SMARCB1 (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: SMARCB1 (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1) Homo sapiens
Analyze
Symbol: SMARCB1
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1
RGD ID: 1318721
HGNC Page HGNC
Description: Enables several functions, including Tat protein binding activity; identical protein binding activity; and p53 binding activity. Contributes to RNA polymerase I core promoter sequence-specific DNA binding activity. Involved in several processes, including nucleosome disassembly; regulation of histone modification; and regulation of transcription, DNA-templated. Acts upstream of or within single stranded viral RNA replication via double stranded DNA intermediate. Located in fibrillar center and nucleoplasm. Part of SWI/SNF complex. Implicated in Coffin-Siris syndrome 3; atypical teratoid rhabdoid tumor; neurilemmomatosis; and rhabdoid cancer. Biomarker of colorectal adenocarcinoma; hepatocellular carcinoma; sinonasal undifferentiated carcinoma; and synovial sarcoma.
Type: protein-coding
RefSeq Status: REVIEWED
Also known as: BAF47; BRG1-associated factor 47; CSS3; hSNF5; hSNFS; INI-1; INI1; integrase interactor 1 protein; malignant rhabdoid tumor suppressor; MRD15; PPP1R144; RDT; RTPS1; Sfh1p; SNF5; SNF5 homolog; SNF5L1; Snr1; sucrose nonfermenting, yeast, homolog-like 1; SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1; SWI/SNF-related matrix-associated protein; SWNTS1
RGD Orthologs
Mouse
Rat
Chinchilla
Bonobo
Dog
Squirrel
Pig
Green Monkey
Naked Mole-Rat
Alliance Genes
More Info more info ...
Allele / Splice: See ClinVar data
Latest Assembly: GRCh38 - Human Genome Assembly GRCh38
Position:
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 Ensembl2223,786,931 - 23,838,009 (+)EnsemblGRCh38hg38GRCh38
GRCh382223,786,966 - 23,838,009 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh372224,129,153 - 24,180,196 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 362222,459,150 - 22,506,705 (+)NCBINCBI36hg18NCBI36
Build 342222,453,703 - 22,501,258NCBI
Celera227,968,247 - 8,015,764 (+)NCBI
Cytogenetic Map22q11.23NCBI
HuRef227,117,207 - 7,164,626 (+)NCBIHuRef
CHM1_12224,141,393 - 24,188,920 (+)NCBICHM1_1
JBrowse: View Region in Genome Browser (JBrowse)
Model


Gene Ontology Annotations     Click to see Annotation Detail View

Cellular Component
brahma complex  (IBA)
chromatin  (HDA,IEA,ISO)
fibrillar center  (IDA)
intracellular membrane-bounded organelle  (IDA)
nBAF complex  (IBA,IEA,ISS)
npBAF complex  (IBA,IEA,ISS)
nuclear chromosome  (IEA)
nucleolus  (IDA)
nucleoplasm  (IDA,TAS)
nucleus  (IBA,IDA,IEA,ISO)
protein-containing complex  (HDA)
SWI/SNF complex  (IBA,IDA,IEA)
XY body  (IEA)

Molecular Pathway Annotations     Click to see Annotation Detail View
Phenotype Annotations     Click to see Annotation Detail View

