MAGEL2 (MAGE family member L2) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: MAGEL2 (MAGE family member L2) Homo sapiens
Analyze
Symbol: MAGEL2
Name: MAGE family member L2
RGD ID: 1320098
HGNC Page HGNC
Description: Enables ubiquitin-protein transferase activity. Involved in Arp2/3 complex-mediated actin nucleation; protein K63-linked ubiquitination; and retrograde transport, endosome to Golgi. Located in endosome. Colocalizes with retromer complex. Implicated in Schaaf-Yang syndrome.
Type: protein-coding
RefSeq Status: REVIEWED
Also known as: MAGE-like 2; MAGE-like protein 2; melanoma antigen family L2; NDNL1; necdin-like protein 1; nM15; PWLS; SHFYNG
RGD Orthologs
Mouse
Rat
Chinchilla
Bonobo
Dog
Squirrel
Pig
Green Monkey
Naked Mole-Rat
Alliance Genes
More Info more info ...
Allele / Splice: See ClinVar data
Latest Assembly: GRCh38 - Human Genome Assembly GRCh38
Position:
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 Ensembl1523,643,549 - 23,647,867 (-)EnsemblGRCh38hg38GRCh38
GRCh381523,643,549 - 23,647,867 (-)NCBIGRCh38GRCh38hg38GRCh38
GRCh371523,888,696 - 23,893,014 (-)NCBIGRCh37GRCh37hg19GRCh37
Build 361521,439,789 - 21,442,268 (-)NCBINCBI36hg18NCBI36
Build 341521,439,787 - 21,442,082NCBI
Celera152,049,600 - 2,053,898 (-)NCBI
Cytogenetic Map15q11.2NCBI
HuRef152,024,179 - 2,028,378 (-)NCBIHuRef
CHM1_11523,838,991 - 23,843,288 (-)NCBICHM1_1
JBrowse: View Region in Genome Browser (JBrowse)
Model


Gene-Chemical Interaction Annotations     Click to see Annotation Detail View
Gene Ontology Annotations     Click to see Annotation Detail View

Cellular Component
cytoplasm  (ISO)
cytosol  (IEA)
early endosome  (IEA)
endosome  (IDA)
nucleus  (IBA,ISS)
retromer complex  (IDA)

Molecular Function

Phenotype Annotations     Click to see Annotation Detail View

Human Phenotype
Abdominal obesity  (IAGP)
Abnormal facial shape  (IAGP)
Abnormal rapid eye movement sleep  (IAGP)
Abnormal temper tantrums  (IAGP)
Abnormality of the philtrum  (IAGP)
Abnormality of ulnar metaphysis  (IAGP)
Abnormality of vision  (IAGP)
Absence of pubertal development  (IAGP)
Absent speech  (IAGP)
Acromicria  (IAGP)
Adrenal insufficiency  (IAGP)
Almond-shaped palpebral fissure  (IAGP)
Ambiguous genitalia  (IAGP)
Anterior pituitary hypoplasia  (IAGP)
Arthrogryposis multiplex congenita  (IAGP)
Atrial septal defect  (IAGP)
Attention deficit hyperactivity disorder  (IAGP)
Autism  (IAGP)
Autistic behavior  (IAGP)
Autosomal dominant inheritance  (IAGP)
Brachydactyly  (IAGP)
Brain imaging abnormality  (IAGP)
Bulimia  (IAGP)
Camptodactyly  (IAGP)
Carious teeth  (IAGP)
Central adrenal insufficiency  (IAGP)
Central apnea  (IAGP)
Central hypothyroidism  (IAGP)
Central sleep apnea  (IAGP)
Chorioretinal hypopigmentation  (IAGP)
Chronic constipation  (IAGP)
Clinodactyly  (IAGP)
Clitoral hypoplasia  (IAGP)
Coarse facial features  (IAGP)
Cognitive impairment  (IAGP)
Confusional arousal  (IAGP)
Constipation  (IAGP)
Cryptorchidism  (IAGP)
Cutaneous photosensitivity  (IAGP)
Decreased circulating gonadotropin concentration  (IAGP)
Decreased circulating T4 level  (IAGP)
Decreased fetal movement  (IAGP)
Decreased inhibin B level  (IAGP)
Decreased muscle mass  (IAGP)
Decreased response to growth hormone stimuation test  (IAGP)
Decreased testicular size  (IAGP)
Delayed ability to walk  (IAGP)
Delayed puberty  (IAGP)
Delayed speech and language development  (IAGP)
Diabetes mellitus  (IAGP)
Dolichocephaly  (IAGP)
Downturned corners of mouth  (IAGP)
Esotropia  (IAGP)
External genital hypoplasia  (IAGP)
Failure to thrive  (IAGP)
Failure to thrive in infancy  (IAGP)
Feeding difficulties  (IAGP)
Feeding difficulties in infancy  (IAGP)
Fetal akinesia sequence  (IAGP)
Flexion contracture  (IAGP)
Frontal bossing  (IAGP)
Frontal upsweep of hair  (IAGP)
Gastroesophageal reflux  (IAGP)
Gastroparesis  (IAGP)
Generalized hypopigmentation  (IAGP)
Generalized hypotonia  (IAGP)
Genu valgum  (IAGP)
Global developmental delay  (IAGP)
Hip dysplasia  (IAGP)
Hyperinsulinemia  (IAGP)
Hypermetropia  (IAGP)
Hypogonadism  (IAGP)
Hypogonadotropic hypogonadism  (IAGP)
Hypopigmentation of hair  (IAGP)
Hypopigmentation of the skin  (IAGP)
Hypoplastic labia minora  (IAGP)
Hypothalamic luteinizing hormone-releasing hormone deficiency  (IAGP)
Hypotonia  (IAGP)
Hypoventilation  (IAGP)
Impaired pain sensation  (IAGP)
Impaired temperature sensation  (IAGP)
Impulsivity  (IAGP)
Inability to walk  (IAGP)
Infantile muscular hypotonia  (IAGP)
Infantile onset  (IAGP)
Infertility  (IAGP)
Intellectual disability  (IAGP)
Intellectual disability, borderline  (IAGP)
Intellectual disability, mild  (IAGP)
Intellectual disability, moderate  (IAGP)
Iris hypopigmentation  (IAGP)
Kyphosis  (IAGP)
Lethargy  (IAGP)
Low-set ears  (IAGP)
Mandibular prognathia  (IAGP)
Micropenis  (IAGP)
Motor delay  (IAGP)
Multiple joint contractures  (IAGP)
Myopia  (IAGP)
Narrow forehead  (IAGP)
Narrow nasal bridge  (IAGP)
Narrow palm  (IAGP)
Nasal speech  (IAGP)
Nasogastric tube feeding  (IAGP)
Neonatal hypotonia  (IAGP)
Obesity  (IAGP)
Obsessive-compulsive behavior  (IAGP)
Obsessive-compulsive trait  (IAGP)
Obstructive sleep apnea  (IAGP)
Occipital cortical atrophy  (IAGP)
Oligomenorrhea  (IAGP)
Open mouth  (IAGP)
Osteopenia  (IAGP)
Osteoporosis  (IAGP)
Parietal cortical atrophy  (IAGP)
Pedal edema  (IAGP)
Perisylvian polymicrogyria  (IAGP)
Polyphagia  (IAGP)
Poor fine motor coordination  (IAGP)
Poor gross motor coordination  (IAGP)
Poor suck  (IAGP)
Postterm pregnancy  (IAGP)
Precocious puberty  (IAGP)
Premature adrenarche  (IAGP)
Premature pubarche  (IAGP)
Primary amenorrhea  (IAGP)
Psychosis  (IAGP)
Radial deviation of finger  (IAGP)
Recurrent respiratory infections  (IAGP)
Reduced tendon reflexes  (IAGP)
Retrognathia  (IAGP)
Rocker bottom foot  (IAGP)
Schizophrenia  (IAGP)
Scoliosis  (IAGP)
Scrotal hypoplasia  (IAGP)
Seizure  (IAGP)
Self-injurious behavior  (IAGP)
Short foot  (IAGP)
Short palm  (IAGP)
Short palpebral fissure  (IAGP)
Short stature  (IAGP)
Skin-picking  (IAGP)
Sleep apnea  (IAGP)
Small for gestational age  (IAGP)
Small hand  (IAGP)
Small pituitary gland  (IAGP)
Specific learning disability  (IAGP)
Speech articulation difficulties  (IAGP)
Sporadic  (IAGP)
Strabismus  (IAGP)
Syndactyly  (IAGP)
Tapered finger  (IAGP)
Temperature instability  (IAGP)
Thick eyebrow  (IAGP)
Thin upper lip vermilion  (IAGP)
Type II diabetes mellitus  (IAGP)
Upslanted palpebral fissure  (IAGP)
Ventriculomegaly  (IAGP)
Weak cry  (IAGP)
Xerostomia  (IAGP)
References

Additional References at PubMed
PMID:10556298   PMID:10915770   PMID:12477932   PMID:20301505   PMID:20467835   PMID:20864041   PMID:21873635   PMID:23452853   PMID:24076603   PMID:25231870   PMID:25590999   PMID:25926624  
PMID:26365340   PMID:27195816   PMID:28281571   PMID:28973533   PMID:29343559   PMID:29389715   PMID:29599419   PMID:31114935   PMID:31397880   PMID:31504653   PMID:32296183   PMID:32879135  
PMID:33570896  


Genomics

Comparative Map Data
MAGEL2
(Homo sapiens - human)
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 Ensembl1523,643,549 - 23,647,867 (-)EnsemblGRCh38hg38GRCh38
GRCh381523,643,549 - 23,647,867 (-)NCBIGRCh38GRCh38hg38GRCh38
GRCh371523,888,696 - 23,893,014 (-)NCBIGRCh37GRCh37hg19GRCh37
Build 361521,439,789 - 21,442,268 (-)NCBINCBI36hg18NCBI36
Build 341521,439,787 - 21,442,082NCBI
Celera152,049,600 - 2,053,898 (-)NCBI
Cytogenetic Map15q11.2NCBI
HuRef152,024,179 - 2,028,378 (-)NCBIHuRef
CHM1_11523,838,991 - 23,843,288 (-)NCBICHM1_1
Magel2
(Mus musculus - house mouse)
Mouse AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCm39762,026,727 - 62,031,388 (+)NCBIGRCm39mm39
GRCm39 Ensembl762,026,758 - 62,031,388 (+)Ensembl
GRCm38762,376,979 - 62,381,640 (+)NCBIGRCm38GRCm38mm10GRCm38
GRCm38.p6 Ensembl762,377,010 - 62,381,640 (+)EnsemblGRCm38mm10GRCm38
MGSCv37769,521,865 - 69,526,526 (+)NCBIGRCm37mm9NCBIm37
MGSCv36762,255,929 - 62,260,590 (+)NCBImm8
MGSCv36751,738,184 - 51,742,845 (+)NCBImm8
Cytogenetic Map7CNCBI
cM Map734.37NCBI
Magel2
(Rattus norvegicus - Norway rat)
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
mRatBN7.21115,880,137 - 115,884,680 (+)NCBI
Rnor_6.0 Ensembl1123,015,746 - 123,019,522 (+)EnsemblRnor6.0rn6Rnor6.0
Rnor_6.01123,015,404 - 123,019,945 (+)NCBIRnor6.0Rnor_6.0rn6Rnor6.0
Rnor_5.01124,153,036 - 124,157,563 (+)NCBIRnor5.0Rnor_5.0rn5Rnor5.0
RGSC_v3.41116,625,779 - 116,629,840 (+)NCBIRGSC3.4rn4RGSC3.4
Celera1108,150,946 - 108,155,487 (+)NCBICelera
Cytogenetic Map1q22NCBI
Magel2
(Chinchilla lanigera - long-tailed chinchilla)
Chinchilla AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChiLan1.0 EnsemblNW_00495541631,091,151 - 31,095,484 (-)EnsemblChiLan1.0
ChiLan1.0NW_00495541631,091,306 - 31,095,420 (-)NCBIChiLan1.0ChiLan1.0
MAGEL2
(Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
PanPan1.11521,134,414 - 21,138,669 (-)NCBIpanpan1.1PanPan1.1panPan2
PanPan1.1 Ensembl1521,134,857 - 21,138,576 (-)Ensemblpanpan1.1panPan2
Mhudiblu_PPA_v0156,017,523 - 6,021,849 (+)NCBIMhudiblu_PPA_v0panPan3
MAGEL2
(Canis lupus familiaris - dog)
Dog AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
CanFam3.1336,362,021 - 36,366,326 (+)NCBICanFam3.1CanFam3.1canFam3CanFam3.1
CanFam3.1 Ensembl336,363,930 - 36,365,870 (+)EnsemblCanFam3.1canFam3CanFam3.1
Dog10K_Boxer_Tasha339,029,381 - 39,033,531 (+)NCBI
ROS_Cfam_1.0336,752,449 - 36,756,599 (+)NCBI
UMICH_Zoey_3.1336,257,544 - 36,261,691 (+)NCBI
UNSW_CanFamBas_1.0336,520,865 - 36,525,015 (+)NCBI
UU_Cfam_GSD_1.0336,665,224 - 36,669,374 (+)NCBI
Magel2
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)
Squirrel AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HiC_Itri_2NW_024408640124,542,205 - 124,546,345 (+)NCBI
SpeTri2.0NW_004936805882,296 - 886,442 (+)NCBISpeTri2.0SpeTri2.0SpeTri2.0
MAGEL2
(Sus scrofa - pig)
Pig AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Sscrofa11.1 Ensembl1142,448,689 - 142,454,697 (+)EnsemblSscrofa11.1susScr11Sscrofa11.1
Sscrofa11.11142,450,414 - 142,454,633 (+)NCBISscrofa11.1Sscrofa11.1susScr11Sscrofa11.1
Sscrofa10.21158,313,180 - 158,317,249 (+)NCBISscrofa10.2Sscrofa10.2susScr3
MAGEL2
(Chlorocebus sabaeus - green monkey)
Green Monkey AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChlSab1.12657,975,936 - 57,980,492 (+)NCBI
Vero_WHO_p1.0NW_02366605440,979,010 - 40,983,470 (+)NCBI
Magel2
(Heterocephalus glaber - naked mole-rat)
Naked Mole-rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HetGla 1.0NW_004624768613,396 - 618,222 (+)NCBI

Position Markers
MAGEL2_358  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371523,888,610 - 23,889,444UniSTSGRCh37
Build 361521,439,703 - 21,440,537RGDNCBI36
Celera152,049,514 - 2,050,348RGD
HuRef152,024,093 - 2,024,927UniSTS

miRNA Target Status

Predicted Target Of
Summary Value
Count of predictions:152
Count of miRNA genes:143
Interacting mature miRNAs:147
Transcripts:ENST00000532292
Prediction methods:Miranda, Rnahybrid
Result types:miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.


