncertain significance
NM_021615.5(CHST6):c.*1967C>T single nucleotide variant Macular corneal dystrophy [RCV000345069] Chr16:75476674 [GRCh38]
Chr16:75510572 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*1295T>C single nucleotide variant Macular corneal dystrophy [RCV000283970] Chr16:75477346 [GRCh38]
Chr16:75511244 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4470C>T single nucleotide variant Macular corneal dystrophy [RCV000282309] Chr16:75474171 [GRCh38]
Chr16:75508069 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3811A>C single nucleotide variant Macular corneal dystrophy [RCV000323879] Chr16:75474830 [GRCh38]
Chr16:75508728 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*522G>C single nucleotide variant Macular corneal dystrophy [RCV000324151] Chr16:75478119 [GRCh38]
Chr16:75512017 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1566T>G single nucleotide variant Macular corneal dystrophy [RCV000370154] Chr16:75477075 [GRCh38]
Chr16:75510973 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*1811G>A single nucleotide variant Macular corneal dystrophy [RCV000395231] Chr16:75476830 [GRCh38]
Chr16:75510728 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1919C>T single nucleotide variant Macular corneal dystrophy [RCV000395234] Chr16:75476722 [GRCh38]
Chr16:75510620 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*3223CT[1] microsatellite Macular corneal dystrophy [RCV000396947] Chr16:75475415..75475416 [GRCh38]
Chr16:75509313..75509314 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*3828A>T single nucleotide variant Macular corneal dystrophy [RCV000325969] Chr16:75474813 [GRCh38]
Chr16:75508711 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.*3364C>A single nucleotide variant Macular corneal dystrophy [RCV000349028] Chr16:75475277 [GRCh38]
Chr16:75509175 [GRCh37]
Chr16:16q23.1
likely benign|uncertain significance
NM_021615.5(CHST6):c.*972C>A single nucleotide variant Macular corneal dystrophy [RCV000371109] Chr16:75477669 [GRCh38]
Chr16:75511567 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.1082T>C (p.Val361Ala) single nucleotide variant Macular corneal dystrophy [RCV000397063] Chr16:75478747 [GRCh38]
Chr16:75512645 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.918C>T (p.Ile306=) single nucleotide variant Macular corneal dystrophy [RCV000397048] Chr16:75478911 [GRCh38]
Chr16:75512809 [GRCh37]
Chr16:16q23.1
conflicting interpretations of pathogenicity|uncertain significance
NM_021615.5(CHST6):c.*1058G>T single nucleotide variant Macular corneal dystrophy [RCV000397840] Chr16:75477583 [GRCh38]
Chr16:75511481 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4487C>T single nucleotide variant Macular corneal dystrophy [RCV000397870] Chr16:75474154 [GRCh38]
Chr16:75508052 [GRCh37]
Chr16:16q23.1
likely benign|uncertain significance
NM_021615.5(CHST6):c.*4366T>C single nucleotide variant Macular corneal dystrophy [RCV000397873] Chr16:75474275 [GRCh38]
Chr16:75508173 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*1914A>G single nucleotide variant Macular corneal dystrophy [RCV000305948] Chr16:75476727 [GRCh38]
Chr16:75510625 [GRCh37]
Chr16:16q23.1
likely benign|uncertain significance
NM_021615.5(CHST6):c.1030C>T (p.Arg344Cys) single nucleotide variant Macular corneal dystrophy [RCV000306656] Chr16:75478799 [GRCh38]
Chr16:75512697 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2956G>A single nucleotide variant Macular corneal dystrophy [RCV000399167] Chr16:75475685 [GRCh38]
Chr16:75509583 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.1181G>A (p.Arg394Gln) single nucleotide variant Macular corneal dystrophy [RCV000350676] Chr16:75478648 [GRCh38]
Chr16:75512546 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3643_*3644del deletion Macular corneal dystrophy [RCV000375076] Chr16:75474997..75474998 [GRCh38]
Chr16:75508895..75508896 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*242_*243insG insertion Macular corneal dystrophy [RCV000375415]|not provided [RCV001594952] Chr16:75478398..75478399 [GRCh38]
Chr16:75512296..75512297 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*4155C>T single nucleotide variant Macular corneal dystrophy [RCV000399352] Chr16:75474486 [GRCh38]
Chr16:75508384 [GRCh37]
Chr16:16q23.1
benign|uncertain significance
NM_021615.5(CHST6):c.*4373dup duplication Macular corneal dystrophy [RCV000334959] Chr16:75474267..75474268 [GRCh38]
Chr16:75508165..75508166 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1377G>A single nucleotide variant Macular corneal dystrophy [RCV000329559] Chr16:75477264 [GRCh38]
Chr16:75511162 [GRCh37]
Chr16:16q23.1
likely benign|uncertain significance
NM_021615.5(CHST6):c.*1316A>C single nucleotide variant Macular corneal dystrophy [RCV000376071] Chr16:75477325 [GRCh38]
Chr16:75511223 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3750C>A single nucleotide variant Macular corneal dystrophy [RCV000376119] Chr16:75474891 [GRCh38]
Chr16:75508789 [GRCh37]
Chr16:16q23.1