Human Phenotype
Abnormal brain FDG positron emission tomography  (IAGP)
Abnormal central sensory function  (IAGP)
Abnormal cerebellum morphology  (IAGP)
Abnormal corpus callosum morphology  (IAGP)
Abnormal heart morphology  (IAGP)
Abnormal kinetic perimetry test  (IAGP)
Abnormality of cardiovascular system morphology  (IAGP)
Abnormality of the mediastinum  (IAGP)
Abnormality of the sense of smell  (IAGP)
Abnormality of the skin  (IAGP)
Abnormality of the vertebral column  (IAGP)
Abnormality on pulmonary function testing  (IAGP)
Absent speech  (IAGP)
Agenesis of corpus callosum  (IAGP)
Aggressive behavior  (IAGP)
Amenorrhea  (IAGP)
Anteverted nares  (IAGP)
Apathy  (IAGP)
Aplasia/Hypoplasia of the distal phalanges of the hand  (IAGP)
Aspiration pneumonia  (IAGP)
Ataxia  (IAGP)
Atrial septal defect  (IAGP)
Autistic behavior  (IAGP)
Autosomal dominant inheritance  (IAGP)
Back pain  (IAGP)
Bitemporal hemianopia  (IAGP)
Blindness  (IAGP)
Brain stem compression  (IAGP)
Broad nasal tip  (IAGP)
Broad philtrum  (IAGP)
Cerebellar hypoplasia  (IAGP)
Cerebral calcification  (IAGP)
Cerebral hemorrhage  (IAGP)
Cerebral palsy  (IAGP)
Choroid plexus carcinoma  (IAGP)
Chromosomal breakage induced by ionizing radiation  (IAGP)
Clinodactyly  (IAGP)
Coarse facial features  (IAGP)
Cranial nerve paralysis  (IAGP)
Cryptorchidism  (IAGP)
Dandy-Walker malformation  (IAGP)
Decreased circulating ACTH level  (IAGP)
Decreased circulating cortisol level  (IAGP)
Decreased circulating follicle stimulating hormone concentration  (IAGP)
Decreased circulating luteinizing hormone level  (IAGP)
Decreased serum estradiol  (IAGP)
Decreased serum testosterone concentration  (IAGP)
Delayed eruption of permanent teeth  (IAGP)
Delayed eruption of teeth  (IAGP)
Delayed skeletal maturation  (IAGP)
Depressed nasal bridge  (IAGP)
Difficulty walking  (IAGP)
Ear pain  (IAGP)
Emotional lability  (IAGP)
Enlarged pituitary gland  (IAGP)
Excessive daytime somnolence  (IAGP)
Facial palsy  (IAGP)
Feeding difficulties  (IAGP)
Focal T2 hypointense thalamic lesion  (IAGP)
Focal-onset seizure  (IAGP)
Generalized hypotonia  (IAGP)
Global developmental delay  (IAGP)
Headache  (IAGP)
Hearing impairment  (IAGP)
Hemifacial spasm  (IAGP)
Hemiparesis  (IAGP)
Hemiplegia/hemiparesis  (IAGP)
Hepatoblastoma  (IAGP)
Hernia  (IAGP)
Hirsutism  (IAGP)
Horseshoe kidney  (IAGP)
Hydrocephalus  (IAGP)
Hyperactivity  (IAGP)
Hypertrichosis  (IAGP)
Hypogonadotropic hypogonadism  (IAGP)
Hypoplastic fifth fingernail  (IAGP)
Hypoplastic fifth toenail  (IAGP)
Hypospadias  (IAGP)
Hypothalamic hypothyroidism  (IAGP)
Impotence  (IAGP)
Incomplete penetrance  (IAGP)
Increased circulating prolactin concentration  (IAGP)
Increased intracranial pressure  (IAGP)
Increased sensitivity to ionizing radiation  (IAGP)
Infantile muscular hypotonia  (IAGP)
Intellectual disability  (IAGP)
Intellectual disability, moderate  (IAGP)
Intellectual disability, severe  (IAGP)
Intracranial meningioma  (IAGP)
Intrauterine growth retardation  (IAGP)
Irritability  (IAGP)
Joint laxity  (IAGP)
Limitation of joint mobility  (IAGP)
Long eyelashes  (IAGP)
Low anterior hairline  (IAGP)
Lower limb muscle weakness  (IAGP)
Macrocephaly  (IAGP)
Macroglossia  (IAGP)
Malignant neoplasm of the central nervous system  (IAGP)
Medulloblastoma  (IAGP)
Meningioma  (IAGP)
Microcephaly  (IAGP)
Migraine  (IAGP)
Muscle weakness  (IAGP)
Myopia  (IAGP)
Nausea and vomiting  (IAGP)
Neoplasm of the anterior pituitary  (IAGP)
Neoplasm of the central nervous system  (IAGP)
Neoplasm of the posterior pituitary  (IAGP)
Neoplasm of the tongue  (IAGP)
Neurofibromas  (IAGP)
Neurological speech impairment  (IAGP)
Obesity  (IAGP)
Oculomotor nerve palsy  (IAGP)
Ophthalmoplegia  (IAGP)
Oral aversion  (IAGP)
Papillary thyroid carcinoma  (IAGP)
Papilledema  (IAGP)
Patent ductus arteriosus  (IAGP)
Peripheral Schwannoma  (IAGP)
Pituitary hypothyroidism  (IAGP)
Postnatal growth retardation  (IAGP)
Progressive pulmonary function impairment  (IAGP)
Prominent eyelashes  (IAGP)
Proptosis  (IAGP)
Ptosis  (IAGP)
Recurrent upper respiratory tract infections  (IAGP)
Reduced circulating prolactin concentration  (IAGP)
Reduced consciousness/confusion  (IAGP)
Schizophrenia  (IAGP)
Schwannoma  (IAGP)
Scoliosis  (IAGP)
Secondary growth hormone deficiency  (IAGP)
Seizure  (IAGP)
Short 5th finger  (IAGP)
Short nose  (IAGP)
Short stature  (IAGP)
Simplified gyral pattern  (IAGP)
Slow decrease in visual acuity  (IAGP)
Somatic mutation  (IAGP)
Sparse scalp hair  (IAGP)
Spinal cord tumor  (IAGP)
Spinal meningioma  (IAGP)
Strabismus  (IAGP)
Syncope  (IAGP)
Tetralogy of Fallot  (IAGP)
Thick eyebrow  (IAGP)
Thick lower lip vermilion  (IAGP)
Thick nasal alae  (IAGP)
Thin upper lip vermilion  (IAGP)
Tinnitus  (IAGP)
Transient global amnesia  (IAGP)
Trigeminal neuralgia  (IAGP)
Upper limb muscle weakness  (IAGP)
Urinary incontinence  (IAGP)
Variable expressivity  (IAGP)
Ventricular septal defect  (IAGP)
Visual acuity test abnormality  (IAGP)
Visual impairment  (IAGP)
Weak extraocular muscles  (IAGP)
Wide mouth  (IAGP)
Wide nasal base  (IAGP)
Wide nose  (IAGP)
References