Expression


RNA-SEQ Expression
High: > 1000 TPM value   Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM   Below Cutoff: < 0.5 TPM

alimentary part of gastrointestinal system circulatory system endocrine system exocrine system hemolymphoid system hepatobiliary system integumental system musculoskeletal system nervous system renal system reproductive system respiratory system sensory system adipose tissue appendage entire extraembryonic component
High
Medium 217 37 3 458 7 45 6 1
Low 475 110 719 36 159 18 761 116 2253 29 997 690 20 452 410 1
Below cutoff 1767 2037 515 347 474 203 3166 1840 949 127 236 639 144 749 2051 2

Sequence


Reference Sequences
RefSeq Acc Id: ENST00000650528   ⟹   ENSP00000497810
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1523,643,549 - 23,647,867 (-)Ensembl
RefSeq Acc Id: NM_019066   ⟹   NP_061939
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381523,643,549 - 23,647,867 (-)NCBI
GRCh371523,888,696 - 23,892,993 (-)RGD
GRCh371523,888,696 - 23,892,993 (-)NCBI
Build 361521,439,789 - 21,442,268 (-)NCBI Archive
Celera152,049,600 - 2,053,898 (-)RGD
HuRef152,024,179 - 2,028,378 (-)RGD
CHM1_11523,838,991 - 23,843,288 (-)NCBI
Sequence:
Reference Sequences
RefSeq Acc Id: NP_061939   ⟸   NM_019066
- UniProtKB: Q9UJ55 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: ENSP00000497810   ⟸   ENST00000650528
Protein Domains
MAGE


