Ptgs2<sup>em1Mcwi</sup> (prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant1, Mcwi) - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Gene: Ptgs2em1Mcwi (prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant1, Mcwi) Rattus norvegicus
Analyze
Symbol: Ptgs2em1Mcwi
Name: prostaglandin-endoperoxide synthase 2; CRISPR/Cas9 induced mutant1, Mcwi
RGD ID: 13208843
Description: CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene.
Type: allele  of Ptgs2  
Previously known as: Ptgs2^[em1Mcwi]; Ptgs2em1Mcwi
Is Marker For: Strains:   SS-Ptgs2em1Mcwi  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


References

References - curated
# Reference Title Reference Citation
1. Data registered by Dr. Melinda Dwinell’s group Personal communication between Dr. Melinda Dwinell’s group and the RGD curators

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Ptgs2em1Mcwi-var1 chr13 62165923 62165975 GTTGGGAAGCTTTCTCCAACCTCTCCTACTACACCAGGGCCCTTCCTCCTGTG - deletion mRatBN7.2

Related Rat Strains
The following Strains have been annotated to Ptgs2em1Mcwi
SS-Ptgs2em1Mcwi    


Expression


Sequence

Nucleotide Sequences


Additional Information