benign|uncertain significance
NM_021615.5(CHST6):c.-66C>G single nucleotide variant Macular corneal dystrophy [RCV000344519] Chr16:75481866 [GRCh38]
Chr16:75515764 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3082G>A single nucleotide variant Macular corneal dystrophy [RCV000309162] Chr16:75475559 [GRCh38]
Chr16:75509457 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.666C>T (p.Asn222=) single nucleotide variant Macular corneal dystrophy [RCV000353686] Chr16:75479163 [GRCh38]
Chr16:75513061 [GRCh37]
Chr16:16q23.1
benign|conflicting interpretations of pathogenicity|uncertain significance
NM_021615.5(CHST6):c.*139A>G single nucleotide variant Macular corneal dystrophy [RCV000403175] Chr16:75478502 [GRCh38]
Chr16:75512400 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4290A>C single nucleotide variant Macular corneal dystrophy [RCV000371356] Chr16:75474351 [GRCh38]
Chr16:75508249 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2902dup duplication Macular corneal dystrophy [RCV000264274] Chr16:75475738..75475739 [GRCh38]
Chr16:75509636..75509637 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*588T>G single nucleotide variant Macular corneal dystrophy [RCV000264350] Chr16:75478053 [GRCh38]
Chr16:75511951 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2327C>T single nucleotide variant Macular corneal dystrophy [RCV000333127] Chr16:75476314 [GRCh38]
Chr16:75510212 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*5441C>T single nucleotide variant Macular corneal dystrophy [RCV000333196] Chr16:75473200 [GRCh38]
Chr16:75507098 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.*2652C>T single nucleotide variant Macular corneal dystrophy [RCV000355758] Chr16:75475989 [GRCh38]
Chr16:75509887 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4605C>T single nucleotide variant Macular corneal dystrophy [RCV000380271] Chr16:75474036 [GRCh38]
Chr16:75507934 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.*488_*490del deletion Macular corneal dystrophy [RCV000378681] Chr16:75478151..75478153 [GRCh38]
Chr16:75512049..75512051 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.129G>A (p.Val43=) single nucleotide variant Macular corneal dystrophy [RCV000334104] Chr16:75479700 [GRCh38]
Chr16:75513598 [GRCh37]
Chr16:16q23.1
benign|conflicting interpretations of pathogenicity|uncertain significance
NM_021615.5(CHST6):c.*1758A>T single nucleotide variant Macular corneal dystrophy [RCV000356973] Chr16:75476883 [GRCh38]
Chr16:75510781 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1375G>A single nucleotide variant Macular corneal dystrophy [RCV000381709] Chr16:75477266 [GRCh38]
Chr16:75511164 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.-78T>C single nucleotide variant Macular corneal dystrophy [RCV000405327] Chr16:75481878 [GRCh38]
Chr16:75515776 [GRCh37]
Chr16:16q23.1
likely benign
NM_021615.5(CHST6):c.*4086G>A single nucleotide variant Macular corneal dystrophy [RCV000313212] Chr16:75474555 [GRCh38]
Chr16:75508453 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.*3490T>C single nucleotide variant Macular corneal dystrophy [RCV000405978] Chr16:75475151 [GRCh38]
Chr16:75509049 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4305T>C single nucleotide variant Macular corneal dystrophy [RCV000314329] Chr16:75474336 [GRCh38]
Chr16:75508234 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*1118A>G single nucleotide variant Macular corneal dystrophy [RCV000336744] Chr16:75477523 [GRCh38]
Chr16:75511421 [GRCh37]
Chr16:16q23.1
likely benign|uncertain significance
NM_021615.5(CHST6):c.*1047G>T single nucleotide variant Macular corneal dystrophy [RCV000337539] Chr16:75477594 [GRCh38]
Chr16:75511492 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.*606G>A single nucleotide variant Macular corneal dystrophy [RCV000359353] Chr16:75478035 [GRCh38]
Chr16:75511933 [GRCh37]
Chr16:16q23.1
benign|uncertain significance
NM_021615.5(CHST6):c.*5150G>A single nucleotide variant Macular corneal dystrophy [RCV000384425] Chr16:75473491 [GRCh38]
Chr16:75507389 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2288T>G single nucleotide variant Macular corneal dystrophy [RCV000385397] Chr16:75476353 [GRCh38]
Chr16:75510251 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.*377G>A single nucleotide variant Macular corneal dystrophy [RCV000316131] Chr16:75478264 [GRCh38]
Chr16:75512162 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.857C>T (p.Ala286Val) single nucleotide variant Macular corneal dystrophy [RCV000361725] Chr16:75478972 [GRCh38]
Chr16:75512870 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2947G>T single nucleotide variant Macular corneal dystrophy [RCV000361407] Chr16:75475694 [GRCh38]
Chr16:75509592 [GRCh37]
Chr16:16q23.1
likely benign|uncertain significance
NM_021615.5(CHST6):c.465G>A (p.Arg155=) single nucleotide variant Macular corneal dystrophy [RCV000387102] Chr16:75479364 [GRCh38]
Chr16:75513262 [GRCh37]
Chr16:16q23.1