Additional References at PubMed
PMID:1569166   PMID:7627549   PMID:7739891   PMID:7801128   PMID:8709224   PMID:8804307   PMID:8895581   PMID:9128241   PMID:9448295   PMID:9584200   PMID:9710619   PMID:9744861  
PMID:9845365   PMID:9891079   PMID:9892189   PMID:10078207   PMID:10208879   PMID:10319872   PMID:10365963   PMID:10490642   PMID:10521299   PMID:10619021   PMID:10688647   PMID:10739763  
PMID:10773452   PMID:10943845   PMID:11013263   PMID:11018012   PMID:11078522   PMID:11085541   PMID:11238380   PMID:11259590   PMID:11430827   PMID:11479624   PMID:11486022   PMID:11726552  
PMID:11734557   PMID:11756182   PMID:11782395   PMID:11782423   PMID:11784859   PMID:11880634   PMID:11921280   PMID:11950834   PMID:12016208   PMID:12082626   PMID:12112529   PMID:12138206  
PMID:12145209   PMID:12200431   PMID:12213194   PMID:12226744   PMID:12368262   PMID:12453419   PMID:12477932   PMID:12548550   PMID:12620397   PMID:12637547   PMID:12665591   PMID:12892231  
PMID:14526201   PMID:14559996   PMID:14604992   PMID:14702039   PMID:14729568   PMID:14743216   PMID:14963118   PMID:14990991   PMID:15096481   PMID:15101046   PMID:15141006   PMID:15150092  
PMID:15175083   PMID:15314177   PMID:15461802   PMID:15489652   PMID:15589835   PMID:15642401   PMID:15696166   PMID:15761491   PMID:15769941   PMID:15796965   PMID:15875659   PMID:15899790  
PMID:15981100   PMID:15985610   PMID:15993274   PMID:16075307   PMID:16154112   PMID:16169070   PMID:16199878   PMID:16217013   PMID:16219292   PMID:16267391   PMID:16287714   PMID:16288006  
PMID:16314535   PMID:16344560   PMID:16387653   PMID:16403635   PMID:16528370   PMID:16568092   PMID:16601680   PMID:16687403   PMID:16712791   PMID:16772295   PMID:16889668   PMID:16912184  
PMID:16945155   PMID:17357086   PMID:17376508   PMID:17486366   PMID:17616514   PMID:17620012   PMID:17669367   PMID:17699849   PMID:17717433   PMID:17922027   PMID:18029348   PMID:18042045  
PMID:18072270   PMID:18087273   PMID:18236049   PMID:18262058   PMID:18266055   PMID:18285426   PMID:18327209   PMID:18414052   PMID:18422762   PMID:18580682   PMID:18647326   PMID:18676838  
PMID:18710953   PMID:18809673   PMID:18973917   PMID:18985520   PMID:18997735   PMID:19014595   PMID:19033866   PMID:19061646   PMID:19124645   PMID:19141382   PMID:19221051   PMID:19221586  
PMID:19224332   PMID:19232540   PMID:19234532   PMID:19276269   PMID:19305156   PMID:19320657   PMID:19328320   PMID:19351817   PMID:19371634   PMID:19389610   PMID:19398554   PMID:19454010  
PMID:19480937   PMID:19503603   PMID:19505873   PMID:19515827   PMID:19525936   PMID:19582488   PMID:19650111   PMID:19683621   PMID:19716452   PMID:19750561   PMID:19805520   PMID:19808872  
PMID:19902524   PMID:19913121   PMID:20003390   PMID:20078948   PMID:20111005   PMID:20118769   PMID:20301533   PMID:20305087   PMID:20305614   PMID:20360068   PMID:20460684   PMID:20472658  
PMID:20506188   PMID:20614030   PMID:20628086   PMID:20829602   PMID:20930055   PMID:20932739   PMID:21057957   PMID:21108436   PMID:21127945   PMID:21145461   PMID:21159066   PMID:21159874  
PMID:21208904   PMID:21240060   PMID:21255467   PMID:21347347   PMID:21494030   PMID:21520050   PMID:21521802   PMID:21532573   PMID:21549307   PMID:21613800   PMID:21637919   PMID:21705046  
PMID:21809989   PMID:21832049   PMID:21873635   PMID:21900206   PMID:21994574   PMID:22020042   PMID:22038540   PMID:22082606   PMID:22242598   PMID:22285184   PMID:22334708   PMID:22368283  
PMID:22434358   PMID:22479537   PMID:22490415   PMID:22544318   PMID:22573825   PMID:22614000   PMID:22672440   PMID:22686875   PMID:22698742   PMID:22752724   PMID:22797305   PMID:22928108  
PMID:22939629   PMID:22949514   PMID:23060122   PMID:23074045   PMID:23174932   PMID:23245672   PMID:23275444   PMID:23348212   PMID:23364536   PMID:23382691   PMID:23435428   PMID:23540691  
PMID:23556151   PMID:23593299   PMID:23602572   PMID:23667531   PMID:23799881   PMID:23815551   PMID:23851497   PMID:23861745   PMID:23904343   PMID:24075062   PMID:24123847   PMID:24204904  
PMID:24285714   PMID:24286138   PMID:24287458   PMID:24327545   PMID:24418192   PMID:24503755   PMID:24525513   PMID:24585572   PMID:24705354   PMID:24832165   PMID:24853101   PMID:24874740  
PMID:24933152   PMID:24981860   PMID:24983247   PMID:25007146   PMID:25009291   PMID:25081545   PMID:25103069   PMID:25168959   PMID:25200863   PMID:25246033   PMID:25271443   PMID:25479928  
PMID:25496315   PMID:25559666   PMID:25609649   PMID:25649007   PMID:25651469   PMID:25663425   PMID:25731772   PMID:25754356   PMID:26073604   PMID:26109171   PMID:26171919   PMID:26186194  
PMID:26261664   PMID:26318153   PMID:26342593   PMID:26342709   PMID:26344197   PMID:26350979   PMID:26364901   PMID:26433572   PMID:26472760   PMID:26496610   PMID:26965049   PMID:27218413  
PMID:27223121   PMID:27229929   PMID:27246730   PMID:27248496   PMID:27261671   PMID:27267444   PMID:27339451   PMID:27356182   PMID:27380723   PMID:27466490   PMID:27503929   PMID:27558426  
PMID:27591253   PMID:27634302   PMID:27635948   PMID:27716508   PMID:27732747   PMID:27733182   PMID:27783955   PMID:27941797   PMID:28069272   PMID:28109176   PMID:28228393   PMID:28235567  
PMID:28242625   PMID:28291122   PMID:28319113   PMID:28338502   PMID:28365909   PMID:28368924   PMID:28420320   PMID:28438634   PMID:28481362   PMID:28514442   PMID:28533407   PMID:28611094  
PMID:28620005   PMID:28620006   PMID:28716547   PMID:28722703   PMID:28825187   PMID:28863077   PMID:28945250   PMID:28974397   PMID:28977666   PMID:29053956   PMID:29128334   PMID:29135520  
PMID:29215836   PMID:29222701   PMID:29229926   PMID:29230670   PMID:29280680   PMID:29309303   PMID:29334836   PMID:29374058   PMID:29483235   PMID:29509190   PMID:29517885   PMID:29625594  
PMID:29656893   PMID:29706634   PMID:29861296   PMID:29907796   PMID:29955894   PMID:30021884   PMID:30108113   PMID:30178299   PMID:30463901   PMID:30472188   PMID:30504402   PMID:30804502  
PMID:30860482   PMID:30864974   PMID:30890647   PMID:30940648   PMID:30962207   PMID:31043422   PMID:31043611   PMID:31048545   PMID:31091453   PMID:31132763   PMID:31182584   PMID:31240424  
PMID:31273213   PMID:31403913   PMID:31422588   PMID:31438887   PMID:31445842   PMID:31502250   PMID:31567195   PMID:31586073   PMID:31631027   PMID:31732806   PMID:31753913   PMID:31759698  
PMID:31857543   PMID:31906887   PMID:31914534   PMID:32001406   PMID:32071317   PMID:32083567   PMID:32218533   PMID:32244797   PMID:32296183   PMID:32306640   PMID:32359397   PMID:32416067  
PMID:32420340   PMID:32492816   PMID:32558936   PMID:32576656   PMID:32799369   PMID:32814053   PMID:32818509   PMID:32901946   PMID:32910019   PMID:32912900   PMID:32918875   PMID:32940101  
PMID:33035459   PMID:33125876   PMID:33163142   PMID:33239431   PMID:33331994   PMID:33481850   PMID:33536423   PMID:33581550   PMID:33625734   PMID:33658498   PMID:33677882   PMID:33931740  
PMID:33961781   PMID:33980829   PMID:34003336   PMID:34133714   PMID:34145313   PMID:34609565   PMID:34668612   PMID:34719161  