Clinical Variants
Name Type Condition(s) Position(s) Clinical significance
NM_019066.5(MAGEL2):c.2501T>C (p.Val834Ala) single nucleotide variant not provided [RCV000520743] Chr15:23645242 [GRCh38]
Chr15:23890389 [GRCh37]
Chr15:15q11.2
uncertain significance
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x3 copy number gain See cases [RCV000050782] Chr15:22358243..28481444 [GRCh38]
Chr15:22698522..29030517 [GRCh37]
Chr15:20249886..26829558 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.367C>G (p.Pro123Ala) single nucleotide variant not provided [RCV000729033] Chr15:23647376 [GRCh38]
Chr15:23892523 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.427C>T (p.Pro143Ser) single nucleotide variant not provided [RCV000729034] Chr15:23647316 [GRCh38]
Chr15:23892463 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1719_1730dup (p.570_573LSAP[3]) duplication not provided [RCV000520816] Chr15:23646012..23646013 [GRCh38]
Chr15:23891159..23891160 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1996dup (p.Gln666fs) duplication Inborn genetic diseases [RCV000622753]|Schaaf-Yang syndrome [RCV000170356]|not provided [RCV000380351] Chr15:23645746..23645747 [GRCh38]
Chr15:23890893..23890894 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.1652del (p.Val551fs) deletion Schaaf-Yang syndrome [RCV000074484] Chr15:23646091 [GRCh38]
Chr15:23891238 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.1802del (p.Pro601fs) deletion Schaaf-Yang syndrome [RCV000074485] Chr15:23645941 [GRCh38]
Chr15:23891088 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.3181_3182del (p.Ile1061fs) microsatellite Schaaf-Yang syndrome [RCV000074486] Chr15:23644561..23644562 [GRCh38]
Chr15:23889708..23889709 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.3124C>T (p.Gln1042Ter) single nucleotide variant Schaaf-Yang syndrome [RCV000074487]|not provided [RCV000285006] Chr15:23644619 [GRCh38]
Chr15:23889766 [GRCh37]
Chr15:15q11.2
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28785371)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000050781]|Global developmental delay [RCV000050782]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000050781]|See cases [RCV000050782] Chr15:23319714..28785371 [GRCh38]
Chr15:22698522..29030517 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x1 copy number loss See cases [RCV000050783] Chr15:22358243..28481444 [GRCh38]
Chr15:22698522..29030517 [GRCh37]
Chr15:20249886..26829558 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23411789-28314256)x1 copy number loss See cases [RCV000050850] Chr15:23411789..28314256 [GRCh38]
Chr15:23656936..28557186 [GRCh37]
Chr15:21208377..26232997 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23411789-28275167)x3 copy number gain See cases [RCV000050557] Chr15:23411789..28275167 [GRCh38]
Chr15:23656936..28520313 [GRCh37]
Chr15:21208377..26193908 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23411789-28275167)x1 copy number loss See cases [RCV000050559] Chr15:23411789..28275167 [GRCh38]
Chr15:23656936..28520313 [GRCh37]
Chr15:21208377..26193908 [NCBI36]
Chr15:15q11.2-13.1
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28275167)x1 copy number loss See cases [RCV000050742] Chr15:23319714..28275167 [GRCh38]
Chr15:23300238..28520313 [GRCh37]
Chr15:20851679..26193908 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23462305-28275167)x1 copy number loss See cases [RCV000050733] Chr15:23462305..28275167 [GRCh38]
Chr15:23707452..28520313 [GRCh37]
Chr15:21258545..26193908 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.3(chr15:23319714-32607357)x3 copy number gain See cases [RCV000051112] Chr15:23319714..32607357 [GRCh38]
Chr15:22698522..32899558 [GRCh37]
Chr15:20249886..30686850 [NCBI36]
Chr15:15q11.2-13.3
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28314256)x1 copy number loss See cases [RCV000051053] Chr15:23319714..28314256 [GRCh38]
Chr15:23300238..28557186 [GRCh37]
Chr15:20851679..26232997 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28681287)x3 copy number gain See cases [RCV000051813] Chr15:23319714..28681287 [GRCh38]
Chr15:23510051..28926433 [GRCh37]
Chr15:21061492..26725474 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23320410-28460005)x3 copy number gain See cases [RCV000051814] Chr15:23320410..28460005 [GRCh38]
Chr15:23565551..28812483 [GRCh37]
Chr15:21116992..26611524 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23411589-28446455)x3 copy number gain See cases [RCV000051816] Chr15:23411589..28446455 [GRCh38]
Chr15:23656736..28691601 [GRCh37]
Chr15:21208177..26365196 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23411789-28281294)x3 copy number gain See cases [RCV000051818] Chr15:23411789..28281294 [GRCh38]
Chr15:23656936..28526440 [GRCh37]
Chr15:21208377..26200035 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.2(chr15:23319714-30109283)x1 copy number loss See cases [RCV000052353] Chr15:23319714..30109283 [GRCh38]
Chr15:22669052..30401486 [GRCh37]
Chr15:20220416..28188778 [NCBI36]
Chr15:15q11.2-13.2
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28275308)x1 copy number loss See cases [RCV000052355] Chr15:23319714..28275308 [GRCh38]
Chr15:22698322..28520454 [GRCh37]
Chr15:20249686..26194049 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28446314)x1 copy number loss See cases [RCV000052356] Chr15:23319714..28446314 [GRCh38]
Chr15:22698522..28691460 [GRCh37]
Chr15:20249886..26365055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28275167)x1 copy number loss See cases [RCV000052357] Chr15:23319714..28275167 [GRCh38]
Chr15:22698522..28520313 [GRCh37]
Chr15:20249886..26193908 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28197267)x1 copy number loss See cases [RCV000052358] Chr15:23319714..28197267 [GRCh38]
Chr15:22779922..28442413 [GRCh37]
Chr15:20331286..26116008 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23411789-28446314)x1 copy number loss Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052400]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052400]|See cases [RCV000052400] Chr15:23411789..28446314 [GRCh38]
Chr15:23656936..28691460 [GRCh37]
Chr15:21208377..26365055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23450287-28446314)x1 copy number loss See cases [RCV000052402] Chr15:23450287..28446314 [GRCh38]
Chr15:23695434..28691460 [GRCh37]
Chr15:21246527..26365055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23462105-28275308)x1 copy number loss See cases [RCV000052403] Chr15:23462105..28275308 [GRCh38]
Chr15:23707252..28520454 [GRCh37]
Chr15:21258345..26194049 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23462305-28190742)x1 copy number loss See cases [RCV000052406] Chr15:23462305..28190742 [GRCh38]
Chr15:23707452..28435888 [GRCh37]
Chr15:21258545..26109483 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23494211-28281294)x1 copy number loss See cases [RCV000052409] Chr15:23494211..28281294 [GRCh38]
Chr15:23739358..28526440 [GRCh37]
Chr15:21290451..26200035 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23537429-28269468)x1 copy number loss See cases [RCV000052410] Chr15:23537429..28269468 [GRCh38]
Chr15:23782576..28514614 [GRCh37]
Chr15:21333669..26188209 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23537429-28275167)x1 copy number loss See cases [RCV000052411] Chr15:23537429..28275167 [GRCh38]
Chr15:23782576..28520313 [GRCh37]
Chr15:21333669..26193908 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.1-13.2(chr15:20002460-30349193)x3 copy number gain See cases [RCV000052339] Chr15:20002460..30349193 [GRCh38]
Chr15:20207713..30641396 [GRCh37]
Chr15:18467727..28428688 [NCBI36]
Chr15:15q11.1-13.2
pathogenic
GRCh38/hg38 15q11.1-13.3(chr15:20002460-32121422)x3 copy number gain See cases [RCV000052340] Chr15:20002460..32121422 [GRCh38]
Chr15:20207713..32413623 [GRCh37]
Chr15:18467727..30200915 [NCBI36]
Chr15:15q11.1-13.3
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22030646-28694952)x1 copy number loss See cases [RCV000052345] Chr15:22030646..28694952 [GRCh38]
Chr15:22318597..28940098 [GRCh37]
Chr15:19819961..26739139 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23337069-28272443)x1 copy number loss See cases [RCV000052372] Chr15:23337069..28272443 [GRCh38]
Chr15:23582216..28517589 [GRCh37]
Chr15:21133657..26191184 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23375083-28197267)x1 copy number loss See cases [RCV000052374] Chr15:23375083..28197267 [GRCh38]
Chr15:23620230..28442413 [GRCh37]
Chr15:21171671..26116008 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.2(chr15:22144677-30349193)x1 copy number loss See cases [RCV000052348] Chr15:22144677..30349193 [GRCh38]
Chr15:22432628..30641396 [GRCh37]
Chr15:19933992..28428688 [NCBI36]
Chr15:15q11.2-13.2
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23375083-28272443)x1 copy number loss See cases [RCV000052376] Chr15:23375083..28272443 [GRCh38]
Chr15:23620230..28517589 [GRCh37]
Chr15:21171671..26191184 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23398620-28190742)x3 copy number gain See cases [RCV000052378] Chr15:23398620..28190742 [GRCh38]
Chr15:23643767..28435888 [GRCh37]
Chr15:21195208..26109483 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23398620-28190742)x1 copy number loss See cases [RCV000052379] Chr15:23398620..28190742 [GRCh38]
Chr15:23643767..28435888 [GRCh37]
Chr15:21195208..26109483 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23398620-28446314)x1 copy number loss See cases [RCV000052380] Chr15:23398620..28446314 [GRCh38]
Chr15:23643767..28691460 [GRCh37]
Chr15:21195208..26365055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23411589-28275308)x1 copy number loss See cases [RCV000052381] Chr15:23411589..28275308 [GRCh38]
Chr15:23656736..28520454 [GRCh37]
Chr15:21208177..26194049 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28190742)x3 copy number gain See cases [RCV000052349] Chr15:23319714..28190742 [GRCh38]
Chr15:22669052..28435888 [GRCh37]
Chr15:20220416..26109483 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28190742)x1 copy number loss See cases [RCV000052350] Chr15:23319714..28190742 [GRCh38]
Chr15:22669052..28435888 [GRCh37]
Chr15:20220416..26109483 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.1-13.1(chr15:19879749-28918517)x3 copy number gain See cases [RCV000052300] Chr15:19879749..28918517 [GRCh38]
Chr15:20085002..29210720 [GRCh37]
Chr15:18345016..26998012 [NCBI36]
Chr15:15q11.1-13.1
pathogenic
GRCh38/hg38 15q11.1-13.1(chr15:19879749-28702163)x4 copy number gain See cases [RCV000052301] Chr15:19879749..28702163 [GRCh38]
Chr15:20085002..28947309 [GRCh37]
Chr15:18345016..26746350 [NCBI36]
Chr15:15q11.1-13.1
pathogenic
GRCh38/hg38 15q11.1-13.1(chr15:19879750-27865713)x3 copy number gain See cases [RCV000052305] Chr15:19879750..27865713 [GRCh38]
Chr15:20085003..28178425 [GRCh37]
Chr15:18345017..25852020 [NCBI36]
Chr15:15q11.1-13.1
pathogenic
GRCh38/hg38 15q11.1-13.1(chr15:19905469-28163751)x3 copy number gain See cases [RCV000052308] Chr15:19905469..28163751 [GRCh38]
Chr15:20110722..28408897 [GRCh37]
Chr15:18370736..26082492 [NCBI36]
Chr15:15q11.1-13.1
pathogenic
GRCh38/hg38 15q11.1-13.1(chr15:20046515-28385894)x3 copy number gain See cases [RCV000053207] Chr15:20046515..28385894 [GRCh38]
Chr15:20251768..28631040 [GRCh37]
Chr15:18511782..26304635 [NCBI36]
Chr15:15q11.1-13.1
pathogenic
GRCh38/hg38 15q11.2-13.3(chr15:23319714-32607498)x4 copy number gain See cases [RCV000053208] Chr15:23319714..32607498 [GRCh38]
Chr15:22698322..32899699 [GRCh37]
Chr15:20249686..30686991 [NCBI36]
Chr15:15q11.2-13.3
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053210]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053210]|See cases [RCV000053210] Chr15:22358243..28481444 [GRCh38]
Chr15:22698322..28940239 [GRCh37]
Chr15:20249686..26739280 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x3 copy number gain Renal adysplasia [RCV000053224]|See cases [RCV000053224] Chr15:22358243..28481444 [GRCh38]
Chr15:22698522..30653936 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-12(chr15:23319714-27051075)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053226]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053226]|See cases [RCV000053226] Chr15:23319714..27051075 [GRCh38]
Chr15:22698522..27296222 [GRCh37]
Chr15:20249886..24878968 [NCBI36]
Chr15:15q11.2-12
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-30527306)x4 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053227]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053227]|See cases [RCV000053227] Chr15:23319714..30527306 [GRCh38]
Chr15:22698522..30819509 [GRCh37]
Chr15:20249886..28606801 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x3 copy number gain See cases [RCV000053229] Chr15:22358243..28481444 [GRCh38]
Chr15:22698522..29085896 [GRCh37]
Chr15:20249886..26884937 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053230]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053230]|See cases [RCV000053230] Chr15:22358243..28481444 [GRCh38]
Chr15:22698522..30366124 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x3 copy number gain See cases [RCV000053231] Chr15:22358243..28481444 [GRCh38]
Chr15:22765428..28940239 [GRCh37]
Chr15:20316792..26739280 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28275167)x3 copy number gain See cases [RCV000053232] Chr15:23319714..28275167 [GRCh38]
Chr15:22765628..28520313 [GRCh37]
Chr15:20316992..26193908 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-30073921)x3 copy number gain See cases [RCV000053233] Chr15:23319714..30073921 [GRCh38]
Chr15:22863854..30366124 [GRCh37]
Chr15:20415295..28153416 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28446455)x3 copy number gain See cases [RCV000053234] Chr15:23319714..28446455 [GRCh38]
Chr15:23300038..28691601 [GRCh37]
Chr15:20851479..26365196 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28275308)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053235]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053235]|See cases [RCV000053235] Chr15:23319714..28275308 [GRCh38]
Chr15:23300038..28520454 [GRCh37]
Chr15:20851479..26194049 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.3017C>G (p.Thr1006Ser) single nucleotide variant Prader-Willi syndrome [RCV000755643]|not provided [RCV000421322]|not specified [RCV000173469] Chr15:23644726 [GRCh38]
Chr15:23889873 [GRCh37]
Chr15:15q11.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_019066.5(MAGEL2):c.2074G>A (p.Val692Ile) single nucleotide variant not provided [RCV000514579]|not specified [RCV000173470] Chr15:23645669 [GRCh38]
Chr15:23890816 [GRCh37]
Chr15:15q11.2
benign|likely benign
NM_019066.5(MAGEL2):c.901C>T (p.Pro301Ser) single nucleotide variant not provided [RCV000870801]|not specified [RCV000173473] Chr15:23646842 [GRCh38]
Chr15:23891989 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.2784C>T (p.Ile928=) single nucleotide variant not provided [RCV000870956]|not specified [RCV000173479] Chr15:23644959 [GRCh38]
Chr15:23890106 [GRCh37]
Chr15:15q11.2
benign
NM_019066.4(MAGEL2):c.2594C>T (p.Thr865Ile) single nucleotide variant Malignant melanoma [RCV000070696] Chr15:23645149 [GRCh38]
Chr15:23890296 [GRCh37]
Chr15:21441389 [NCBI36]
Chr15:15q11.2
not provided
NM_019066.4(MAGEL2):c.2372C>T (p.Pro791Leu) single nucleotide variant Malignant melanoma [RCV000070697] Chr15:23645371 [GRCh38]
Chr15:23890518 [GRCh37]
Chr15:21441611 [NCBI36]
Chr15:15q11.2
not provided
NM_019066.5(MAGEL2):c.2982_2983del (p.Glu995fs) deletion not provided [RCV000657540] Chr15:23644760..23644761 [GRCh38]
Chr15:23889907..23889908 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.1912C>T (p.Gln638Ter) single nucleotide variant Inborn genetic diseases [RCV000190699]|Prader-Willi syndrome [RCV000762935]|Schaaf-Yang syndrome [RCV000508676]|not provided [RCV000238706] Chr15:23645831 [GRCh38]
Chr15:23890978 [GRCh37]
Chr15:15q11.2
pathogenic|likely pathogenic
NM_019066.5(MAGEL2):c.2281G>C (p.Ala761Pro) single nucleotide variant not provided [RCV000515006] Chr15:23645462 [GRCh38]
Chr15:23890609 [GRCh37]
Chr15:15q11.2
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019066.5(MAGEL2):c.1175C>T (p.Thr392Met) single nucleotide variant Autistic behavior [RCV001281523]|not provided [RCV000173476] Chr15:23646568 [GRCh38]
Chr15:23891715 [GRCh37]
Chr15:15q11.2
conflicting interpretations of pathogenicity|uncertain significance
NM_019066.5(MAGEL2):c.448T>C (p.Ser150Pro) single nucleotide variant not provided [RCV000173477] Chr15:23647295 [GRCh38]
Chr15:23892442 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.42G>A (p.Pro14=) single nucleotide variant not provided [RCV000173478] Chr15:23647701 [GRCh38]
Chr15:23892848 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.474A>G (p.Pro158=) single nucleotide variant not provided [RCV000173480] Chr15:23647269 [GRCh38]
Chr15:23892416 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.406G>A (p.Gly136Arg) single nucleotide variant not provided [RCV000173481] Chr15:23647337 [GRCh38]
Chr15:23892484 [GRCh37]
Chr15:15q11.2
conflicting interpretations of pathogenicity|uncertain significance
NM_019066.5(MAGEL2):c.479CCCATCCTCCTCCTCCGGGGACCCCGATGG[1] (p.160AHPPPPGTPM[1]) microsatellite not provided [RCV000173482] Chr15:23647205..23647234 [GRCh38]
Chr15:23892352..23892381 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.2738C>T (p.Pro913Leu) single nucleotide variant not provided [RCV000173483] Chr15:23645005 [GRCh38]
Chr15:23890152 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1304C>T (p.Pro435Leu) single nucleotide variant not provided [RCV000865359]|not specified [RCV000173484] Chr15:23646439 [GRCh38]
Chr15:23891586 [GRCh37]
Chr15:15q11.2
benign|uncertain significance
NM_019066.5(MAGEL2):c.2660G>A (p.Arg887Gln) single nucleotide variant Schaaf-Yang syndrome [RCV000662115]|not provided [RCV000173485] Chr15:23645083 [GRCh38]
Chr15:23890230 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.2919G>A (p.Pro973=) single nucleotide variant not provided [RCV000173486] Chr15:23644824 [GRCh38]
Chr15:23889971 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.3570G>A (p.Leu1190=) single nucleotide variant not provided [RCV000173487] Chr15:23644173 [GRCh38]
Chr15:23889320 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1079C>T (p.Ala360Val) single nucleotide variant not provided [RCV000173468]|not specified [RCV000259133] Chr15:23646664 [GRCh38]
Chr15:23891811 [GRCh37]