benign|conflicting interpretations of pathogenicity|uncertain significance
NM_021615.5(CHST6):c.976G>T (p.Ala326Ser) single nucleotide variant Macular corneal dystrophy [RCV001855182]|not provided [RCV000365634] Chr16:75478853 [GRCh38]
Chr16:75512751 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.708C>T (p.Asp236=) single nucleotide variant Macular corneal dystrophy [RCV000317606] Chr16:75479121 [GRCh38]
Chr16:75513019 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1892del deletion Macular corneal dystrophy [RCV000339678] Chr16:75476749 [GRCh38]
Chr16:75510647 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*751C>T single nucleotide variant Macular corneal dystrophy [RCV000362717] Chr16:75477890 [GRCh38]
Chr16:75511788 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3819G>C single nucleotide variant Macular corneal dystrophy [RCV000363334] Chr16:75474822 [GRCh38]
Chr16:75508720 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*1426C>A single nucleotide variant Macular corneal dystrophy [RCV000387301] Chr16:75477215 [GRCh38]
Chr16:75511113 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.120C>T (p.Arg40=) single nucleotide variant Macular corneal dystrophy [RCV000388573] Chr16:75479709 [GRCh38]
Chr16:75513607 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.*472G>C single nucleotide variant Macular corneal dystrophy [RCV000279584] Chr16:75478169 [GRCh38]
Chr16:75512067 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.484C>G (p.Arg162Gly) single nucleotide variant Macular corneal dystrophy [RCV000318543]|not provided [RCV001636903] Chr16:75479345 [GRCh38]
Chr16:75513243 [GRCh37]
Chr16:16q23.1
benign|likely benign|conflicting interpretations of pathogenicity
NM_021615.5(CHST6):c.*955C>T single nucleotide variant Macular corneal dystrophy [RCV000390266] Chr16:75477686 [GRCh38]
Chr16:75511584 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.-115C>G single nucleotide variant Macular corneal dystrophy [RCV000290791] Chr16:75494963 [GRCh38]
Chr16:75528861 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.892C>T (p.Gln298Ter) single nucleotide variant Macular corneal dystrophy [RCV000303034] Chr16:75478937 [GRCh38]
Chr16:75512835 [GRCh37]
Chr16:16q23.1
pathogenic
NM_021615.5(CHST6):c.*2836T>C single nucleotide variant Macular corneal dystrophy [RCV000302994] Chr16:75475805 [GRCh38]
Chr16:75509703 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1474C>G single nucleotide variant Macular corneal dystrophy [RCV000330534] Chr16:75477167 [GRCh38]
Chr16:75511065 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2080del deletion Macular corneal dystrophy [RCV000346062] Chr16:75476561 [GRCh38]
Chr16:75510459 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2437C>T single nucleotide variant Macular corneal dystrophy [RCV000316059] Chr16:75476204 [GRCh38]
Chr16:75510102 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3679T>C single nucleotide variant Macular corneal dystrophy [RCV000318125] Chr16:75474962 [GRCh38]
Chr16:75508860 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2055del deletion Macular corneal dystrophy [RCV000384326] Chr16:75476586 [GRCh38]
Chr16:75510484 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*241C>T single nucleotide variant Macular corneal dystrophy [RCV000349917] Chr16:75478400 [GRCh38]
Chr16:75512298 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3516T>C single nucleotide variant Macular corneal dystrophy [RCV000336273] Chr16:75475125 [GRCh38]
Chr16:75509023 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*794A>C single nucleotide variant Macular corneal dystrophy [RCV000308223] Chr16:75477847 [GRCh38]
Chr16:75511745 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*5452G>C single nucleotide variant Macular corneal dystrophy [RCV000354191] Chr16:75473189 [GRCh38]
Chr16:75507087 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2433A>C single nucleotide variant Macular corneal dystrophy [RCV000373049] Chr16:75476208 [GRCh38]
Chr16:75510106 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1585G>T single nucleotide variant Macular corneal dystrophy [RCV000298708] Chr16:75477056 [GRCh38]
Chr16:75510954 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4497G>A single nucleotide variant Macular corneal dystrophy [RCV000340763] Chr16:75474144 [GRCh38]
Chr16:75508042 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.-154T>A single nucleotide variant Macular corneal dystrophy [RCV000341211] Chr16:75495002 [GRCh38]
Chr16:75528900 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4970T>C single nucleotide variant Macular corneal dystrophy [RCV000289429] Chr16:75473671 [GRCh38]
Chr16:75507569 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.-21C>A single nucleotide variant Macular corneal dystrophy [RCV000289481] Chr16:75481821 [GRCh38]
Chr16:75515719 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*984G>C single nucleotide variant Macular corneal dystrophy [RCV000311729] Chr16:75477657 [GRCh38]