Genomics

Comparative Map Data
SMARCB1
(Homo sapiens - human)
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 Ensembl2223,786,931 - 23,838,009 (+)EnsemblGRCh38hg38GRCh38
GRCh382223,786,966 - 23,838,009 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh372224,129,153 - 24,180,196 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 362222,459,150 - 22,506,705 (+)NCBINCBI36hg18NCBI36
Build 342222,453,703 - 22,501,258NCBI
Celera227,968,247 - 8,015,764 (+)NCBI
Cytogenetic Map22q11.23NCBI
HuRef227,117,207 - 7,164,626 (+)NCBIHuRef
CHM1_12224,141,393 - 24,188,920 (+)NCBICHM1_1
Smarcb1
(Mus musculus - house mouse)
Mouse AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCm391075,732,603 - 75,757,448 (-)NCBIGRCm39mm39
GRCm39 Ensembl1075,732,603 - 75,757,451 (-)Ensembl
GRCm381075,896,769 - 75,921,614 (-)NCBIGRCm38GRCm38mm10GRCm38
GRCm38.p6 Ensembl1075,896,769 - 75,921,617 (-)EnsemblGRCm38mm10GRCm38
MGSCv371075,359,514 - 75,384,359 (-)NCBIGRCm37mm9NCBIm37
MGSCv361075,340,491 - 75,365,304 (-)NCBImm8
Celera1076,941,458 - 76,966,299 (-)NCBICelera
Cytogenetic Map10C1NCBI
Smarcb1
(Rattus norvegicus - Norway rat)
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
mRatBN7.22012,741,164 - 12,763,616 (+)NCBImRatBN7.2
mRatBN7.2 Ensembl2012,741,477 - 12,763,620 (+)Ensembl
Rnor_6.02013,679,955 - 13,702,821 (+)NCBIRnor6.0Rnor_6.0rn6Rnor6.0
Rnor_6.0 Ensembl2013,680,716 - 13,704,931 (+)EnsemblRnor6.0rn6Rnor6.0
Rnor_5.02015,836,242 - 15,858,384 (+)NCBIRnor5.0Rnor_5.0rn5Rnor5.0
RGSC_v3.42013,140,331 - 13,162,437 (+)NCBIRGSC3.4rn4RGSC3.4
RGSC_v3.12013,140,557 - 13,162,664 (+)NCBI
Celera2014,232,795 - 14,254,901 (+)NCBICelera
Cytogenetic Map20p12NCBI
Smarcb1
(Chinchilla lanigera - long-tailed chinchilla)
Chinchilla AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChiLan1.0 EnsemblNW_0049554558,415,839 - 8,457,097 (-)EnsemblChiLan1.0
ChiLan1.0NW_0049554558,420,263 - 8,457,105 (-)NCBIChiLan1.0ChiLan1.0
SMARCB1
(Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
PanPan1.12222,627,950 - 22,673,921 (+)NCBIpanpan1.1PanPan1.1panPan2
PanPan1.1 Ensembl2222,627,982 - 22,673,921 (+)Ensemblpanpan1.1panPan2
Mhudiblu_PPA_v0224,542,764 - 4,589,461 (+)NCBIMhudiblu_PPA_v0panPan3
SMARCB1
(Canis lupus familiaris - dog)
Dog AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
CanFam3.12628,692,610 - 28,728,778 (-)NCBICanFam3.1CanFam3.1canFam3CanFam3.1
CanFam3.1 Ensembl2628,692,899 - 28,728,783 (-)EnsemblCanFam3.1canFam3CanFam3.1
Dog10K_Boxer_Tasha2627,765,925 - 27,802,103 (-)NCBI
ROS_Cfam_1.02630,097,586 - 30,133,966 (-)NCBI
ROS_Cfam_1.0 Ensembl2630,097,586 - 30,134,047 (-)Ensembl
UMICH_Zoey_3.12628,178,905 - 28,215,089 (-)NCBI
UNSW_CanFamBas_1.02627,796,839 - 27,833,022 (-)NCBI
UU_Cfam_GSD_1.02628,784,702 - 28,820,890 (-)NCBI
Smarcb1
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)
Squirrel AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HiC_Itri_2NW_024405118141,445,150 - 141,477,819 (+)NCBI
SpeTri2.0NW_0049366191,276,239 - 1,308,945 (-)NCBISpeTri2.0SpeTri2.0SpeTri2.0
SMARCB1
(Sus scrofa - pig)
Pig AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Sscrofa11.1 Ensembl1449,874,984 - 49,906,048 (-)EnsemblSscrofa11.1susScr11Sscrofa11.1
Sscrofa11.11449,874,981 - 49,906,043 (-)NCBISscrofa11.1Sscrofa11.1susScr11Sscrofa11.1
Sscrofa10.21453,317,251 - 53,348,336 (-)NCBISscrofa10.2Sscrofa10.2susScr3
SMARCB1
(Chlorocebus sabaeus - green monkey)
Green Monkey AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChlSab1.1196,902,985 - 6,945,111 (+)NCBIChlSab1.1chlSab2
ChlSab1.1196,902,985 - 6,945,111 (+)NCBIChlSab1.1chlSab2
ChlSab1.1 Ensembl196,902,951 - 6,944,784 (+)EnsemblChlSab1.1chlSab2
Vero_WHO_p1.0NW_023666100428,050 - 470,045 (-)NCBIVero_WHO_p1.0
Smarcb1
(Heterocephalus glaber - naked mole-rat)
Naked Mole-rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HetGla 1.0NW_00462474710,362,149 - 10,396,580 (-)NCBIHetGla_female_1.0hetGla2