Chr15:15q11.2
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019066.5(MAGEL2):c.1286C>T (p.Pro429Leu) single nucleotide variant not provided [RCV000724119]|not specified [RCV000173471] Chr15:23646457 [GRCh38]
Chr15:23891604 [GRCh37]
Chr15:15q11.2
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019066.5(MAGEL2):c.1423G>T (p.Ala475Ser) single nucleotide variant not provided [RCV000173472] Chr15:23646320 [GRCh38]
Chr15:23891467 [GRCh37]
Chr15:15q11.2
conflicting interpretations of pathogenicity|uncertain significance
NM_019066.5(MAGEL2):c.1344ACCCGTGATCCGCCAGGCCCC[1] (p.442PVIRQAP[2]) microsatellite not provided [RCV000513935] Chr15:23646358..23646378 [GRCh38]
Chr15:23891505..23891525 [GRCh37]
Chr15:15q11.2
conflicting interpretations of pathogenicity|uncertain significance
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x4 copy number gain See cases [RCV000050781] Chr15:22358243..28481444 [GRCh38]
Chr15:22698522..29030517 [GRCh37]
Chr15:20249886..26829558 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-30361733)x3 copy number gain See cases [RCV000053224] Chr15:23319714..30361733 [GRCh38]
Chr15:22698522..30653936 [GRCh37]
Chr15:20249886..28441228 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-30073921)x3 copy number gain See cases [RCV000053230] Chr15:23319714..30073921 [GRCh38]
Chr15:22698522..30366124 [GRCh37]
Chr15:20249886..28153416 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.2611G>T (p.Ala871Ser) single nucleotide variant not provided [RCV000514433]|not specified [RCV000146263] Chr15:23645132 [GRCh38]
Chr15:23890279 [GRCh37]
Chr15:15q11.2
benign|likely benign
NM_019066.5(MAGEL2):c.2612C>T (p.Ala871Val) single nucleotide variant not provided [RCV000514827]|not specified [RCV000146264] Chr15:23645131 [GRCh38]
Chr15:23890278 [GRCh37]
Chr15:15q11.2
benign|likely benign
NM_019066.5(MAGEL2):c.3151C>A (p.Leu1051Ile) single nucleotide variant not specified [RCV000146265] Chr15:23644592 [GRCh38]
Chr15:23889739 [GRCh37]
Chr15:15q11.2
benign|likely benign|conflicting interpretations of pathogenicity
NM_019066.5(MAGEL2):c.3229T>C (p.Leu1077=) single nucleotide variant not provided [RCV000872451]|not specified [RCV000146266] Chr15:23644514 [GRCh38]
Chr15:23889661 [GRCh37]
Chr15:15q11.2
benign|likely benign
NM_019066.5(MAGEL2):c.383T>C (p.Leu128Pro) single nucleotide variant not provided [RCV000876337]|not specified [RCV000146267] Chr15:23647360 [GRCh38]
Chr15:23892507 [GRCh37]
Chr15:15q11.2
benign|likely benign|conflicting interpretations of pathogenicity
GRCh38/hg38 15q11.2-13.1(chr15:23462288-28694922)x1 copy number loss See cases [RCV000134719] Chr15:23462288..28694922 [GRCh38]
Chr15:23707435..28940068 [GRCh37]
Chr15:21258528..26739109 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23439508-28154050)x1 copy number loss See cases [RCV000134437] Chr15:23439508..28154050 [GRCh38]
Chr15:23684655..28399196 [GRCh37]
Chr15:21236096..26072791 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23462288-28275170)x1 copy number loss See cases [RCV000134053] Chr15:23462288..28275170 [GRCh38]
Chr15:23707435..28520316 [GRCh37]
Chr15:21258528..26193911 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23462288-28314291)x1 copy number loss See cases [RCV000134115] Chr15:23462288..28314291 [GRCh38]
Chr15:23707435..28557186 [GRCh37]
Chr15:21258528..26233032 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28275170)x3 copy number gain See cases [RCV000134062] Chr15:23319714..28275170 [GRCh38]
Chr15:22765637..28520316 [GRCh37]
Chr15:20317001..26193911 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28347620)x1 copy number loss See cases [RCV000134074] Chr15:23319714..28347620 [GRCh38]
Chr15:23353638..28592766 [GRCh37]
Chr15:20905079..26266361 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x1 copy number loss See cases [RCV000134082] Chr15:22358243..28481444 [GRCh38]
Chr15:22652047..28705151 [GRCh37]
Chr15:20203411..26524679 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28154050)x1 copy number loss See cases [RCV000135313] Chr15:23328044..28154050 [GRCh38]
Chr15:22860857..28399196 [GRCh37]
Chr15:20412298..26072791 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23410917-28275170)x1 copy number loss See cases [RCV000134776] Chr15:23410917..28275170 [GRCh38]
Chr15:23656064..28520316 [GRCh37]
Chr15:21207505..26193911 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x1 copy number loss See cases [RCV000134755] Chr15:22358243..28481444 [GRCh38]
Chr15:22765637..29085888 [GRCh37]
Chr15:20317001..26884929 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x3 copy number gain See cases [RCV000134756] Chr15:22358243..28481444 [GRCh38]
Chr15:22765637..29085888 [GRCh37]
Chr15:20317001..26884929 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-30361733)x4 copy number gain See cases [RCV000135743] Chr15:23319714..30361733 [GRCh38]
Chr15:22698522..30653936 [GRCh37]
Chr15:20249886..28441228 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x1 copy number loss See cases [RCV000135744] Chr15:22358243..28481444 [GRCh38]
Chr15:22698522..29085896 [GRCh37]
Chr15:20249886..26884937 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-30073921)x4 copy number gain See cases [RCV000135745] Chr15:23319714..30073921 [GRCh38]
Chr15:22698522..30366124 [GRCh37]
Chr15:20249886..28153416 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28314256)x1 copy number loss See cases [RCV000135860] Chr15:23319714..28314256 [GRCh38]
Chr15:22698522..28557186 [GRCh37]
Chr15:20249886..26232997 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x4 copy number gain See cases [RCV000135583] Chr15:22358243..28481444 [GRCh38]
Chr15:22698522..28940098 [GRCh37]
Chr15:20249886..26739139 [NCBI36]
Chr15:15q11.2-13.1
pathogenic|uncertain significance
GRCh38/hg38 15q11.2-13.1(chr15:23462305-28275167)x3 copy number gain See cases [RCV000135505] Chr15:23462305..28275167 [GRCh38]
Chr15:23707452..28520313 [GRCh37]
Chr15:21258545..26193908 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28275167)x3 copy number gain See cases [RCV000135506] Chr15:23319714..28275167 [GRCh38]
Chr15:23300238..28520313 [GRCh37]
Chr15:20851679..26193908 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.2(chr15:23319714-30073876)x4 copy number gain See cases [RCV000135973] Chr15:23319714..30073876 [GRCh38]
Chr15:22765637..30366079 [GRCh37]
Chr15:20317001..28153371 [NCBI36]
Chr15:15q11.2-13.2
pathogenic
GRCh38/hg38 15q11.2-14(chr15:23319714-38089582)x1 copy number loss See cases [RCV000135953] Chr15:23319714..38089582 [GRCh38]
Chr15:22698522..38381783 [GRCh37]
Chr15:20249886..36169075 [NCBI36]
Chr15:15q11.2-14
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23462105-28290061)x1 copy number loss See cases [RCV000135892] Chr15:23462105..28290061 [GRCh38]
Chr15:23707252..28535207 [GRCh37]
Chr15:21258345..26208802 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23462305-28694952)x3 copy number gain See cases [RCV000137064] Chr15:23462305..28694952 [GRCh38]
Chr15:23707452..28940098 [GRCh37]
Chr15:21258545..26739139 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28314256)x3 copy number gain See cases [RCV000137099] Chr15:23319714..28314256 [GRCh38]
Chr15:22765628..28557186 [GRCh37]
Chr15:20316992..26232997 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23462305-28314256)x1 copy number loss See cases [RCV000136950] Chr15:23462305..28314256 [GRCh38]
Chr15:23707452..28557186 [GRCh37]
Chr15:21258545..26232997 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28314256)x4 copy number gain See cases [RCV000137100] Chr15:23319714..28314256 [GRCh38]
Chr15:22765628..28559402 [GRCh37]
Chr15:20316992..26232997 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.1-13.2(chr15:20480943-30217181)x3 copy number gain See cases [RCV000136964] Chr15:20480943..30217181 [GRCh38]
Chr15:20686196..30509384 [GRCh37]
Chr15:18946210..28296676 [NCBI36]
Chr15:15q11.1-13.2
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28280314)x1 copy number loss See cases [RCV000136811] Chr15:23319714..28280314 [GRCh38]
Chr15:22784523..28525460 [GRCh37]
Chr15:20335887..26199055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23454554-28280314)x1 copy number loss See cases [RCV000136734] Chr15:23454554..28280314 [GRCh38]
Chr15:23699701..28525460 [GRCh37]
Chr15:21250794..26199055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23411789-28280314)x3 copy number gain See cases [RCV000136752] Chr15:23411789..28280314 [GRCh38]
Chr15:23656936..28525460 [GRCh37]
Chr15:21208377..26199055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.2(chr15:23319714-30361733)x4 copy number gain See cases [RCV000137578] Chr15:23319714..30361733 [GRCh38]
Chr15:22765628..30653936 [GRCh37]
Chr15:20316992..28441228 [NCBI36]
Chr15:15q11.2-13.2
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-30073921)x4 copy number gain See cases [RCV000137630] Chr15:23319714..30073921 [GRCh38]
Chr15:22765628..30366124 [GRCh37]
Chr15:20316992..28153416 [NCBI36]
Chr15:15q11.2-13.1
pathogenic|conflicting data from submitters
GRCh38/hg38 15q11.2-13.1(chr15:23422864-28280314)x3 copy number gain See cases [RCV000137393] Chr15:23422864..28280314 [GRCh38]
Chr15:23668011..28525460 [GRCh37]
Chr15:21219452..26199055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23422864-28280314)x1 copy number loss See cases [RCV000137394] Chr15:23422864..28280314 [GRCh38]
Chr15:23668011..28525460 [GRCh37]
Chr15:21219452..26199055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic|conflicting data from submitters
GRCh38/hg38 15q11.2-13.1(chr15:23523934-28280314)x1 copy number loss See cases [RCV000137270] Chr15:23523934..28280314 [GRCh38]
Chr15:23769081..28525460 [GRCh37]
Chr15:21320174..26199055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic|likely pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x4 copy number gain See cases [RCV000138132] Chr15:22358243..28481444 [GRCh38]
Chr15:22765628..29006852 [GRCh37]
Chr15:20316992..26805893 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x3 copy number gain See cases [RCV000138133] Chr15:22358243..28481444 [GRCh38]
Chr15:22765628..29006852 [GRCh37]
Chr15:20316992..26805893 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x4 copy number gain See cases [RCV000137945] Chr15:22358243..28481444 [GRCh38]
Chr15:22765628..28912057 [GRCh37]
Chr15:20316992..26711098 [NCBI36]
Chr15:15q11.2-13.1
pathogenic|likely benign
GRCh38/hg38 15q11.2-13.1(chr15:23422864-28314256)x1 copy number loss See cases [RCV000137953] Chr15:23422864..28314256 [GRCh38]
Chr15:23668011..28557186 [GRCh37]
Chr15:21219452..26232997 [NCBI36]
Chr15:15q11.2-13.1
pathogenic|conflicting data from submitters
GRCh38/hg38 15q11.2-12(chr15:23319714-25980547)x3 copy number gain See cases [RCV000137911] Chr15:23319714..25980547 [GRCh38]
Chr15:23179889..26225694 [GRCh37]
Chr15:20731330..23776787 [NCBI36]
Chr15:15q11.2-12
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23462288-28446301)x1 copy number loss See cases [RCV000138857] Chr15:23462288..28446301 [GRCh38]
Chr15:23707435..28691447 [GRCh37]
Chr15:21258528..26365042 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-32607357)x3 copy number gain See cases [RCV000138622] Chr15:23319714..32607357 [GRCh38]
Chr15:22765637..32899558 [GRCh37]
Chr15:20317001..30686850 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-14(chr15:23319714-38545325)x3 copy number gain See cases [RCV000138530] Chr15:23319714..38545325 [GRCh38]
Chr15:22765628..38837526 [GRCh37]
Chr15:20316992..36624818 [NCBI36]
Chr15:15q11.2-14
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-32384654)x1 copy number loss See cases [RCV000138308] Chr15:23319714..32384654 [GRCh38]
Chr15:22765628..32676855 [GRCh37]
Chr15:20316992..30464147 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23410917-28446301)x1 copy number loss See cases [RCV000139335] Chr15:23410917..28446301 [GRCh38]
Chr15:23656064..28691447 [GRCh37]
Chr15:21207505..26365042 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-31175232)x3 copy number gain See cases [RCV000139101] Chr15:23319714..31175232 [GRCh38]
Chr15:22765637..31467435 [GRCh37]
Chr15:20317001..29254727 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28446301)x3 copy number gain See cases [RCV000139162] Chr15:23319714..28446301 [GRCh38]
Chr15:23300254..28691447 [GRCh37]
Chr15:20851695..26365042 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28638603)x4 copy number gain See cases [RCV000139948] Chr15:23328044..28638603 [GRCh38]
Chr15:22652060..28883749 [GRCh37]
Chr15:20203424..26682790 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23370621-28289312)x1 copy number loss See cases [RCV000139980] Chr15:23370621..28289312 [GRCh38]
Chr15:23615768..28534458 [GRCh37]
Chr15:21167209..26208053 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23375044-28300209)x1 copy number loss See cases [RCV000139986] Chr15:23375044..28300209 [GRCh38]
Chr15:23620191..28545355 [GRCh37]
Chr15:21171632..26218950 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x1 copy number loss See cases [RCV000140240] Chr15:22358243..28481444 [GRCh38]
Chr15:22765628..28940098 [GRCh37]
Chr15:20316992..26739139 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28578576)x1 copy number loss See cases [RCV000140454] Chr15:23328044..28578576 [GRCh38]
Chr15:22770421..28823722 [GRCh37]
Chr15:20321785..26622763 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-32217731)x3 copy number gain See cases [RCV000139610] Chr15:23319714..32217731 [GRCh38]
Chr15:22765637..32509932 [GRCh37]
Chr15:20317001..30297224 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x1 copy number loss See cases [RCV000141251] Chr15:22358243..28481444 [GRCh38]
Chr15:22765628..28976193 [GRCh37]
Chr15:20316992..26775234 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28446314)x1 copy number loss See cases [RCV000140712] Chr15:23319714..28446314 [GRCh38]
Chr15:22765628..28691460 [GRCh37]
Chr15:20316992..26365055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x3 copy number gain See cases [RCV000140871] Chr15:22358243..28481444 [GRCh38]
Chr15:22765628..29096442 [GRCh37]
Chr15:20316992..26895483 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28300209)x1 copy number loss See cases [RCV000140888] Chr15:23328044..28300209 [GRCh38]
Chr15:23286571..28545355 [GRCh37]
Chr15:20838012..26218950 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:21581401-28332641)x3 copy number gain See cases [RCV000140619] Chr15:21581401..28332641 [GRCh38]
Chr15:22304596..28577787 [GRCh37]
Chr15:19805960..26251382 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28154050)x3 copy number gain See cases [RCV000140622] Chr15:23328044..28154050 [GRCh38]
Chr15:23569415..28399196 [GRCh37]
Chr15:21120856..26072791 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.1-13.3(chr15:19840581-32621939)x4 copy number gain See cases [RCV000140623] Chr15:19840581..32621939 [GRCh38]
Chr15:20045834..32914140 [GRCh37]
Chr15:18305848..30701432 [NCBI36]
Chr15:15q11.1-13.3
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23370621-28414765)x1 copy number loss See cases [RCV000141946] Chr15:23370621..28414765 [GRCh38]
Chr15:23615768..28659911 [GRCh37]
Chr15:21167209..26333506 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23370622-28414892)x1 copy number loss See cases [RCV000141728] Chr15:23370622..28414892 [GRCh38]
Chr15:23615769..28660038 [GRCh37]
Chr15:21167210..26333633 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28836775)x1 copy number loss See cases [RCV000141730] Chr15:23328044..28836775 [GRCh38]
Chr15:22770421..29081921 [GRCh37]
Chr15:20321785..26880962 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28315123)x1 copy number loss See cases [RCV000142069] Chr15:23328044..28315123 [GRCh38]
Chr15:22770421..28560269 [GRCh37]
Chr15:20321785..26233864 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28315951)x1 copy number loss See cases [RCV000142233] Chr15:23328044..28315951 [GRCh38]
Chr15:23290786..28561097 [GRCh37]
Chr15:20842227..26234692 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28464569)x1 copy number loss See cases [RCV000142103] Chr15:23328044..28464569 [GRCh38]
Chr15:22770421..28709715 [GRCh37]
Chr15:20321785..26378746 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23370621-28578576)x1 copy number loss See cases [RCV000142234] Chr15:23370621..28578576 [GRCh38]
Chr15:23615768..28823722 [GRCh37]
Chr15:21167209..26622763 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23375044-28300358)x1 copy number loss See cases [RCV000142170] Chr15:23375044..28300358 [GRCh38]
Chr15:23620191..28545504 [GRCh37]
Chr15:21171632..26219099 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28300358)x1 copy number loss See cases [RCV000142132] Chr15:23328044..28300358 [GRCh38]
Chr15:23286571..28545504 [GRCh37]
Chr15:20838012..26219099 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.2(chr15:23328044-30077815)x1 copy number loss See cases [RCV000142046] Chr15:23328044..30077815 [GRCh38]
Chr15:23276605..30370018 [GRCh37]
Chr15:20828046..28157310 [NCBI36]
Chr15:15q11.2-13.2
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23398620-28280314)x3 copy number gain See cases [RCV000142854] Chr15:23398620..28280314 [GRCh38]
Chr15:23643767..28525460 [GRCh37]
Chr15:21195208..26199055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28314256)x1 copy number loss See cases [RCV000142766] Chr15:23319714..28314256 [GRCh38]
Chr15:22765628..28559402 [GRCh37]
Chr15:20316992..26232997 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x3 copy number gain See cases [RCV000142713] Chr15:22358243..28481444 [GRCh38]
Chr15:22765628..29085896 [GRCh37]
Chr15:20316992..26884937 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x1 copy number loss See cases [RCV000142795] Chr15:22358243..28481444 [GRCh38]
Chr15:22765628..28912057 [GRCh37]
Chr15:20316992..26711098 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.2(chr15:23319714-30527306)x4 copy number gain See cases [RCV000142791] Chr15:23319714..30527306 [GRCh38]
Chr15:22765628..30819509 [GRCh37]
Chr15:20316992..28606801 [NCBI36]
Chr15:15q11.2-13.2
pathogenic
GRCh38/hg38 15q11.2-13.2(chr15:23328044-30094350)x4 copy number gain See cases [RCV000143379] Chr15:23328044..30094350 [GRCh38]
Chr15:22770421..30386553 [GRCh37]
Chr15:20321785..28173845 [NCBI36]
Chr15:15q11.2-13.2
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23370622-28389912)x1 copy number loss See cases [RCV000143443] Chr15:23370622..28389912 [GRCh38]