Chr16:75511555 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*5183G>A single nucleotide variant Macular corneal dystrophy [RCV000327485] Chr16:75473458 [GRCh38]
Chr16:75507356 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*687C>A single nucleotide variant Macular corneal dystrophy [RCV000327910] Chr16:75477954 [GRCh38]
Chr16:75511852 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1324C>T single nucleotide variant Macular corneal dystrophy [RCV000342463] Chr16:75477317 [GRCh38]
Chr16:75511215 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1031A>G single nucleotide variant Macular corneal dystrophy [RCV000397843] Chr16:75477610 [GRCh38]
Chr16:75511508 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*5197C>T single nucleotide variant Macular corneal dystrophy [RCV001120953] Chr16:75473444 [GRCh38]
Chr16:75507342 [GRCh37]
Chr16:16q23.1
likely benign
NM_021615.5(CHST6):c.*5011G>A single nucleotide variant Macular corneal dystrophy [RCV001120957] Chr16:75473630 [GRCh38]
Chr16:75507528 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.172C>T (p.Gln58Ter) single nucleotide variant not provided [RCV000598391] Chr16:75479657 [GRCh38]
Chr16:75513555 [GRCh37]
Chr16:16q23.1
pathogenic
GRCh37/hg19 16q11.2-24.3(chr16:46464488-90155062)x3 copy number gain See cases [RCV000446110] Chr16:46464488..90155062 [GRCh37]
Chr16:16q11.2-24.3
pathogenic
GRCh37/hg19 16p13.3-q24.3(chr16:69193-90274381)x3 copy number gain See cases [RCV000446684] Chr16:69193..90274381 [GRCh37]
Chr16:16p13.3-q24.3
pathogenic
GRCh37/hg19 16q23.1(chr16:74150909-77077326)x1 copy number loss See cases [RCV000512133] Chr16:74150909..77077326 [GRCh37]
Chr16:16q23.1
uncertain significance
GRCh37/hg19 16p13.2-q24.3(chr16:9273328-89548493)x3 copy number gain See cases [RCV000511622] Chr16:9273328..89548493 [GRCh37]
Chr16:16p13.2-q24.3
uncertain significance
GRCh37/hg19 16q11.2-24.3(chr16:46497599-90354753)x1 copy number loss Poly (ADP-Ribose) polymerase inhibitor response [RCV000626429] Chr16:46497599..90354753 [GRCh37]
Chr16:16q11.2-24.3
drug response
GRCh37/hg19 16p13.3-q24.3(chr16:85881-90155062) copy number gain See cases [RCV000511296] Chr16:85881..90155062 [GRCh37]
Chr16:16p13.3-q24.3
pathogenic
GRCh37/hg19 16p13.3-q24.3(chr16:85881-90155062)x3 copy number gain See cases [RCV000512138] Chr16:85881..90155062 [GRCh37]
Chr16:16p13.3-q24.3
pathogenic
GRCh37/hg19 16q13-24.3(chr16:57051473-89797669)x3 copy number gain See cases [RCV000512511] Chr16:57051473..89797669 [GRCh37]
Chr16:16q13-24.3
pathogenic
GRCh37/hg19 16q11.2-24.3(chr16:46455960-90354753)x1 copy number loss Poly (ADP-Ribose) polymerase inhibitor response [RCV000626435] Chr16:46455960..90354753 [GRCh37]
Chr16:16q11.2-24.3
drug response
GRCh37/hg19 16q22.2-24.3(chr16:72515938-90155062)x3 copy number gain not provided [RCV000683831] Chr16:72515938..90155062 [GRCh37]
Chr16:16q22.2-24.3
pathogenic
GRCh37/hg19 16p13.3-q24.3(chr16:88165-90274695)x3 copy number gain not provided [RCV000738918] Chr16:88165..90274695 [GRCh37]
Chr16:16p13.3-q24.3
pathogenic
NM_021615.5(CHST6):c.847_848delinsTG (p.Glu283Ter) indel Macular corneal dystrophy [RCV001731224] Chr16:75478981..75478982 [GRCh38]
Chr16:75512879..75512880 [GRCh37]
Chr16:16q23.1
pathogenic
GRCh37/hg19 16p13.3-q24.3(chr16:61451-90294632)x3 copy number gain not provided [RCV000738915] Chr16:61451..90294632 [GRCh37]
Chr16:16p13.3-q24.3
pathogenic
GRCh37/hg19 16p13.3-q24.3(chr16:88165-90163275)x3 copy number gain not provided [RCV000738917] Chr16:88165..90163275 [GRCh37]
Chr16:16p13.3-q24.3
pathogenic
GRCh37/hg19 16q23.1(chr16:75428474-75729424)x3 copy number gain not provided [RCV000739215] Chr16:75428474..75729424 [GRCh37]
Chr16:16q23.1
benign
GRCh37/hg19 16q23.1(chr16:75505046-75532044)x1 copy number loss not provided [RCV000739216] Chr16:75505046..75532044 [GRCh37]
Chr16:16q23.1
benign
GRCh37/hg19 16q23.1(chr16:75527524-75532044)x1 copy number loss not provided [RCV000739217] Chr16:75527524..75532044 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*2450C>G single nucleotide variant Macular corneal dystrophy [RCV001116252] Chr16:75476191 [GRCh38]
Chr16:75510089 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2426T>C single nucleotide variant Macular corneal dystrophy [RCV001116253] Chr16:75476215 [GRCh38]
Chr16:75510113 [GRCh37]
Chr16:16q23.1
likely benign
NM_021615.5(CHST6):c.*4566A>G single nucleotide variant Macular corneal dystrophy [RCV001117482] Chr16:75474075 [GRCh38]
Chr16:75507973 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4460T>G single nucleotide variant Macular corneal dystrophy [RCV001117484] Chr16:75474181 [GRCh38]
Chr16:75508079 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4494G>C single nucleotide variant Macular corneal dystrophy [RCV001117483] Chr16:75474147 [GRCh38]
Chr16:75508045 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3656C>A single nucleotide variant Macular corneal dystrophy [RCV001117575] Chr16:75474985 [GRCh38]
Chr16:75508883 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.130C>T (p.Leu44=) single nucleotide variant Macular corneal dystrophy [RCV001121453]|not provided [RCV000966305] Chr16:75479699 [GRCh38]