Position Markers
RH80678  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372224,176,704 - 24,176,933UniSTSGRCh37
Build 362222,506,704 - 22,506,933RGDNCBI36
Celera228,015,763 - 8,015,992RGD
Cytogenetic Map22q11UniSTS
Cytogenetic Map22q11.23UniSTS
HuRef227,164,625 - 7,164,854UniSTS
GeneMap99-GB4 RH Map2248.17UniSTS
RH80266  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372224,155,498 - 24,155,667UniSTSGRCh37
Build 362222,485,498 - 22,485,667RGDNCBI36
Celera227,994,592 - 7,994,761RGD
Cytogenetic Map22q11UniSTS
Cytogenetic Map22q11.23UniSTS
HuRef227,143,432 - 7,143,601UniSTS
GeneMap99-GB4 RH Map2250.97UniSTS
SHGC-33862  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372224,154,546 - 24,154,694UniSTSGRCh37
Build 362222,484,546 - 22,484,694RGDNCBI36
Celera227,993,639 - 7,993,787RGD
Cytogenetic Map22q11UniSTS
Cytogenetic Map22q11.23UniSTS
HuRef227,142,479 - 7,142,627UniSTS
Stanford-G3 RH Map22345.0UniSTS
GeneMap99-GB4 RH Map2272.18UniSTS
Whitehead-RH Map2241.1UniSTS
GeneMap99-G3 RH Map22345.0UniSTS
A006E25  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372224,176,595 - 24,176,725UniSTSGRCh37
GRCh372224,176,595 - 24,176,702UniSTSGRCh37
Build 362222,506,595 - 22,506,702RGDNCBI36
Celera228,015,654 - 8,015,784UniSTS
Celera228,015,654 - 8,015,761RGD
Cytogenetic Map22q11UniSTS
Cytogenetic Map22q11.23UniSTS
HuRef227,164,516 - 7,164,646UniSTS
HuRef227,164,516 - 7,164,623UniSTS
GeneMap99-GB4 RH Map2272.18UniSTS
G20745  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372224,176,595 - 24,176,725UniSTSGRCh37
GRCh372224,176,595 - 24,176,702UniSTSGRCh37
Build 362222,506,595 - 22,506,702RGDNCBI36
Celera228,015,654 - 8,015,784UniSTS
Celera228,015,654 - 8,015,761RGD
Cytogenetic Map22q11.23UniSTS
Cytogenetic Map22q11UniSTS
HuRef227,164,516 - 7,164,623UniSTS
HuRef227,164,516 - 7,164,646UniSTS

miRNA Target Status

Predicted Target Of
Summary Value
Count of predictions:2279
Count of miRNA genes:749
Interacting mature miRNAs:884
Transcripts:ENST00000263121, ENST00000344921, ENST00000407082, ENST00000407422, ENST00000417137, ENST00000477836, ENST00000491967
Prediction methods:Microtar, Miranda, Rnahybrid
Result types:miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.


Expression


RNA-SEQ Expression
High: > 1000 TPM value   Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM   Below Cutoff: < 0.5 TPM

alimentary part of gastrointestinal system circulatory system endocrine system exocrine system hemolymphoid system hepatobiliary system integumental system musculoskeletal system nervous system renal system reproductive system respiratory system sensory system visual system adipose tissue appendage entire extraembryonic component pharyngeal arch
High
Medium 2439 2740 1674 573 1815 414 4354 2090 3635 415 1460 1612 175 1 1204 2785 6 2
Low 251 52 51 136 51 3 107 99 4 3
Below cutoff 1

Sequence

Nucleotide Sequences
RefSeq Transcripts NG_009303 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001007468 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001317946 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001362877 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_003073 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AB017523 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ011737 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ011738 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK021419 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK024025 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK299411 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK303620 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL389878 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL389881 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AP000349 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AP000350 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AU143041 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY207470 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY207471 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY207472 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY562997 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC117114 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC143667 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BG705851 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CB161660 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471095 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CR456581 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ230988 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  HY013730 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LC523818 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LC523819 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LC523820 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LC523821 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  R37717 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Y17118 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Y17119 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Y17120 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Y17121 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Y17122 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Y17123 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Y17124 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Y17125 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Y17126 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles

Reference Sequences
RefSeq Acc Id: ENST00000263121   ⟹   ENSP00000263121
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,787,011 - 23,834,501 (+)Ensembl
RefSeq Acc Id: ENST00000344921   ⟹   ENSP00000340883
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,786,963 - 23,834,505 (+)Ensembl
RefSeq Acc Id: ENST00000407082   ⟹   ENSP00000385226
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,787,017 - 23,803,401 (+)Ensembl
RefSeq Acc Id: ENST00000407422   ⟹   ENSP00000383984
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,786,931 - 23,834,540 (+)Ensembl
RefSeq Acc Id: ENST00000417137   ⟹   ENSP00000388489
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,787,027 - 23,816,833 (+)Ensembl
RefSeq Acc Id: ENST00000477836
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,814,991 - 23,833,587 (+)Ensembl
RefSeq Acc Id: ENST00000491967
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,786,980 - 23,802,060 (+)Ensembl
RefSeq Acc Id: ENST00000634926   ⟹   ENSP00000489445
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,791,811 - 23,803,322 (+)Ensembl
RefSeq Acc Id: ENST00000635578   ⟹   ENSP00000489115
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,791,811 - 23,803,322 (+)Ensembl
RefSeq Acc Id: ENST00000642275
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,802,547 - 23,818,580 (+)Ensembl
RefSeq Acc Id: ENST00000642727   ⟹   ENSP00000495144
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,801,299 - 23,803,629 (+)Ensembl
RefSeq Acc Id: ENST00000643421
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,787,202 - 23,804,383 (+)Ensembl
RefSeq Acc Id: ENST00000644036   ⟹   ENSP00000494049
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,786,966 - 23,838,009 (+)Ensembl
RefSeq Acc Id: ENST00000644462   ⟹   ENSP00000494283
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,791,801 - 23,834,358 (+)Ensembl
RefSeq Acc Id: ENST00000644467
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,802,001 - 23,818,669 (+)Ensembl
RefSeq Acc Id: ENST00000644619   ⟹   ENSP00000494695
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,787,001 - 23,816,927 (+)Ensembl
RefSeq Acc Id: ENST00000645799
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,823,108 - 23,834,353 (+)Ensembl
RefSeq Acc Id: ENST00000646421
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,786,978 - 23,802,275 (+)Ensembl
RefSeq Acc Id: ENST00000646723
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,787,182 - 23,834,270 (+)Ensembl
RefSeq Acc Id: ENST00000646911
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,787,258 - 23,826,248 (+)Ensembl
RefSeq Acc Id: ENST00000647057   ⟹   ENSP00000494757
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl2223,786,983 - 23,834,505 (+)Ensembl
RefSeq Acc Id: NM_001007468   ⟹   NP_001007469
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382223,786,966 - 23,838,009 (+)NCBI
GRCh372224,129,150 - 24,176,705 (+)ENTREZGENE
Build 362222,459,150 - 22,506,705 (+)NCBI Archive
HuRef227,117,207 - 7,164,626 (+)ENTREZGENE
CHM1_12224,141,361 - 24,188,920 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001317946   ⟹   NP_001304875
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382223,786,966 - 23,838,009 (+)NCBI
CHM1_12224,141,361 - 24,188,920 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001362877   ⟹   NP_001349806
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382223,786,966 - 23,838,009 (+)NCBI
Sequence:
RefSeq Acc Id: NM_003073   ⟹   NP_003064
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh382223,786,966 - 23,838,009 (+)NCBI
GRCh372224,129,150 - 24,176,705 (+)ENTREZGENE
Build 362222,459,150 - 22,506,705 (+)NCBI Archive
HuRef227,117,207 - 7,164,626 (+)ENTREZGENE
CHM1_12224,141,361 - 24,188,920 (+)NCBI
Sequence:
Reference Sequences
RefSeq Acc Id: NP_003064   ⟸   NM_003073
- Peptide Label: isoform a
- UniProtKB: Q12824 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: NP_001007469   ⟸   NM_001007468
- Peptide Label: isoform b
- UniProtKB: Q12824 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: NP_001304875   ⟸   NM_001317946
- Peptide Label: isoform c
- UniProtKB: G5E975 (UniProtKB/TrEMBL),   Q9H836 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: NP_001349806   ⟸   NM_001362877
- Peptide Label: isoform d
RefSeq Acc Id: ENSP00000489445   ⟸   ENST00000634926
RefSeq Acc Id: ENSP00000489115   ⟸   ENST00000635578
RefSeq Acc Id: ENSP00000388489   ⟸   ENST00000417137
RefSeq Acc Id: ENSP00000385226   ⟸   ENST00000407082
RefSeq Acc Id: ENSP00000383984   ⟸   ENST00000407422
RefSeq Acc Id: ENSP00000495144   ⟸   ENST00000642727
RefSeq Acc Id: ENSP00000494695   ⟸   ENST00000644619
RefSeq Acc Id: ENSP00000494283   ⟸   ENST00000644462
RefSeq Acc Id: ENSP00000494049   ⟸   ENST00000644036
RefSeq Acc Id: ENSP00000263121   ⟸   ENST00000263121
RefSeq Acc Id: ENSP00000494757   ⟸   ENST00000647057
RefSeq Acc Id: ENSP00000340883   ⟸   ENST00000344921

Promoters
RGD ID:6799858
Promoter ID:HG_KWN:41964
Type:CpG-Island
SO ACC ID:SO:0000170
Source:MPROMDB
Tissues & Cell Lines:CD4+TCell,   CD4+TCell_12Hour,   CD4+TCell_2Hour,   HeLa_S3,   Jurkat,   K562,   Lymphoblastoid,   NB4
Transcripts:ENST00000407082,   NM_001007468,   NM_003073,   OTTHUMT00000319877,   UC002ZYA.2,   UC002ZYD.1
Position:
Human AssemblyChrPosition (strand)Source
Build 362222,458,916 - 22,459,637 (+)MPROMDB
RGD ID:6851840
Promoter ID:EP73725
Type:multiple initiation site
Name:HS_SMARCB1
Description:SWI/SNF related, matrix associated, actin dependent regulator ofchromatin, subfamily b, member 1.
SO ACC ID:SO:0000170
Source:EPD (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Experiment Methods:NEDO full length human cDNA sequencing project.; Oligo-capping
Position:
Human AssemblyChrPosition (strand)Source
Build 362222,459,167 - 22,459,227EPD
RGD ID:6800373
Promoter ID:HG_KWN:41967
Type:Non-CpG
SO ACC ID:SO:0000170
Source:MPROMDB
Tissues & Cell Lines:Lymphoblastoid
Transcripts:OTTHUMT00000319878
Position:
Human AssemblyChrPosition (strand)Source
Build 362222,488,251 - 22,488,751 (+)MPROMDB
RGD ID:13603442
Promoter ID:EPDNEW_H27905
Type:initiation region
Name:SMARCB1_1
Description:SWI/SNF related, matrix associated, actin dependent regulatorof chromatin, subfamily b, member 1
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Experiment Methods:Single-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh382223,786,978 - 23,787,038EPDNEW