Chr15:23615769..28635058 [GRCh37]
Chr15:21167210..26308653 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23422864-28446314)x1 copy number loss See cases [RCV000143183] Chr15:23422864..28446314 [GRCh38]
Chr15:23668011..28691460 [GRCh37]
Chr15:21219452..26365055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23422864-28460005)x1 copy number loss See cases [RCV000143185] Chr15:23422864..28460005 [GRCh38]
Chr15:23668011..28801348 [GRCh37]
Chr15:21219452..26600389 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28683584)x4 copy number gain See cases [RCV000143291] Chr15:23328044..28683584 [GRCh38]
Chr15:22770421..28928730 [GRCh37]
Chr15:20321785..26727771 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.2(chr15:23328044-30023809)x1 copy number loss See cases [RCV000143226] Chr15:23328044..30023809 [GRCh38]
Chr15:22770422..30316012 [GRCh37]
Chr15:20321786..28103304 [NCBI36]
Chr15:15q11.2-13.2
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x3 copy number gain See cases [RCV000148084] Chr15:22358243..28481444 [GRCh38]
Chr15:22698522..29085896 [GRCh37]
Chr15:20249886..26884937 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28294829)x1 copy number loss See cases [RCV000143702] Chr15:23328044..28294829 [GRCh38]
Chr15:22770421..28539975 [GRCh37]
Chr15:20321785..26213570 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23370622-28300209)x1 copy number loss See cases [RCV000143744] Chr15:23370622..28300209 [GRCh38]
Chr15:23615769..28545355 [GRCh37]
Chr15:21167210..26218950 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x4 copy number gain See cases [RCV000148060] Chr15:22358243..28481444 [GRCh38]
Chr15:22698522..29030517 [GRCh37]
Chr15:20249886..26829558 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:22358243-28481444)x1 copy number loss See cases [RCV000148061] Chr15:22358243..28481444 [GRCh38]
Chr15:22698522..29030517 [GRCh37]
Chr15:20249886..26829558 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23411789-28275167)x3 copy number gain See cases [RCV000148062] Chr15:23411789..28275167 [GRCh38]
Chr15:23656936..28520313 [GRCh37]
Chr15:21208377..26193908 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23444168-28277347)x3 copy number gain See cases [RCV000143666] Chr15:23444168..28277347 [GRCh38]
Chr15:23689315..28522493 [GRCh37]
Chr15:21240408..26196088 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23462305-28275167)x1 copy number loss See cases [RCV000148063] Chr15:23462305..28275167 [GRCh38]
Chr15:23707452..28520313 [GRCh37]
Chr15:21258545..26193908 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.3(chr15:23328044-32151843)x3 copy number gain See cases [RCV000143653] Chr15:23328044..32151843 [GRCh38]
Chr15:23282829..32444044 [GRCh37]
Chr15:20834270..30231336 [NCBI36]
Chr15:15q11.2-13.3
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28713633)x3 copy number gain See cases [RCV000143479] Chr15:23328044..28713633 [GRCh38]
Chr15:22770421..28958779 [GRCh37]
Chr15:20321785..26757820 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23328044-28478308)x1 copy number loss See cases [RCV000143483] Chr15:23328044..28478308 [GRCh38]
Chr15:22770421..28723454 [GRCh37]
Chr15:20321785..26378746 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28275167)x1 copy number loss See cases [RCV000148195] Chr15:23319714..28275167 [GRCh38]
Chr15:23300238..28520313 [GRCh37]
Chr15:20851679..26193908 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23411789-28275167)x1 copy number loss See cases [RCV000148164] Chr15:23411789..28275167 [GRCh38]
Chr15:23656936..28520313 [GRCh37]
Chr15:21208377..26193908 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
GRCh38/hg38 15q11.2-13.1(chr15:23319714-28446314)x1 copy number loss See cases [RCV000148194] Chr15:23319714..28446314 [GRCh38]
Chr15:22698522..28691460 [GRCh37]
Chr15:20249886..26365055 [NCBI36]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.1996C>T (p.Gln666Ter) single nucleotide variant not provided [RCV000254810] Chr15:23645747 [GRCh38]
Chr15:23890894 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.1038G>C (p.Arg346Ser) single nucleotide variant not provided [RCV000870819]|not specified [RCV000194196] Chr15:23646705 [GRCh38]
Chr15:23891852 [GRCh37]
Chr15:15q11.2
benign|conflicting interpretations of pathogenicity|uncertain significance
NM_019066.5(MAGEL2):c.434C>T (p.Pro145Leu) single nucleotide variant not specified [RCV000194460] Chr15:23647309 [GRCh38]
Chr15:23892456 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.2886C>T (p.Ser962=) single nucleotide variant not provided [RCV000865417]|not specified [RCV000195026] Chr15:23644857 [GRCh38]
Chr15:23890004 [GRCh37]
Chr15:15q11.2
benign|likely benign
NC_000015.9:g.(?_23730704)_(28530182_?)del deletion Angelman syndrome [RCV000191153] Chr15:23730704..28530182 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-12(chr15:20848460-27662530)x3 copy number gain See cases [RCV000240207] Chr15:20848460..27662530 [GRCh37]
Chr15:15q11.2-12
pathogenic
GRCh37/hg19 15q11.1-13.3(chr15:20190548-32917857)x4 copy number gain See cases [RCV000240220] Chr15:20190548..32917857 [GRCh37]
Chr15:15q11.1-13.3
pathogenic
Single allele deletion Angelman syndrome [RCV001250749] Chr15:22646692..28964445 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.1761G>A (p.Trp587Ter) single nucleotide variant Schaaf-Yang syndrome [RCV000754907] Chr15:23645982 [GRCh38]
Chr15:23891129 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.1762C>T (p.Gln588Ter) single nucleotide variant Schaaf-Yang syndrome [RCV000754908] Chr15:23645981 [GRCh38]
Chr15:23891128 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.3208G>T (p.Glu1070Ter) single nucleotide variant Schaaf-Yang syndrome [RCV000209903] Chr15:23644535 [GRCh38]
Chr15:23889682 [GRCh37]
Chr15:15q11.2
pathogenic
Single allele duplication Autism spectrum disorder [RCV000225455] Chr15:20044342..28924405 [GRCh37]
Chr15:15q11.1-13.1
pathogenic
Single allele duplication Autism spectrum disorder [RCV000225599] Chr15:23624148..28790734 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
Single allele duplication Autism spectrum disorder [RCV000225663] Chr15:20306549..26208861 [GRCh37]
Chr15:15q11.1-12
pathogenic
NM_019066.5(MAGEL2):c.3746G>A (p.Arg1249His) single nucleotide variant not provided [RCV000224841] Chr15:23643997 [GRCh38]
Chr15:23889144 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.773C>G (p.Pro258Arg) single nucleotide variant not provided [RCV000595822] Chr15:23646970 [GRCh38]
Chr15:23892117 [GRCh37]
Chr15:15q11.2
uncertain significance
GRCh37/hg19 15q11.2-13.1(chr15:20733395-28406709)x3 copy number gain See cases [RCV000239962] Chr15:20733395..28406709 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28823722)x3 copy number gain See cases [RCV000511328] Chr15:22770421..28823722 [GRCh37]
Chr15:15q11.2-13.1
likely pathogenic
NM_019066.5(MAGEL2):c.3122del (p.Val1041fs) deletion Inborn genetic diseases [RCV000622615] Chr15:23644621 [GRCh38]
Chr15:23889768 [GRCh37]
Chr15:15q11.2
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22815306-28406709)x1 copy number loss See cases [RCV000240259] Chr15:22815306..28406709 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.1-13.3(chr15:20190548-32386089)x4 copy number gain See cases [RCV000240538] Chr15:20190548..32386089 [GRCh37]
Chr15:15q11.1-13.3
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22698522-28406709)x1 copy number loss See cases [RCV000240502] Chr15:22698522..28406709 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.1949A>G (p.Gln650Arg) single nucleotide variant not provided [RCV000270449] Chr15:23645794 [GRCh38]
Chr15:23890941 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1535C>T (p.Pro512Leu) single nucleotide variant not provided [RCV000270016] Chr15:23646208 [GRCh38]
Chr15:23891355 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1446T>C (p.Ala482=) single nucleotide variant not provided [RCV000870500]|not specified [RCV000339996] Chr15:23646297 [GRCh38]
Chr15:23891444 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.831G>A (p.Pro277=) single nucleotide variant not provided [RCV000280334] Chr15:23646912 [GRCh38]
Chr15:23892059 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.3261T>C (p.Tyr1087=) single nucleotide variant not provided [RCV000351368] Chr15:23644482 [GRCh38]
Chr15:23889629 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1470G>A (p.Pro490=) single nucleotide variant not provided [RCV000392138] Chr15:23646273 [GRCh38]
Chr15:23891420 [GRCh37]
Chr15:15q11.2
conflicting interpretations of pathogenicity|uncertain significance
NM_019066.5(MAGEL2):c.3690G>C (p.Glu1230Asp) single nucleotide variant not provided [RCV000293053] Chr15:23644053 [GRCh38]
Chr15:23889200 [GRCh37]
Chr15:15q11.2
conflicting interpretations of pathogenicity|uncertain significance
NM_019066.5(MAGEL2):c.1387G>C (p.Ala463Pro) single nucleotide variant not specified [RCV000327900] Chr15:23646356 [GRCh38]
Chr15:23891503 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.639A>C (p.Pro213=) single nucleotide variant not provided [RCV000872520]|not specified [RCV000327641] Chr15:23647104 [GRCh38]
Chr15:23892251 [GRCh37]
Chr15:15q11.2
benign|likely benign
NM_019066.5(MAGEL2):c.1467_1487del (p.Leu492_Pro498del) deletion not provided [RCV000401311] Chr15:23646256..23646276 [GRCh38]
Chr15:23891403..23891423 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.2070dup (p.Ala691fs) duplication not provided [RCV000404304] Chr15:23645672..23645673 [GRCh38]
Chr15:23890819..23890820 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.2163C>A (p.Cys721Ter) single nucleotide variant not provided [RCV000261432] Chr15:23645580 [GRCh38]
Chr15:23890727 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.3227A>C (p.Gln1076Pro) single nucleotide variant not provided [RCV000488095] Chr15:23644516 [GRCh38]
Chr15:23889663 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1715C>T (p.Ala572Val) single nucleotide variant Prader-Willi syndrome [RCV000765201]|not provided [RCV000488318] Chr15:23646028 [GRCh38]
Chr15:23891175 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.2298_2299del (p.Ala767fs) deletion not provided [RCV000520762] Chr15:23645444..23645445 [GRCh38]
Chr15:23890591..23890592 [GRCh37]
Chr15:15q11.2
likely pathogenic
Single allele deletion Prader-Willi syndrome [RCV000520873] Chr15:23707435..28520316 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.1A>C (p.Met1Leu) single nucleotide variant not provided [RCV000598585] Chr15:23647742 [GRCh38]
Chr15:23892889 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.1507G>A (p.Ala503Thr) single nucleotide variant not provided [RCV000592477] Chr15:23646236 [GRCh38]
Chr15:23891383 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1146G>A (p.Trp382Ter) single nucleotide variant not provided [RCV000598908] Chr15:23646597 [GRCh38]
Chr15:23891744 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.1198G>C (p.Ala400Pro) single nucleotide variant not provided [RCV000520836] Chr15:23646545 [GRCh38]
Chr15:23891692 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1927dup (p.Val643fs) duplication not provided [RCV000599423] Chr15:23645815..23645816 [GRCh38]
Chr15:23890962..23890963 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.1404CCCACCTGTGATCCGCCAGGC[1] (p.464VIRQAPP[3]) microsatellite not provided [RCV000593663] Chr15:23646298..23646318 [GRCh38]
Chr15:23891445..23891465 [GRCh37]
Chr15:15q11.2
conflicting interpretations of pathogenicity|uncertain significance
GRCh37/hg19 15q11.2-13.1(chr15:23810397-29213787) copy number gain Autistic disorder of childhood onset [RCV000626505] Chr15:23810397..29213787 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.2849G>A (p.Ser950Asn) single nucleotide variant not provided [RCV000731510] Chr15:23644894 [GRCh38]
Chr15:23890041 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.2572A>T (p.Thr858Ser) single nucleotide variant not provided [RCV000734700] Chr15:23645171 [GRCh38]
Chr15:23890318 [GRCh37]
Chr15:15q11.2
uncertain significance
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28644578)x3 copy number gain See cases [RCV000449082] Chr15:22770421..28644578 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-29062203)x3 copy number gain See cases [RCV000449451] Chr15:22770421..29062203 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28545355)x1 copy number loss See cases [RCV000449342] Chr15:23620191..28545355 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23615768-28823722)x1 copy number loss See cases [RCV000449387] Chr15:23615768..28823722 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.1-13.2(chr15:20071673-30737344)x4 copy number gain See cases [RCV000454142] Chr15:20071673..30737344 [GRCh37]
Chr15:15q11.1-13.2
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28357230)x1 copy number loss See cases [RCV000449305] Chr15:23620191..28357230 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28527747)x1 copy number loss See cases [RCV000449486] Chr15:22770421..28527747 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23300138-29338429)x3 copy number gain See cases [RCV000449160] Chr15:23300138..29338429 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28928730)x1 copy number loss See cases [RCV000446327] Chr15:22770421..28928730 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28527747)x3 copy number gain See cases [RCV000447681] Chr15:22770421..28527747 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23290862-28823722)x1 copy number loss See cases [RCV000447304] Chr15:23290862..28823722 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28545355)x1 copy number loss See cases [RCV000447305] Chr15:22770421..28545355 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23290862-28561097)x3 copy number gain See cases [RCV000446375] Chr15:23290862..28561097 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28958779)x4 copy number gain See cases [RCV000447111] Chr15:22770421..28958779 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2(chr15:23633652-24093847)x3 copy number gain See cases [RCV000446198] Chr15:23633652..24093847 [GRCh37]
Chr15:15q11.2
likely benign
GRCh37/hg19 15q11.2-13.1(chr15:23615768-28545355)x1 copy number loss See cases [RCV000446271] Chr15:23615768..28545355 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23286571-28545355)x1 copy number loss See cases [RCV000447349] Chr15:23286571..28545355 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-29021034)x1 copy number loss See cases [RCV000447354] Chr15:22770421..29021034 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28828168)x1 copy number loss See cases [RCV000446646] Chr15:22770421..28828168 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28823722)x4 copy number gain See cases [RCV000447598] Chr15:22770421..28823722 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23487423-28406650)x3 copy number gain See cases [RCV000446525] Chr15:23487423..28406650 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23707452-28406650)x3 copy number gain See cases [RCV000447049] Chr15:23707452..28406650 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28915864)x3 copy number gain See cases [RCV000446464] Chr15:22770421..28915864 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28823722)x1 copy number loss See cases [RCV000446703] Chr15:22770421..28823722 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.1-13.1(chr15:20190548-28406650) copy number gain See cases [RCV000447173] Chr15:20190548..28406650 [GRCh37]
Chr15:15q11.1-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28704050)x1 copy number loss See cases [RCV000447451] Chr15:22770421..28704050 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28527734)x1 copy number loss See cases [RCV000446656] Chr15:23620191..28527734 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28561232)x1 copy number loss See cases [RCV000447084] Chr15:23620191..28561232 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.3(chr15:22770421-31760986)x1 copy number loss See cases [RCV000445857] Chr15:22770421..31760986 [GRCh37]
Chr15:15q11.2-13.3
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-29069001)x3 copy number gain See cases [RCV000445780] Chr15:22770421..29069001 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.3(chr15:23282829-32446830)x1 copy number loss See cases [RCV000445807] Chr15:23282829..32446830 [GRCh37]
Chr15:15q11.2-13.3
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:20733395-28406650)x3 copy number gain See cases [RCV000445711] Chr15:20733395..28406650 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.2(chr15:22770421-31073669)x4 copy number gain See cases [RCV000448114] Chr15:22770421..31073669 [GRCh37]
Chr15:15q11.2-13.2
pathogenic
GRCh37/hg19 15q11.2-26.3(chr15:20733395-102511616)x4 copy number gain See cases [RCV000447765] Chr15:20733395..102511616 [GRCh37]
Chr15:15q11.2-26.3
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28534458)x1 copy number loss See cases [RCV000448156] Chr15:22770421..28534458 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22815306-28406650)x1 copy number loss See cases [RCV000448168] Chr15:22815306..28406650 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23288374-28534245)x3 copy number gain See cases [RCV000448177] Chr15:23288374..28534245 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-14(chr15:22770421-33707835)x3 copy number gain See cases [RCV000447775] Chr15:22770421..33707835 [GRCh37]
Chr15:15q11.2-14
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28709715)x1 copy number loss See cases [RCV000448196] Chr15:22770421..28709715 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23290862-28534245)x3 copy number gain See cases [RCV000448566] Chr15:23290862..28534245 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28915864)x1 copy number loss See cases [RCV000447934] Chr15:22770421..28915864 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28660038)x4 copy number gain See cases [RCV000448060] Chr15:22770421..28660038 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28545601)x1 copy number loss See cases [RCV000448654] Chr15:23620191..28545601 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.1-13.3(chr15:20190548-32917801)x4 copy number gain See cases [RCV000448210] Chr15:20190548..32917801 [GRCh37]
Chr15:15q11.1-13.3