Chr16:75513597 [GRCh37]
Chr16:16q23.1
benign|likely benign
NM_021615.5(CHST6):c.392C>T (p.Ser131Leu) single nucleotide variant Macular corneal dystrophy [RCV000778477] Chr16:75479437 [GRCh38]
Chr16:75513335 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.196G>C (p.Val66Leu) single nucleotide variant Macular corneal dystrophy [RCV000778478] Chr16:75479633 [GRCh38]
Chr16:75513531 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.6G>A (p.Trp2Ter) single nucleotide variant Macular corneal dystrophy [RCV000778479] Chr16:75479823 [GRCh38]
Chr16:75513721 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.237C>T (p.Thr79=) single nucleotide variant Macular corneal dystrophy [RCV001121452]|not provided [RCV000966304] Chr16:75479592 [GRCh38]
Chr16:75513490 [GRCh37]
Chr16:16q23.1
benign|likely benign
GRCh37/hg19 16q23.1(chr16:75225021-75533658)x3 copy number gain not provided [RCV000848186] Chr16:75225021..75533658 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3547C>T single nucleotide variant Macular corneal dystrophy [RCV001117578] Chr16:75475094 [GRCh38]
Chr16:75508992 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2050G>A single nucleotide variant Macular corneal dystrophy [RCV001117699] Chr16:75476591 [GRCh38]
Chr16:75510489 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*818G>A single nucleotide variant Macular corneal dystrophy [RCV001117800] Chr16:75477823 [GRCh38]
Chr16:75511721 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4589C>T single nucleotide variant Macular corneal dystrophy [RCV001116031] Chr16:75474052 [GRCh38]
Chr16:75507950 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2131C>T single nucleotide variant Macular corneal dystrophy [RCV001117698] Chr16:75476510 [GRCh38]
Chr16:75510408 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4291T>C single nucleotide variant Macular corneal dystrophy [RCV001119084] Chr16:75474350 [GRCh38]
Chr16:75508248 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4981C>T single nucleotide variant Macular corneal dystrophy [RCV001116028] Chr16:75473660 [GRCh38]
Chr16:75507558 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*5208C>T single nucleotide variant Macular corneal dystrophy [RCV001118985] Chr16:75473433 [GRCh38]
Chr16:75507331 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.1113C>G (p.Ala371=) single nucleotide variant Macular corneal dystrophy [RCV001116451] Chr16:75478716 [GRCh38]
Chr16:75512614 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.484C>A (p.Arg162=) single nucleotide variant Macular corneal dystrophy [RCV001119460] Chr16:75479345 [GRCh38]
Chr16:75513243 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.768C>T (p.Ala256=) single nucleotide variant Macular corneal dystrophy [RCV000958719] Chr16:75479061 [GRCh38]
Chr16:75512959 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*5182C>G single nucleotide variant Macular corneal dystrophy [RCV001120955] Chr16:75473459 [GRCh38]
Chr16:75507357 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*5149C>T single nucleotide variant Macular corneal dystrophy [RCV001120956] Chr16:75473492 [GRCh38]
Chr16:75507390 [GRCh37]
Chr16:16q23.1
uncertain significance
GRCh37/hg19 16q23.1(chr16:75275780-75684031)x1 copy number loss not provided [RCV000846687] Chr16:75275780..75684031 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2962G>A single nucleotide variant Macular corneal dystrophy [RCV001119181] Chr16:75475679 [GRCh38]
Chr16:75509577 [GRCh37]
Chr16:16q23.1
uncertain significance
GRCh37/hg19 16q22.2-23.1(chr16:72677179-77439111)x1 copy number loss not provided [RCV000847084] Chr16:72677179..77439111 [GRCh37]
Chr16:16q22.2-23.1
uncertain significance
GRCh37/hg19 16q23.1(chr16:75513907-75626027)x3 copy number gain not provided [RCV000849205] Chr16:75513907..75626027 [GRCh37]
Chr16:16q23.1
uncertain significance
GRCh37/hg19 16q23.1(chr16:75494923-75539525)x1 copy number loss not provided [RCV000849595] Chr16:75494923..75539525 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.1124T>G (p.Val375Gly) single nucleotide variant Macular corneal dystrophy [RCV001116450] Chr16:75478705 [GRCh38]
Chr16:75512603 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.573C>G (p.Pro191=) single nucleotide variant Macular corneal dystrophy [RCV001119457] Chr16:75479256 [GRCh38]
Chr16:75513154 [GRCh37]
Chr16:16q23.1
conflicting interpretations of pathogenicity|uncertain significance
NM_021615.5(CHST6):c.-16-289TAAGAAGGTAGGACTCACAT[2] microsatellite not provided [RCV001676500] Chr16:75480074..75480093 [GRCh38]
Chr16:75513972..75513991 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.828G>A (p.Leu276=) single nucleotide variant Macular corneal dystrophy [RCV001117909]|not provided [RCV000881933] Chr16:75479001 [GRCh38]
Chr16:75512899 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*68G>T single nucleotide variant Macular corneal dystrophy [RCV001121368] Chr16:75478573 [GRCh38]