Clinical Variants
Name Type Condition(s) Position(s) Clinical significance
NM_003073.5(SMARCB1):c.582G>A (p.Glu194=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001024580]|not provided [RCV000547067] Chr22:23803376 [GRCh38]
Chr22:24145563 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.282G>A (p.Ser94=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001016713]|not provided [RCV000553269] Chr22:23793608 [GRCh38]
Chr22:24135795 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1038G>A (p.Ala346=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000566596]|not provided [RCV000874410] Chr22:23833623 [GRCh38]
Chr22:24175810 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1085AGA[2] (p.Lys364del) microsatellite Mental retardation, autosomal dominant 15 [RCV000023121]|not provided [RCV000377856] Chr22:23833670..23833672 [GRCh38]
Chr22:24175857..24175859 [GRCh37]
Chr22:22q11.23
pathogenic|likely pathogenic
NM_003073.5(SMARCB1):c.951del (p.Gln318fs) deletion Malignant rhabdoid tumor, somatic [RCV000008486] Chr22:23825380 [GRCh38]
Chr22:24167567 [GRCh37]
Chr22:22q11.23
pathogenic|other
SMARCB1, 19-BP DEL deletion Malignant rhabdoid tumor, somatic [RCV000008487] Chr22:22q11 pathogenic|other
NM_003073.5(SMARCB1):c.591del (p.Gln198fs) deletion Rhabdoid tumor predisposition syndrome 1 [RCV000008488] Chr22:23803383 [GRCh38]
Chr22:24145570 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.986+1G>A single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000008489] Chr22:23825416 [GRCh38]
Chr22:24167603 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.203_216delinsTACC (p.His68fs) indel Schwannomatosis 1 [RCV000008492] Chr22:23791865..23791878 [GRCh38]
Chr22:24134052..24134065 [GRCh37]
Chr22:22q11.23
pathogenic
SMARCB1, 7-BP DEL, NT233 deletion Schwannomatosis 1 [RCV000008493] Chr22:22q11 pathogenic
NM_003073.5(SMARCB1):c.629-361_795+2103dup duplication Rhabdoid tumor predisposition syndrome 1 [RCV000008495]|Schwannomatosis 1 [RCV000008494] Chr22:23816405..23816406 [GRCh38]
Chr22:24158592..24158593 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.628+5A>G single nucleotide variant not provided [RCV000543607] Chr22:23803427 [GRCh38]
Chr22:24145614 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.912C>T (p.Gly304=) single nucleotide variant not provided [RCV000639923] Chr22:23825341 [GRCh38]
Chr22:24167528 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.90C>G (p.Ser30=) single nucleotide variant not provided [RCV000555337] Chr22:23787259 [GRCh38]
Chr22:24129446 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.137_140dup (p.Tyr47Ter) duplication Rhabdoid tumor predisposition syndrome 1 [RCV000552170]|not provided [RCV001385486] Chr22:23791797..23791798 [GRCh38]
Chr22:24133984..24133985 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.501-1G>C single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000554042]|not provided [RCV001388061] Chr22:23803294 [GRCh38]
Chr22:24145481 [GRCh37]
Chr22:22q11.23
pathogenic|likely pathogenic
NC_000022.10:g.(?_24143125)_(24176373_?)dup duplication Rhabdoid tumor predisposition syndrome 1 [RCV000551371] Chr22:24143125..24176373 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.495C>G (p.Pro165=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001023324]|not provided [RCV000546301] Chr22:23801076 [GRCh38]
Chr22:24143263 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.510C>T (p.Asp170=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000567126]|not provided [RCV000864929] Chr22:23803304 [GRCh38]
Chr22:24145491 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.734T>C (p.Ile245Thr) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000564442] Chr22:23816875 [GRCh38]
Chr22:24159062 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.31G>A (p.Gly11Arg) single nucleotide variant Intellectual disability [RCV001260856]|not provided [RCV000522979] Chr22:23787200 [GRCh38]
Chr22:24129387 [GRCh37]
Chr22:22q11.23
pathogenic|likely pathogenic|uncertain significance
NM_003073.5(SMARCB1):c.881C>T (p.Ala294Val) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000564624] Chr22:23825310 [GRCh38]
Chr22:24167497 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.34C>T (p.Gln12Ter) single nucleotide variant Schwannomatosis 1 [RCV000008490] Chr22:23787203 [GRCh38]
Chr22:24129390 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.544C>T (p.Gln182Ter) single nucleotide variant Schwannomatosis 1, somatic [RCV000008491] Chr22:23803338 [GRCh38]
Chr22:24145525 [GRCh37]
Chr22:22q11.23
pathogenic|other
NM_003073.5(SMARCB1):c.92A>T (p.Glu31Val) single nucleotide variant Schwannomatosis 1 [RCV000008496] Chr22:23787261 [GRCh38]
Chr22:24129448 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.143C>T (p.Pro48Leu) single nucleotide variant Schwannomatosis 1 [RCV000023122]|not provided [RCV001321700] Chr22:23791805 [GRCh38]
Chr22:24133992 [GRCh37]
Chr22:22q11.23
pathogenic|uncertain significance