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23290786-28545459)x1 copy number loss See cases [RCV000448755] Chr15:23290786..28545459 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22698522-28406650)x1 copy number loss See cases [RCV000448076] Chr15:22698522..28406650 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28419123)x1 copy number loss See cases [RCV000448602] Chr15:22770421..28419123 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28437018)x1 copy number loss See cases [RCV000448456] Chr15:23620191..28437018 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23707452-28406650)x1 copy number loss See cases [RCV000448093] Chr15:23707452..28406650 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28534245)x3 copy number gain See cases [RCV000448096] Chr15:22770421..28534245 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.2(chr15:22770421-30386398)x4 copy number gain See cases [RCV000448389] Chr15:22770421..30386398 [GRCh37]
Chr15:15q11.2-13.2
pathogenic
NM_019066.5(MAGEL2):c.67T>C (p.Tyr23His) single nucleotide variant not provided [RCV000483819] Chr15:23647676 [GRCh38]
Chr15:23892823 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.2958del (p.Ser987fs) deletion Schaaf-Yang syndrome [RCV000455050] Chr15:23644785 [GRCh38]
Chr15:23889932 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.1418G>T (p.Arg473Leu) single nucleotide variant not provided [RCV000483060] Chr15:23646325 [GRCh38]
Chr15:23891472 [GRCh37]
Chr15:15q11.2
uncertain significance
GRCh37/hg19 15q11.2-13.1(chr15:23615768-28540415)x1 copy number loss See cases [RCV000510622] Chr15:23615768..28540415 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28526410)x3 copy number gain See cases [RCV000510367] Chr15:22770421..28526410 [GRCh37]
Chr15:15q11.2-13.1
likely pathogenic
GRCh37/hg19 15q11.2-13.2(chr15:22770421-31122895)x4 copy number gain See cases [RCV000510386] Chr15:22770421..31122895 [GRCh37]
Chr15:15q11.2-13.2
pathogenic
NM_019066.5(MAGEL2):c.822A>T (p.Ser274=) single nucleotide variant not specified [RCV000500947] Chr15:23646921 [GRCh38]
Chr15:23892068 [GRCh37]
Chr15:15q11.2
likely benign
GRCh37/hg19 15q11.2-13.2(chr15:22770421-30386398)x4 copy number gain See cases [RCV000510251] Chr15:22770421..30386398 [GRCh37]
Chr15:15q11.2-13.2
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28415107)x1 copy number loss See cases [RCV000510397] Chr15:22770421..28415107 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23625784-28540345)x1 copy number loss See cases [RCV000510211] Chr15:23625784..28540345 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-29214721)x3 copy number gain See cases [RCV000510224] Chr15:22770421..29214721 [GRCh37]
Chr15:15q11.2-13.1
likely pathogenic
NM_019066.5(MAGEL2):c.919C>T (p.Pro307Ser) single nucleotide variant not provided [RCV000865075]|not specified [RCV000499439] Chr15:23646824 [GRCh38]
Chr15:23891971 [GRCh37]
Chr15:15q11.2
likely benign|uncertain significance
NM_019066.5(MAGEL2):c.385A>G (p.Met129Val) single nucleotide variant Prader-Willi syndrome [RCV001198742]|not specified [RCV000501872] Chr15:23647358 [GRCh38]
Chr15:23892505 [GRCh37]
Chr15:15q11.2
benign|uncertain significance
GRCh37/hg19 15q11.2-13.1(chr15:23615769-28561671)x1 copy number loss See cases [RCV000510689] Chr15:23615769..28561671 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.3273C>T (p.Asn1091=) single nucleotide variant not specified [RCV000504457] Chr15:23644470 [GRCh38]
Chr15:23889617 [GRCh37]
Chr15:15q11.2
likely benign
GRCh37/hg19 15q11.2-13.1(chr15:23615769-28561097)x3 copy number gain See cases [RCV000510296] Chr15:23615769..28561097 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-29062203)x1 copy number loss See cases [RCV000510693] Chr15:22770421..29062203 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.789T>C (p.Pro263=) single nucleotide variant not specified [RCV000502723] Chr15:23646954 [GRCh38]
Chr15:23892101 [GRCh37]
Chr15:15q11.2
likely benign
GRCh37/hg19 15q11.2-26.3(chr15:22770422-102429112)x3 copy number gain See cases [RCV000510717] Chr15:22770422..102429112 [GRCh37]
Chr15:15q11.2-26.3
pathogenic
NM_019066.5(MAGEL2):c.959C>A (p.Ala320Asp) single nucleotide variant not specified [RCV000502840] Chr15:23646784 [GRCh38]
Chr15:23891931 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.37_38insAC (p.Pro13fs) insertion not specified [RCV000503000] Chr15:23647705..23647706 [GRCh38]
Chr15:23892852..23892853 [GRCh37]
Chr15:15q11.2
likely pathogenic|uncertain significance
NM_019066.5(MAGEL2):c.1996del (p.Gln666fs) deletion Ambiguous genitalia [RCV001257380]|Schaaf-Yang syndrome [RCV000508606]|not provided [RCV001386664] Chr15:23645747 [GRCh38]
Chr15:23890894 [GRCh37]
Chr15:15q11.2
pathogenic
GRCh37/hg19 15q11.2-26.3(chr15:22770422-102429112) copy number gain See cases [RCV000512019] Chr15:22770422..102429112 [GRCh37]
Chr15:15q11.2-26.3
pathogenic
NM_019066.5(MAGEL2):c.2118del (p.Leu708fs) deletion Schaaf-Yang syndrome [RCV000508643] Chr15:23645625 [GRCh38]
Chr15:23890772 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.1621C>T (p.Gln541Ter) single nucleotide variant Schaaf-Yang syndrome [RCV000508613] Chr15:23646122 [GRCh38]
Chr15:23891269 [GRCh37]
Chr15:15q11.2
pathogenic|likely pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28660038)x1 copy number loss See cases [RCV000511670] Chr15:22770421..28660038 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.353C>T (p.Pro118Leu) single nucleotide variant Schaaf-Yang syndrome [RCV000678310]|not provided [RCV000494586] Chr15:23647390 [GRCh38]
Chr15:23892537 [GRCh37]
Chr15:15q11.2
uncertain significance
GRCh37/hg19 15q11.2-13.1(chr15:23290786-28545601)x1 copy number loss See cases [RCV000511767] Chr15:23290786..28545601 [GRCh37]
Chr15:15q11.2-13.1
pathogenic|uncertain significance
GRCh37/hg19 15q11.2-13.1(chr15:23615768-28534245)x3 copy number gain See cases [RCV000511592] Chr15:23615768..28534245 [GRCh37]
Chr15:15q11.2-13.1
likely pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28534359)x1 copy number loss See cases [RCV000511600] Chr15:23620191..28534359 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23615769-28953483)x3 copy number gain See cases [RCV000511850] Chr15:23615769..28953483 [GRCh37]
Chr15:15q11.2-13.1
likely pathogenic
NM_019066.5(MAGEL2):c.655A>C (p.Met219Leu) single nucleotide variant not provided [RCV000493162] Chr15:23647088 [GRCh38]
Chr15:23892235 [GRCh37]
Chr15:15q11.2
uncertain significance
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28539975)x1 copy number loss See cases [RCV000510883] Chr15:23620191..28539975 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28540415)x1 copy number loss See cases [RCV000511196] Chr15:23620191..28540415 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28561671)x1 copy number loss See cases [RCV000510894] Chr15:23620191..28561671 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28958779)x3 copy number gain See cases [RCV000510929] Chr15:23620191..28958779 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28534245)x3 copy number gain See cases [RCV000510737] Chr15:23620191..28534245 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.2(chr15:22770421-30369944)x4 copy number gain See cases [RCV000510901] Chr15:22770421..30369944 [GRCh37]
Chr15:15q11.2-13.2
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28561671)x1 copy number loss See cases [RCV000511178] Chr15:22770421..28561671 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23290862-28958779)x3 copy number gain See cases [RCV000511275] Chr15:23290862..28958779 [GRCh37]
Chr15:15q11.2-13.1
likely pathogenic
NM_019066.5(MAGEL2):c.2290G>A (p.Ala764Thr) single nucleotide variant not provided [RCV000514999] Chr15:23645453 [GRCh38]
Chr15:23890600 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.2692A>G (p.Ser898Gly) single nucleotide variant not provided [RCV000514108] Chr15:23645051 [GRCh38]
Chr15:23890198 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.410C>T (p.Ala137Val) single nucleotide variant not provided [RCV000595012] Chr15:23647333 [GRCh38]
Chr15:23892480 [GRCh37]
Chr15:15q11.2
uncertain significance
GRCh37/hg19 15q11.2-13.1(chr15:23615769-28163991)x1 copy number loss See cases [RCV000512394] Chr15:23615769..28163991 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28561670)x4 copy number gain See cases [RCV000512182] Chr15:22770421..28561670 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28709715)x1 copy number loss See cases [RCV000512355] Chr15:23620191..28709715 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23286571-28540415)x1 copy number loss See cases [RCV000512547] Chr15:23286571..28540415 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-29009042)x3 copy number gain See cases [RCV000512432] Chr15:22770421..29009042 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.939CCCACCTGCACAGCCGATGGC[1] (p.314PPAQPMA[1]) microsatellite not provided [RCV000598014] Chr15:23646763..23646783 [GRCh38]
Chr15:23891910..23891930 [GRCh37]
Chr15:15q11.2
conflicting interpretations of pathogenicity|uncertain significance
NM_019066.5(MAGEL2):c.2296C>T (p.Arg766Ter) single nucleotide variant not provided [RCV000627290] Chr15:23645447 [GRCh38]
Chr15:23890594 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.2092G>A (p.Gly698Arg) single nucleotide variant not provided [RCV000658456] Chr15:23645651 [GRCh38]
Chr15:23890798 [GRCh37]
Chr15:15q11.2
uncertain significance
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28376934)x4 copy number gain not provided [RCV000683630] Chr15:22770421..28376934 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28545601)x4 copy number gain not provided [RCV000683632] Chr15:22770421..28545601 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28823722)x1 copy number loss not provided [RCV000683633] Chr15:22770421..28823722 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-29069001)x1 copy number loss not provided [RCV000683634] Chr15:22770421..29069001 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.2(chr15:22770421-30386398)x1 copy number loss not provided [RCV000683635] Chr15:22770421..30386398 [GRCh37]
Chr15:15q11.2-13.2
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22876919-28561671)x1 copy number loss not provided [RCV000683640] Chr15:22876919..28561671 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23620191-28540415)x3 copy number gain not provided [RCV000683647] Chr15:23620191..28540415 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.2(chr15:22770421-31073668)x3,4 copy number gain not provided [RCV000683636] Chr15:22770421..31073668 [GRCh37]
Chr15:15q11.2-13.2
pathogenic
GRCh37/hg19 15q11.2-13.3(chr15:22770421-32439524)x4 copy number gain not provided [RCV000683638] Chr15:22770421..32439524 [GRCh37]
Chr15:15q11.2-13.3
pathogenic
GRCh37/hg19 15q11.2-13.3(chr15:22770421-33098520)x3,4 copy number gain not provided [RCV000683639] Chr15:22770421..33098520 [GRCh37]
Chr15:15q11.2-13.3
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23288374-29062203)x1 copy number loss not provided [RCV000683643] Chr15:23288374..29062203 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23632677-28534458)x3 copy number gain not provided [RCV000683648] Chr15:23632677..28534458 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23637603-28644578)x1 copy number loss not provided [RCV000683650] Chr15:23637603..28644578 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23615768-28561671)x3 copy number gain not provided [RCV000683645] Chr15:23615768..28561671 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-12(chr15:23662481-25991024)x1 copy number loss not provided [RCV000683651] Chr15:23662481..25991024 [GRCh37]
Chr15:15q11.2-12
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23290786-28560269)x1 copy number loss not provided [RCV000683644] Chr15:23290786..28560269 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23615768-28561671)x1 copy number loss not provided [RCV000683646] Chr15:23615768..28561671 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23632677-28723454)x3 copy number gain not provided [RCV000683649] Chr15:23632677..28723454 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770421-28534245)x3 copy number gain not provided [RCV000683631] Chr15:22770421..28534245 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23288374-28705281)x1 copy number loss not provided [RCV000683642] Chr15:23288374..28705281 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.3(chr15:22770421-32421780)x2,3 copy number gain not provided [RCV000683637] Chr15:22770421..32421780 [GRCh37]
Chr15:15q11.2-13.3
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23286571-28823722)x1 copy number loss not provided [RCV000683641] Chr15:23286571..28823722 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.2170_2232dup (p.Ser724_Ala744dup) duplication Schaaf-Yang syndrome [RCV000736025] Chr15:23645510..23645511 [GRCh38]
Chr15:23890657..23890658 [GRCh37]
Chr15:15q11.2
uncertain significance
Single allele duplication Schizophrenia [RCV000754156] Chr15:23319712..28684313 [GRCh38]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22652330-29050198)x1 copy number loss not provided [RCV000738652] Chr15:22652330..29050198 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23672782-28532120)x1 copy number loss not provided [RCV000738660] Chr15:23672782..28532120 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23672782-28544359)x1 copy number loss not provided [RCV000738661] Chr15:23672782..28544359 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23693406-29085893)x3 copy number gain not provided [RCV000738662] Chr15:23693406..29085893 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
Single allele duplication Autistic disorder of childhood onset [RCV000754147] Chr15:22420897..32130343 [GRCh38]
Chr15:15q11.2-13.3
pathogenic
Single allele duplication Autistic disorder of childhood onset [RCV000754157] Chr15:23319712..28800324 [GRCh38]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.1-13.1(chr15:20102541-28535051)x4 copy number gain not provided [RCV000754760] Chr15:20102541..28535051 [GRCh37]
Chr15:15q11.1-13.1
pathogenic
Single allele duplication Schizophrenia [RCV000754155] Chr15:23157975..28774125 [GRCh38]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22750305-28535266)x1 copy number loss not provided [RCV000751176] Chr15:22750305..28535266 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.2(chr15:22835967-30371774)x4 copy number gain not provided [RCV000751178] Chr15:22835967..30371774 [GRCh37]
Chr15:15q11.2-13.2
pathogenic
GRCh37/hg19 15q11.1-26.3(chr15:20016811-102493540)x3 copy number gain not provided [RCV000751155] Chr15:20016811..102493540 [GRCh37]
Chr15:15q11.1-26.3
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23109890-29085893)x3 copy number gain not provided [RCV000751181] Chr15:23109890..29085893 [GRCh37]
Chr15:15q11.2-13.1
likely pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23656946-28506450)x3 copy number gain not provided [RCV000751185] Chr15:23656946..28506450 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23656946-28535266)x3 copy number gain not provided [RCV000751186] Chr15:23656946..28535266 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23656946-28544359)x3 copy number gain not provided [RCV000751187] Chr15:23656946..28544359 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23656946-28544359)x1 copy number loss not provided [RCV000751188] Chr15:23656946..28544359 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.1-26.3(chr15:20071673-102461162)x3 copy number gain not provided [RCV000751156] Chr15:20071673..102461162 [GRCh37]
Chr15:15q11.1-26.3
pathogenic
NM_019066.5(MAGEL2):c.678T>G (p.Gly226=) single nucleotide variant not provided [RCV000871805] Chr15:23647065 [GRCh38]
Chr15:23892212 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.188dup (p.Ala64fs) duplication Schaaf-Yang syndrome [RCV000853315] Chr15:23647554..23647555 [GRCh38]
Chr15:23892701..23892702 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.2971G>A (p.Val991Ile) single nucleotide variant not provided [RCV000874947] Chr15:23644772 [GRCh38]
Chr15:23889919 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.135T>A (p.Asp45Glu) single nucleotide variant not provided [RCV000873081] Chr15:23647608 [GRCh38]
Chr15:23892755 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.2874G>A (p.Trp958Ter) single nucleotide variant not provided [RCV000760832] Chr15:23644869 [GRCh38]
Chr15:23890016 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.2362A>T (p.Ser788Cys) single nucleotide variant not provided [RCV000864728] Chr15:23645381 [GRCh38]
Chr15:23890528 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.3657G>A (p.Ala1219=) single nucleotide variant not provided [RCV000865147] Chr15:23644086 [GRCh38]
Chr15:23889233 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.2979G>C (p.Val993=) single nucleotide variant not provided [RCV000936718] Chr15:23644764 [GRCh38]
Chr15:23889911 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.1887C>T (p.Pro629=) single nucleotide variant not provided [RCV000864729] Chr15:23645856 [GRCh38]
Chr15:23891003 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.3522C>T (p.Tyr1174=) single nucleotide variant not provided [RCV000926013] Chr15:23644221 [GRCh38]
Chr15:23889368 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.1218G>A (p.Pro406=) single nucleotide variant not provided [RCV000897848] Chr15:23646525 [GRCh38]
Chr15:23891672 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.3483T>C (p.Phe1161=) single nucleotide variant not provided [RCV000901987] Chr15:23644260 [GRCh38]
Chr15:23889407 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.3705C>G (p.Thr1235=) single nucleotide variant not provided [RCV000915237] Chr15:23644038 [GRCh38]
Chr15:23889185 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.225G>A (p.Pro75=) single nucleotide variant not provided [RCV000875811] Chr15:23647518 [GRCh38]
Chr15:23892665 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.1368C>A (p.Pro456=) single nucleotide variant not provided [RCV000922504] Chr15:23646375 [GRCh38]
Chr15:23891522 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.2685A>G (p.Gln895=) single nucleotide variant not provided [RCV000920451] Chr15:23645058 [GRCh38]
Chr15:23890205 [GRCh37]
Chr15:15q11.2
likely benign
GRCh37/hg19 15q11.1-13.1(chr15:20191652-28525310) copy number gain Chromosome 15q11-q13 duplication syndrome [RCV000767718] Chr15:20191652..28525310 [GRCh37]