Chr16:75512471 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*13T>C single nucleotide variant Macular corneal dystrophy [RCV001121369] Chr16:75478628 [GRCh38]
Chr16:75512526 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.1096G>A (p.Glu366Lys) single nucleotide variant Macular corneal dystrophy [RCV001207736] Chr16:75478733 [GRCh38]
Chr16:75512631 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4942C>T single nucleotide variant Macular corneal dystrophy [RCV001116029] Chr16:75473699 [GRCh38]
Chr16:75507597 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3814C>G single nucleotide variant Macular corneal dystrophy [RCV001116141] Chr16:75474827 [GRCh38]
Chr16:75508725 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*991A>G single nucleotide variant Macular corneal dystrophy [RCV001116350] Chr16:75477650 [GRCh38]
Chr16:75511548 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.621G>A (p.Val207=) single nucleotide variant Macular corneal dystrophy [RCV001422515]|not provided [RCV000936037] Chr16:75479208 [GRCh38]
Chr16:75513106 [GRCh37]
Chr16:16q23.1
likely benign
NM_021615.5(CHST6):c.*5311T>C single nucleotide variant Macular corneal dystrophy [RCV001118984] Chr16:75473330 [GRCh38]
Chr16:75507228 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4444A>G single nucleotide variant Macular corneal dystrophy [RCV001119082] Chr16:75474197 [GRCh38]
Chr16:75508095 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4325A>G single nucleotide variant Macular corneal dystrophy [RCV001119083] Chr16:75474316 [GRCh38]
Chr16:75508214 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3240A>G single nucleotide variant Macular corneal dystrophy [RCV001119180] Chr16:75475401 [GRCh38]
Chr16:75509299 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3983G>A single nucleotide variant Macular corneal dystrophy [RCV001121047] Chr16:75474658 [GRCh38]
Chr16:75508556 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3947C>T single nucleotide variant Macular corneal dystrophy [RCV001121048] Chr16:75474694 [GRCh38]
Chr16:75508592 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*2770T>G single nucleotide variant Macular corneal dystrophy [RCV001121174] Chr16:75475871 [GRCh38]
Chr16:75509769 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.539A>G (p.Asn180Ser) single nucleotide variant Macular corneal dystrophy [RCV001119458] Chr16:75479290 [GRCh38]
Chr16:75513188 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*164G>T single nucleotide variant Macular corneal dystrophy [RCV001121366] Chr16:75478477 [GRCh38]
Chr16:75512375 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4003T>C single nucleotide variant Macular corneal dystrophy [RCV001121046] Chr16:75474638 [GRCh38]
Chr16:75508536 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*5190T>A single nucleotide variant Macular corneal dystrophy [RCV001120954] Chr16:75473451 [GRCh38]
Chr16:75507349 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.7C>A (p.Leu3Met) single nucleotide variant Macular corneal dystrophy [RCV001116563] Chr16:75479822 [GRCh38]
Chr16:75513720 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4574G>C single nucleotide variant Macular corneal dystrophy [RCV001117480] Chr16:75474067 [GRCh38]
Chr16:75507965 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*4573C>T single nucleotide variant Macular corneal dystrophy [RCV001117481] Chr16:75474068 [GRCh38]
Chr16:75507966 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*824G>A single nucleotide variant Macular corneal dystrophy [RCV001117799] Chr16:75477817 [GRCh38]
Chr16:75511715 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.1A>T (p.Met1Leu) single nucleotide variant not provided [RCV001091758] Chr16:75479828 [GRCh38]
Chr16:75513726 [GRCh37]
Chr16:16q23.1
pathogenic
NM_021615.5(CHST6):c.*3465T>C single nucleotide variant Macular corneal dystrophy [RCV001119178] Chr16:75475176 [GRCh38]
Chr16:75509074 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*3297C>T single nucleotide variant Macular corneal dystrophy [RCV001119179] Chr16:75475344 [GRCh38]
Chr16:75509242 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*435C>T single nucleotide variant Macular corneal dystrophy [RCV001119365] Chr16:75478206 [GRCh38]
Chr16:75512104 [GRCh37]
Chr16:16q23.1
likely benign
NM_021615.5(CHST6):c.496C>G (p.Arg166Gly) single nucleotide variant Macular corneal dystrophy [RCV001119459] Chr16:75479333 [GRCh38]
Chr16:75513231 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.301C>T (p.Leu101=) single nucleotide variant Macular corneal dystrophy [RCV001119461] Chr16:75479528 [GRCh38]
Chr16:75513426 [GRCh37]
Chr16:16q23.1
conflicting interpretations of pathogenicity|uncertain significance
NM_021615.5(CHST6):c.*2833T>G single nucleotide variant Macular corneal dystrophy [RCV001121173] Chr16:75475808 [GRCh38]
Chr16:75509706 [GRCh37]
Chr16:16q23.1
benign
NM_021615.5(CHST6):c.*106G>T single nucleotide variant Macular corneal dystrophy [RCV001121367] Chr16:75478535 [GRCh38]