Chr15:15q11.1-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23615768-28561671) copy number loss Angelman syndrome [RCV000767724] Chr15:23615768..28561671 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23683783-28530182) copy number loss Angelman syndrome [RCV000767725] Chr15:23683783..28530182 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-12(chr15:23288374-27706996)x1 copy number loss not provided [RCV001006666] Chr15:23288374..27706996 [GRCh37]
Chr15:15q11.2-12
pathogenic
Single allele duplication Chromosome 15q11-q13 duplication syndrome [RCV000825026] Chr15:23810928..28544664 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.3(chr15:20848750-32925141) copy number loss Angelman syndrome [RCV000767719] Chr15:20848750..32925141 [GRCh37]
Chr15:15q11.2-13.3
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770994-29050198) copy number loss Angelman syndrome [RCV000767721] Chr15:22770994..29050198 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.3(chr15:22383299-32917689) copy number gain Chromosome 15q11-q13 duplication syndrome [RCV000767722] Chr15:22383299..32917689 [GRCh37]
Chr15:15q11.2-13.3
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22770994-28517432) copy number gain Chromosome 15q11-q13 duplication syndrome [RCV000767723] Chr15:22770994..28517432 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23810184-29213896) copy number gain Chromosome 15q11-q13 duplication syndrome [RCV000767753] Chr15:23810184..29213896 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23810397-28525505) copy number gain Chromosome 15q11-q13 duplication syndrome [RCV000767754] Chr15:23810397..28525505 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.3140T>C (p.Val1047Ala) single nucleotide variant not provided [RCV000903967] Chr15:23644603 [GRCh38]
Chr15:23889750 [GRCh37]
Chr15:15q11.2
likely benign
GRCh37/hg19 15q11.2-13.3(chr15:22382860-32396457) copy number gain Chromosome 15q11-q13 duplication syndrome [RCV000767720] Chr15:22382860..32396457 [GRCh37]
Chr15:15q11.2-13.3
pathogenic
NM_019066.5(MAGEL2):c.2817C>T (p.Thr939=) single nucleotide variant not provided [RCV000939610] Chr15:23644926 [GRCh38]
Chr15:23890073 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.1404C>A (p.Ala468=) single nucleotide variant not provided [RCV000875707] Chr15:23646339 [GRCh38]
Chr15:23891486 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.853G>A (p.Gly285Arg) single nucleotide variant not provided [RCV000871740] Chr15:23646890 [GRCh38]
Chr15:23892037 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.2637A>G (p.Pro879=) single nucleotide variant not provided [RCV000943232] Chr15:23645106 [GRCh38]
Chr15:23890253 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.3474C>T (p.Thr1158=) single nucleotide variant not provided [RCV000916631] Chr15:23644269 [GRCh38]
Chr15:23889416 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.2633C>T (p.Pro878Leu) single nucleotide variant not provided [RCV000873342] Chr15:23645110 [GRCh38]
Chr15:23890257 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.687G>A (p.Met229Ile) single nucleotide variant not provided [RCV000865178] Chr15:23647056 [GRCh38]
Chr15:23892203 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.372C>G (p.Thr124=) single nucleotide variant not provided [RCV000919079] Chr15:23647371 [GRCh38]
Chr15:23892518 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.450C>G (p.Ser150=) single nucleotide variant not provided [RCV000922218] Chr15:23647293 [GRCh38]
Chr15:23892440 [GRCh37]
Chr15:15q11.2
likely benign
GRCh37/hg19 15q11.1-13.2(chr15:20190548-30300265) copy number gain Chromosome 15q11-q13 duplication syndrome [RCV000767717] Chr15:20190548..30300265 [GRCh37]
Chr15:15q11.1-13.2
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:23810184-28525505) copy number loss Prader-Willi syndrome [RCV000767726] Chr15:23810184..28525505 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22816713-28530182) copy number loss Angelman syndrome [RCV000767840] Chr15:22816713..28530182 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.1(chr15:22816713-28530182) copy number gain Chromosome 15q11-q13 duplication syndrome [RCV000767841] Chr15:22816713..28530182 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.807C>A (p.Thr269=) single nucleotide variant not provided [RCV000937928] Chr15:23646936 [GRCh38]
Chr15:23892083 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.2767G>A (p.Glu923Lys) single nucleotide variant not provided [RCV000822076] Chr15:23644976 [GRCh38]
Chr15:23890123 [GRCh37]
Chr15:15q11.2
uncertain significance
GRCh37/hg19 15q11.2(chr15:23620191-23929571)x3 copy number gain not provided [RCV000849544] Chr15:23620191..23929571 [GRCh37]
Chr15:15q11.2
uncertain significance
Single allele complex Esophageal atresia [RCV000986105] Chr15:22676913..30137106 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-13.3(chr15:23213406-32446830)x1 copy number loss not provided [RCV001006665] Chr15:23213406..32446830 [GRCh37]
Chr15:15q11.2-13.3
pathogenic
NM_019066.5(MAGEL2):c.1613C>A (p.Ala538Glu) single nucleotide variant Schaaf-Yang syndrome [RCV001090063] Chr15:23646130 [GRCh38]
Chr15:23891277 [GRCh37]
Chr15:15q11.2
pathogenic
GRCh37/hg19 15q11.1-13.3(chr15:20179527-32998070)x3 copy number gain not provided [RCV000846014] Chr15:20179527..32998070 [GRCh37]
Chr15:15q11.1-13.3
pathogenic
NM_019066.5(MAGEL2):c.1869C>G (p.Pro623=) single nucleotide variant not provided [RCV000916913] Chr15:23645874 [GRCh38]
Chr15:23891021 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.108C>T (p.Ser36=) single nucleotide variant not provided [RCV000920016] Chr15:23647635 [GRCh38]
Chr15:23892782 [GRCh37]
Chr15:15q11.2
likely benign
Single allele deletion Neurodevelopmental disorder [RCV000787376] Chr15:23699983..28436313 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
GRCh37/hg19 15q11.2-14(chr15:22770421-36861479)x1 copy number loss not provided [RCV001006664] Chr15:22770421..36861479 [GRCh37]
Chr15:15q11.2-14
pathogenic
NM_019066.5(MAGEL2):c.3246del (p.Asn1084fs) deletion Schaaf-Yang syndrome [RCV001007942] Chr15:23644497 [GRCh38]
Chr15:23889644 [GRCh37]
Chr15:15q11.2
pathogenic
Single allele deletion Angelman syndrome [RCV001250751] Chr15:23579300..28447626 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
Single allele deletion Angelman syndrome [RCV001250750] Chr15:22833416..28566671 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.3131C>T (p.Ser1044Leu) single nucleotide variant Prader-Willi syndrome [RCV001196510] Chr15:23644612 [GRCh38]
Chr15:23889759 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1601del (p.Pro534fs) deletion Inborn genetic diseases [RCV001267304]|Schaaf-Yang syndrome [RCV001249368] Chr15:23646142 [GRCh38]
Chr15:23891289 [GRCh37]
Chr15:15q11.2
pathogenic|not provided
NM_019066.5(MAGEL2):c.1468C>G (p.Pro490Ala) single nucleotide variant Schaaf-Yang syndrome [RCV001249765]|not provided [RCV001358317] Chr15:23646275 [GRCh38]
Chr15:23891422 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.2199del (p.Glu734fs) deletion Schaaf-Yang syndrome [RCV000989269] Chr15:23645544 [GRCh38]
Chr15:23890691 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.2060_2085del (p.Gln687fs) deletion not provided [RCV001008277] Chr15:23645658..23645683 [GRCh38]
Chr15:23890805..23890830 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.45G>A (p.Ala15=) single nucleotide variant not provided [RCV000975400] Chr15:23647698 [GRCh38]
Chr15:23892845 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.2251A>G (p.Ile751Val) single nucleotide variant not provided [RCV000873121] Chr15:23645492 [GRCh38]
Chr15:23890639 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.822A>C (p.Ser274=) single nucleotide variant not provided [RCV000940831] Chr15:23646921 [GRCh38]
Chr15:23892068 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.569C>G (p.Ala190Gly) single nucleotide variant not provided [RCV000931274] Chr15:23647174 [GRCh38]
Chr15:23892321 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.2418C>T (p.Gly806=) single nucleotide variant not provided [RCV000873282] Chr15:23645325 [GRCh38]
Chr15:23890472 [GRCh37]
Chr15:15q11.2
benign
NM_019066.5(MAGEL2):c.789T>A (p.Pro263=) single nucleotide variant not provided [RCV000933445] Chr15:23646954 [GRCh38]
Chr15:23892101 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.2829G>A (p.Leu943=) single nucleotide variant not provided [RCV000909669] Chr15:23644914 [GRCh38]
Chr15:23890061 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.3721G>A (p.Gly1241Ser) single nucleotide variant not provided [RCV000910514] Chr15:23644022 [GRCh38]
Chr15:23889169 [GRCh37]
Chr15:15q11.2
likely benign
GRCh37/hg19 15q11.2-13.2(chr15:22770421-30386553)x4 copy number gain not provided [RCV001006662] Chr15:22770421..30386553 [GRCh37]
Chr15:15q11.2-13.2
pathogenic
GRCh37/hg19 15q11.2-13.3(chr15:22770421-32915089)x4 copy number gain not provided [RCV001006663] Chr15:22770421..32915089 [GRCh37]
Chr15:15q11.2-13.3
pathogenic
NM_019066.5(MAGEL2):c.2484A>G (p.Val828=) single nucleotide variant not provided [RCV000912027] Chr15:23645259 [GRCh38]
Chr15:23890406 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.1099G>T (p.Gly367Cys) single nucleotide variant not provided [RCV000933653] Chr15:23646644 [GRCh38]
Chr15:23891791 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.1995C>T (p.Pro665=) single nucleotide variant not provided [RCV000933728] Chr15:23645748 [GRCh38]
Chr15:23890895 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.1221G>A (p.Pro407=) single nucleotide variant not provided [RCV000913828] Chr15:23646522 [GRCh38]
Chr15:23891669 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.1808C>A (p.Ser603Ter) single nucleotide variant not provided [RCV001008685] Chr15:23645935 [GRCh38]
Chr15:23891082 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.717G>A (p.Met239Ile) single nucleotide variant Autistic disorder of childhood onset [RCV001263335] Chr15:23647026 [GRCh38]
Chr15:23892173 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.2498C>A (p.Ala833Glu) single nucleotide variant Intellectual disability [RCV001263367] Chr15:23645245 [GRCh38]
Chr15:23890392 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.3070del (p.Ala1024fs) deletion not provided [RCV001008951] Chr15:23644673 [GRCh38]
Chr15:23889820 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.2945_2946del (p.Leu981_Ser982insTer) microsatellite Prader-Willi syndrome [RCV001195825] Chr15:23644797..23644798 [GRCh38]
Chr15:23889944..23889945 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.187_192delinsGGCCCCTG (p.Pro63fs) indel not provided [RCV001009287] Chr15:23647551..23647556 [GRCh38]
Chr15:23892698..23892703 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.1220C>T (p.Pro407Leu) single nucleotide variant Prader-Willi syndrome [RCV001196912] Chr15:23646523 [GRCh38]
Chr15:23891670 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.539_568del (p.Val180_Met189del) deletion Prader-Willi syndrome [RCV001197127] Chr15:23647175..23647204 [GRCh38]
Chr15:23892322..23892351 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1808C>G (p.Ser603Ter) single nucleotide variant Schaaf-Yang syndrome [RCV001251169] Chr15:23645935 [GRCh38]
Chr15:23891082 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.3526G>A (p.Glu1176Lys) single nucleotide variant not specified [RCV001251262] Chr15:23644217 [GRCh38]
Chr15:23889364 [GRCh37]
Chr15:15q11.2
uncertain significance
GRCh37/hg19 15q11.2-12(chr15:22833525-27193380)x4 copy number gain not provided [RCV001310299] Chr15:22833525..27193380 [GRCh37]
Chr15:15q11.2-12
pathogenic
NM_019066.5(MAGEL2):c.494C>T (p.Pro165Leu) single nucleotide variant Schaaf-Yang syndrome [RCV001262993] Chr15:23647249 [GRCh38]
Chr15:23892396 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1906C>T (p.Gln636Ter) single nucleotide variant Inborn genetic diseases [RCV001267238] Chr15:23645837 [GRCh38]
Chr15:23890984 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.2847_2883del (p.Ser950fs) deletion Schaaf-Yang syndrome [RCV001420186]|not provided [RCV001268027] Chr15:23644860..23644896 [GRCh38]
Chr15:23890007..23890043 [GRCh37]
Chr15:15q11.2
pathogenic|likely pathogenic
NM_019066.5(MAGEL2):c.1944del (p.Gln650fs) deletion Inborn genetic diseases [RCV001267405] Chr15:23645799 [GRCh38]
Chr15:23890946 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.1496C>G (p.Pro499Arg) single nucleotide variant not provided [RCV001280766] Chr15:23646247 [GRCh38]
Chr15:23891394 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1930C>T (p.Gln644Ter) single nucleotide variant Intellectual disability [RCV001260888] Chr15:23645813 [GRCh38]
Chr15:23890960 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.877G>A (p.Gly293Ser) single nucleotide variant Schaaf-Yang syndrome [RCV001329112] Chr15:23646866 [GRCh38]
Chr15:23892013 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1276G>A (p.Gly426Ser) single nucleotide variant Schaaf-Yang syndrome [RCV001329108] Chr15:23646467 [GRCh38]
Chr15:23891614 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.2819C>A (p.Pro940His) single nucleotide variant Seizures [RCV001281436] Chr15:23644924 [GRCh38]
Chr15:23890071 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.3449_3450del (p.Phe1150fs) deletion Schaaf-Yang syndrome [RCV001334045] Chr15:23644293..23644294 [GRCh38]
Chr15:23889440..23889441 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.1846G>A (p.Ala616Thr) single nucleotide variant not provided [RCV001305974] Chr15:23645897 [GRCh38]
Chr15:23891044 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1145_1147dup (p.Gln383_Ala384insArg) duplication Schaaf-Yang syndrome [RCV001329106] Chr15:23646595..23646596 [GRCh38]
Chr15:23891742..23891743 [GRCh37]
Chr15:15q11.2
uncertain significance
GRCh37/hg19 15q11.2-13.1(chr15:23707435-28726651)x1 copy number loss not provided [RCV001281355] Chr15:23707435..28726651 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.3583del (p.Met1195fs) deletion Schaaf-Yang syndrome [RCV001420183] Chr15:23644160 [GRCh38]
Chr15:23889307 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.3043C>T (p.Gln1015Ter) single nucleotide variant not provided [RCV001281581] Chr15:23644700 [GRCh38]
Chr15:23889847 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.2646del (p.Gly883fs) deletion Schaaf-Yang syndrome [RCV001420187] Chr15:23645097 [GRCh38]
Chr15:23890244 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.41C>A (p.Pro14Gln) single nucleotide variant not provided [RCV001355068] Chr15:23647702 [GRCh38]
Chr15:23892849 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1922C>G (p.Pro641Arg) single nucleotide variant not provided [RCV001356681] Chr15:23645821 [GRCh38]
Chr15:23890968 [GRCh37]
Chr15:15q11.2
likely benign
NM_019066.5(MAGEL2):c.1404_1445del (p.464VIRQAPP[2]) deletion not provided [RCV001294535] Chr15:23646298..23646339 [GRCh38]
Chr15:23891445..23891486 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.3699_3701dup (p.Asp1234dup) duplication not provided [RCV001354495] Chr15:23644041..23644042 [GRCh38]
Chr15:23889188..23889189 [GRCh37]
Chr15:15q11.2
uncertain significance
GRCh37/hg19 15q11.2-13.1(chr15:23208842-28525460) copy number gain Epileptic encephalopathy [RCV001291989] Chr15:23208842..28525460 [GRCh37]
Chr15:15q11.2-13.1
pathogenic
NM_019066.5(MAGEL2):c.1188G>A (p.Trp396Ter) single nucleotide variant Schaaf-Yang syndrome [RCV001329107] Chr15:23646555 [GRCh38]
Chr15:23891702 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1972G>A (p.Ala658Thr) single nucleotide variant Schaaf-Yang syndrome [RCV001329110] Chr15:23645771 [GRCh38]
Chr15:23890918 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.2839G>C (p.Glu947Gln) single nucleotide variant Schaaf-Yang syndrome [RCV001329111] Chr15:23644904 [GRCh38]
Chr15:23890051 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1015C>T (p.Gln339Ter) single nucleotide variant Schaaf-Yang syndrome [RCV001420184] Chr15:23646728 [GRCh38]
Chr15:23891875 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.1104G>A (p.Trp368Ter) single nucleotide variant Schaaf-Yang syndrome [RCV001420188] Chr15:23646639 [GRCh38]
Chr15:23891786 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.1797_1798del (p.Glu599fs) microsatellite not provided [RCV001280768] Chr15:23645945..23645946 [GRCh38]
Chr15:23891092..23891093 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.1640C>T (p.Pro547Leu) single nucleotide variant Schaaf-Yang syndrome [RCV001329109] Chr15:23646103 [GRCh38]
Chr15:23891250 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.639_668del (p.181HPPPPGTPMA[4]) deletion not provided [RCV001357300] Chr15:23647075..23647104 [GRCh38]
Chr15:23892222..23892251 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.648del (p.Thr217fs) deletion Schaaf-Yang syndrome [RCV001420185] Chr15:23647095 [GRCh38]
Chr15:23892242 [GRCh37]
Chr15:15q11.2
likely pathogenic
NM_019066.5(MAGEL2):c.937G>T (p.Ala313Ser) single nucleotide variant not provided [RCV001302567] Chr15:23646806 [GRCh38]
Chr15:23891953 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.1039G>C (p.Ala347Pro) single nucleotide variant not provided [RCV001308297] Chr15:23646704 [GRCh38]
Chr15:23891851 [GRCh37]
Chr15:15q11.2
uncertain significance
Single allele duplication Chromosome 15q11-q13 duplication syndrome [RCV001420629] Chr15:22804175..30375696 [GRCh38]
Chr15:15q11.2-13.2
pathogenic
NM_019066.5(MAGEL2):c.2746A>G (p.Asn916Asp) single nucleotide variant Schaaf-Yang syndrome [RCV001420653] Chr15:23644997 [GRCh38]
Chr15:23890144 [GRCh37]
Chr15:15q11.2
uncertain significance
NM_019066.5(MAGEL2):c.3044dup (p.Pro1016fs) duplication not provided [RCV001390406] Chr15:23644698..23644699 [GRCh38]
Chr15:23889845..23889846 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.1850G>A (p.Trp617Ter) single nucleotide variant not provided [RCV001383388] Chr15:23645893 [GRCh38]
Chr15:23891040 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.2153C>A (p.Ser718Ter) single nucleotide variant not provided [RCV001383389] Chr15:23645590 [GRCh38]
Chr15:23890737 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.1990_1991insT (p.Pro664fs) insertion not provided [RCV001385990] Chr15:23645752..23645753 [GRCh38]
Chr15:23890899..23890900 [GRCh37]
Chr15:15q11.2
pathogenic
NM_019066.5(MAGEL2):c.277C>T (p.Pro93Ser) single nucleotide variant Schaaf-Yang syndrome [RCV001376011] Chr15:23647466 [GRCh38]
Chr15:23892613 [GRCh37]
Chr15:15q11.2
pathogenic