Chr16:75512433 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.115G>C (p.Ala39Pro) single nucleotide variant Macular corneal dystrophy [RCV001121454] Chr16:75479714 [GRCh38]
Chr16:75513612 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.24C>T (p.Ser8=) single nucleotide variant Macular corneal dystrophy [RCV001121455] Chr16:75479805 [GRCh38]
Chr16:75513703 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.15C>T (p.Arg5=) single nucleotide variant Macular corneal dystrophy [RCV001121456] Chr16:75479814 [GRCh38]
Chr16:75513712 [GRCh37]
Chr16:16q23.1
conflicting interpretations of pathogenicity|uncertain significance
NM_021615.5(CHST6):c.*4749G>T single nucleotide variant Macular corneal dystrophy [RCV001116030] Chr16:75473892 [GRCh38]
Chr16:75507790 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.1101G>A (p.Gln367=) single nucleotide variant Macular corneal dystrophy [RCV001116452] Chr16:75478728 [GRCh38]
Chr16:75512626 [GRCh37]
Chr16:16q23.1
uncertain significance
GRCh37/hg19 16q21-24.3(chr16:61524229-90155062)x3 copy number gain not provided [RCV001249359] Chr16:61524229..90155062 [GRCh37]
Chr16:16q21-24.3
not provided
NM_021615.5(CHST6):c.*2635G>A single nucleotide variant Macular corneal dystrophy [RCV001121175] Chr16:75476006 [GRCh38]
Chr16:75509904 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.656C>T (p.Ala219Val) single nucleotide variant Macular corneal dystrophy [RCV001117910] Chr16:75479173 [GRCh38]
Chr16:75513071 [GRCh37]
Chr16:16q23.1
conflicting interpretations of pathogenicity|uncertain significance
NM_021615.5(CHST6):c.*4238A>G single nucleotide variant Macular corneal dystrophy [RCV001119085] Chr16:75474403 [GRCh38]
Chr16:75508301 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1836G>A single nucleotide variant Macular corneal dystrophy [RCV001119264] Chr16:75476805 [GRCh38]
Chr16:75510703 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*1652G>A single nucleotide variant Macular corneal dystrophy [RCV001119265] Chr16:75476989 [GRCh38]
Chr16:75510887 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3608A>C single nucleotide variant Macular corneal dystrophy [RCV001117576] Chr16:75475033 [GRCh38]
Chr16:75508931 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3602C>T single nucleotide variant Macular corneal dystrophy [RCV001117577] Chr16:75475039 [GRCh38]
Chr16:75508937 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.*3917G>A single nucleotide variant Macular corneal dystrophy [RCV001121049] Chr16:75474724 [GRCh38]
Chr16:75508622 [GRCh37]
Chr16:16q23.1
likely benign
NM_021615.5(CHST6):c.*3883T>G single nucleotide variant Macular corneal dystrophy [RCV001116140] Chr16:75474758 [GRCh38]
Chr16:75508656 [GRCh37]
Chr16:16q23.1
likely benign
NM_021615.5(CHST6):c.231G>A (p.Trp77Ter) single nucleotide variant Macular corneal dystrophy [RCV001335098] Chr16:75479598 [GRCh38]
Chr16:75513496 [GRCh37]
Chr16:16q23.1
pathogenic
NM_021615.5(CHST6):c.1043T>G (p.Leu348Arg) single nucleotide variant Macular corneal dystrophy [RCV001348901] Chr16:75478786 [GRCh38]
Chr16:75512684 [GRCh37]
Chr16:16q23.1
uncertain significance
GRCh37/hg19 16q23.1(chr16:75281963-75665698)x3 copy number gain not provided [RCV001259871] Chr16:75281963..75665698 [GRCh37]
Chr16:16q23.1
uncertain significance
GRCh37/hg19 16q23.1(chr16:75064591-75549654)x1 copy number loss not provided [RCV001258649] Chr16:75064591..75549654 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.898G>T (p.Glu300Ter) single nucleotide variant Macular corneal dystrophy [RCV001335099] Chr16:75478931 [GRCh38]
Chr16:75512829 [GRCh37]
Chr16:16q23.1
pathogenic
NM_021615.5(CHST6):c.518T>C (p.Leu173Pro) single nucleotide variant Macular corneal dystrophy [RCV001367958] Chr16:75479311 [GRCh38]
Chr16:75513209 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.500C>T (p.Ser167Phe) single nucleotide variant Macular corneal dystrophy [RCV001298368] Chr16:75479329 [GRCh38]
Chr16:75513227 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.349del (p.Leu117fs) deletion Macular corneal dystrophy [RCV001331191] Chr16:75479480 [GRCh38]
Chr16:75513378 [GRCh37]
Chr16:16q23.1
pathogenic
NM_021615.5(CHST6):c.729C>T (p.Arg243=) single nucleotide variant Macular corneal dystrophy [RCV001309627] Chr16:75479100 [GRCh38]
Chr16:75512998 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.944G>A (p.Arg315His) single nucleotide variant Macular corneal dystrophy [RCV001371555] Chr16:75478885 [GRCh38]
Chr16:75512783 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.494_495delinsCT (p.Cys165Ser) indel Macular corneal dystrophy [RCV001331192]|not provided [RCV002225826] Chr16:75479334..75479335 [GRCh38]
Chr16:75513232..75513233 [GRCh37]
Chr16:16q23.1
likely pathogenic|uncertain significance
NM_021615.5(CHST6):c.1167C>T (p.Thr389=) single nucleotide variant Macular corneal dystrophy [RCV001456521] Chr16:75478662 [GRCh38]
Chr16:75512560 [GRCh37]
Chr16:16q23.1
likely benign
NM_021615.5(CHST6):c.585A>G (p.Leu195=) single nucleotide variant Macular corneal dystrophy [RCV001445734] Chr16:75479244 [GRCh38]
Chr16:75513142 [GRCh37]
Chr16:16q23.1
likely benign
NM_021615.5(CHST6):c.897C>G (p.Leu299=) single nucleotide variant Macular corneal dystrophy [RCV001460860] Chr16:75478932 [GRCh38]
Chr16:75512830 [GRCh37]
Chr16:16q23.1
likely benign
NM_021615.5(CHST6):c.789T>C (p.Phe263=) single nucleotide variant Macular corneal dystrophy [RCV001398804] Chr16:75479040 [GRCh38]
Chr16:75512938 [GRCh37]
Chr16:16q23.1
likely benign
NC_000016.9:g.(?_75428968)_(75690509_?)del deletion not provided [RCV002239772] Chr16:75428968..75690509 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.997T>C (p.Trp333Arg) single nucleotide variant Macular corneal dystrophy [RCV001731225] Chr16:75478832 [GRCh38]
Chr16:75512730 [GRCh37]
Chr16:16q23.1
likely pathogenic
NM_021615.5(CHST6):c.211G>C (p.Glu71Gln) single nucleotide variant Macular corneal dystrophy [RCV001785426] Chr16:75479618 [GRCh38]
Chr16:75513516 [GRCh37]
Chr16:16q23.1
likely pathogenic
NM_021615.5(CHST6):c.799C>T (p.Arg267Cys) single nucleotide variant Macular corneal dystrophy [RCV002009424] Chr16:75479030 [GRCh38]
Chr16:75512928 [GRCh37]
Chr16:16q23.1
uncertain significance
NC_000016.9:g.(?_74748068)_(75513746_?)del deletion Macular corneal dystrophy [RCV001949688] Chr16:74748068..75513746 [GRCh37]
Chr16:16q23.1
pathogenic
NM_021615.5(CHST6):c.400G>A (p.Ala134Thr) single nucleotide variant Macular corneal dystrophy [RCV001894403] Chr16:75479429 [GRCh38]
Chr16:75513327 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.307G>A (p.Asp103Asn) single nucleotide variant Macular corneal dystrophy [RCV001942776] Chr16:75479522 [GRCh38]
Chr16:75513420 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.355G>C (p.Asp119His) single nucleotide variant Macular corneal dystrophy [RCV001963438] Chr16:75479474 [GRCh38]
Chr16:75513372 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.14G>C (p.Arg5Pro) single nucleotide variant Macular corneal dystrophy [RCV001918463] Chr16:75479815 [GRCh38]
Chr16:75513713 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.1099C>G (p.Gln367Glu) single nucleotide variant Macular corneal dystrophy [RCV001993850] Chr16:75478730 [GRCh38]
Chr16:75512628 [GRCh37]
Chr16:16q23.1
uncertain significance
NC_000016.9:g.(?_75490611)_(75576599_?)del deletion Joubert syndrome 20 [RCV001953926] Chr16:75490611..75576599 [GRCh37]
Chr16:16q23.1
pathogenic
NC_000016.9:g.(?_75327850)_(75664426_?)dup duplication Joubert syndrome 20 [RCV001875411] Chr16:75327850..75664426 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.532T>G (p.Phe178Val) single nucleotide variant Macular corneal dystrophy [RCV001922179] Chr16:75479297 [GRCh38]
Chr16:75513195 [GRCh37]
Chr16:16q23.1
uncertain significance
NM_021615.5(CHST6):c.1006G>A (p.Ala336Thr) single nucleotide variant Macular corneal dystrophy [RCV002096646] Chr16:75478823 [GRCh38]
Chr16:75512721 [GRCh37]
Chr16:16q23.1
benign
GRCh37/hg19 16q11.2-24.3(chr16:46503968-90155062)x3 copy number gain not provided [RCV002221458] Chr16:46503968..90155062 [GRCh37]
Chr16:16q11.2-24.3
pathogenic

Additional Information

Database Acc Id Source(s)
AGR Gene HGNC:6938 AgrOrtholog
COSMIC CHST6 COSMIC
Ensembl Genes ENSG00000183196 Ensembl, ENTREZGENE, UniProtKB/Swiss-Prot
Ensembl Protein ENSP00000328983 ENTREZGENE
  ENSP00000328983.4 UniProtKB/Swiss-Prot
  ENSP00000375079.2 UniProtKB/Swiss-Prot
  ENSP00000496806.1 UniProtKB/Swiss-Prot
  ENSP00000497635.1 UniProtKB/Swiss-Prot
Ensembl Transcript ENST00000332272 ENTREZGENE
  ENST00000332272.9 UniProtKB/Swiss-Prot
  ENST00000390664.3 UniProtKB/Swiss-Prot
  ENST00000649341.1 UniProtKB/Swiss-Prot
  ENST00000649824.1 UniProtKB/Swiss-Prot
Gene3D-CATH 3.40.50.300 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
GTEx ENSG00000183196 GTEx
HGNC ID HGNC:6938 ENTREZGENE
Human Proteome Map CHST6 Human Proteome Map
InterPro Carbohydrate_sulfotransferase UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  P-loop_NTPase UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  Sulfotransferase_dom UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
KEGG Report hsa:4166 UniProtKB/Swiss-Prot
NCBI Gene 4166 ENTREZGENE
OMIM 217800 OMIM
  605294 OMIM
Pfam Sulfotransfer_1 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PharmGKB PA26506 PharmGKB
PIRSF Carbohydrate_sulfotransferase UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Superfamily-SCOP SSF52540 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
UniProt A0A1I9LHJ0_HUMAN UniProtKB/TrEMBL
  A0A1I9LHJ1_HUMAN UniProtKB/TrEMBL
  A0A1I9LHJ2_HUMAN UniProtKB/TrEMBL
  CHST6_HUMAN UniProtKB/Swiss-Prot
  D6QZA0_HUMAN UniProtKB/TrEMBL
  D6QZA1_HUMAN UniProtKB/TrEMBL
  D6QZA2_HUMAN UniProtKB/TrEMBL
  L8E925_HUMAN UniProtKB/TrEMBL
  Q9GZX3 ENTREZGENE
UniProt Secondary D3DUK3 UniProtKB/Swiss-Prot


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2016-03-28 CHST6  carbohydrate sulfotransferase 6    carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6  Symbol and/or name change 5135510 APPROVED