Additional Information

Database Acc Id Source(s)
AGR Gene HGNC:6814 AgrOrtholog
COSMIC MAGEL2 COSMIC
Ensembl Genes ENSG00000254585 Ensembl, ENTREZGENE, UniProtKB/Swiss-Prot
  ENSG00000288188 UniProtKB/Swiss-Prot
Ensembl Protein ENSP00000497810 ENTREZGENE, UniProtKB/Swiss-Prot
  ENSP00000499864 UniProtKB/Swiss-Prot
  ENSP00000500572 UniProtKB/Swiss-Prot
Ensembl Transcript ENST00000650528 ENTREZGENE, UniProtKB/Swiss-Prot
  ENST00000672700 UniProtKB/Swiss-Prot
  ENST00000673192 UniProtKB/Swiss-Prot
Gene3D-CATH 1.10.10.1200 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  1.10.10.1210 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
GTEx ENSG00000254585 GTEx
  ENSG00000288188 GTEx
HGNC ID HGNC:6814 ENTREZGENE
Human Proteome Map MAGEL2 Human Proteome Map
InterPro MAGE UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  MAGE_WH1 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  MAGE_WH2 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  MHD_dom UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
KEGG Report hsa:54551 UniProtKB/Swiss-Prot
NCBI Gene 54551 ENTREZGENE
OMIM 605283 OMIM
  615547 OMIM
PANTHER PTHR11736 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Pfam MAGE UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PharmGKB PA30562 PharmGKB
PROSITE MAGE UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
SMART MAGE UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
UniProt MAGL2_HUMAN UniProtKB/Swiss-Prot
  Q05BN9_HUMAN UniProtKB/TrEMBL
  Q2M1Q7_HUMAN UniProtKB/TrEMBL
  Q6P3U4_HUMAN UniProtKB/TrEMBL
  Q9UJ55 ENTREZGENE
UniProt Secondary H0YDD5 UniProtKB/Swiss-Prot


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2015-12-08 MAGEL2  MAGE family member L2    melanoma antigen family L2  Symbol and/or name change 5135510 APPROVED
2015-02-10 MAGEL2  melanoma antigen family L2    MAGE-like 2  Symbol and/or name change 5135510 APPROVED