NM_003073.5(SMARCB1):c.1130G>A (p.Arg377His) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001017402]|Mental retardation, autosomal dominant 15 [RCV000023124]|not provided [RCV001238882] Chr22:23834152 [GRCh38]
Chr22:24176339 [GRCh37]
Chr22:22q11.23
pathogenic|uncertain significance
NM_003073.5(SMARCB1):c.897G>A (p.Ser299=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000563757]|Rhabdoid tumor predisposition syndrome 1 [RCV000368609]|Schwannomatosis 1 [RCV000272799]|not provided [RCV000589103]|not specified [RCV000114311] Chr22:23825326 [GRCh38]
Chr22:24167513 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.110G>A (p.Arg37His) single nucleotide variant Mental retardation, autosomal dominant 15 [RCV000074462]|SMARCB1-related BAFopathy [RCV001533133]|not provided [RCV000262341] Chr22:23791772 [GRCh38]
Chr22:24133959 [GRCh37]
Chr22:22q11.23
pathogenic|uncertain significance
NM_003073.5(SMARCB1):c.500+24C>G single nucleotide variant not provided [RCV000034699]|not specified [RCV000119888] Chr22:23801105 [GRCh38]
Chr22:24143292 [GRCh37]
Chr22:22q11.23
uncertain significance|not provided
GRCh38/hg38 22q11.21-12.3(chr22:18178957-31821193)x3 copy number gain See cases [RCV000050768] Chr22:18178957..31821193 [GRCh38]
Chr22:18661724..32217179 [GRCh37]
Chr22:17041724..30547179 [NCBI36]
Chr22:22q11.21-12.3
pathogenic
GRCh38/hg38 22q11.22-11.23(chr22:22669543-24563859)x3 copy number gain See cases [RCV000050739] Chr22:22669543..24563859 [GRCh38]
Chr22:23012013..24959827 [GRCh37]
Chr22:21342013..23289827 [NCBI36]
Chr22:22q11.22-11.23
conflicting interpretations of pathogenicity|uncertain significance|conflicting data from submitters
GRCh38/hg38 22q11.23(chr22:23338443-24610403)x3 copy number gain See cases [RCV000053174] Chr22:23338443..24610403 [GRCh38]
Chr22:23680630..25006370 [GRCh37]
Chr22:22010630..23336370 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.21-11.23(chr22:21454661-24197852)x1 copy number loss Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053084]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053084]|See cases [RCV000053084] Chr22:21454661..24197852 [GRCh38]
Chr22:21808950..24593820 [GRCh37]
Chr22:20138950..22923820 [NCBI36]
Chr22:22q11.21-11.23
pathogenic
GRCh38/hg38 22q11.21-11.23(chr22:21457690-24220231)x1 copy number loss See cases [RCV000053087] Chr22:21457690..24220231 [GRCh38]
Chr22:21811979..24616199 [GRCh37]
Chr22:20141979..22946199 [NCBI36]
Chr22:22q11.21-11.23
pathogenic
GRCh38/hg38 22q11.23(chr22:23338443-24577664)x3 copy number gain See cases [RCV000053175] Chr22:23338443..24577664 [GRCh38]
Chr22:23680630..24973632 [GRCh37]
Chr22:22010630..23303632 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.23(chr22:23354221-24541945)x3 copy number gain See cases [RCV000053176] Chr22:23354221..24541945 [GRCh38]
Chr22:23696408..24937913 [GRCh37]
Chr22:22026408..23267913 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.23(chr22:23369950-24669609)x3 copy number gain See cases [RCV000053177] Chr22:23369950..24669609 [GRCh38]
Chr22:23712137..25065576 [GRCh37]
Chr22:22042137..23395576 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.23(chr22:23377784-24564000)x3 copy number gain See cases [RCV000053178] Chr22:23377784..24564000 [GRCh38]
Chr22:23719971..24959968 [GRCh37]
Chr22:22049971..23289968 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.23(chr22:23377984-24563859)x3 copy number gain See cases [RCV000053179] Chr22:23377984..24563859 [GRCh38]
Chr22:23720171..24959827 [GRCh37]
Chr22:22050171..23289827 [NCBI36]
Chr22:22q11.23
conflicting interpretations of pathogenicity|uncertain significance|conflicting data from submitters
GRCh38/hg38 22q11.21-11.23(chr22:21562911-24307688)x1 copy number loss See cases [RCV000053090] Chr22:21562911..24307688 [GRCh38]
Chr22:21917200..24703656 [GRCh37]
Chr22:20247200..23033656 [NCBI36]
Chr22:22q11.21-11.23
pathogenic
GRCh38/hg38 22q11.23(chr22:23377984-24669609)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053181]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053181]|See cases [RCV000053181] Chr22:23377984..24669609 [GRCh38]
Chr22:23720171..25065576 [GRCh37]
Chr22:22050171..23395576 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.23(chr22:23414627-24563859)x3 copy number gain See cases [RCV000053182] Chr22:23414627..24563859 [GRCh38]
Chr22:23756814..24959827 [GRCh37]
Chr22:22086814..23289827 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.1-11.23(chr22:16916608-24358936)x3 copy number gain See cases [RCV000053104] Chr22:16916608..24358936 [GRCh38]
Chr22:17397498..24754904 [GRCh37]
Chr22:15777498..23084904 [NCBI36]
Chr22:22q11.1-11.23
pathogenic
GRCh38/hg38 22q11.22-11.23(chr22:22686122-24577664)x3 copy number gain See cases [RCV000053161] Chr22:22686122..24577664 [GRCh38]
Chr22:23028586..24973632 [GRCh37]
Chr22:21358586..23303632 [NCBI36]
Chr22:22q11.22-11.23
uncertain significance
GRCh38/hg38 22q11.22-11.23(chr22:22703701-24669609)x3 copy number gain See cases [RCV000053163] Chr22:22703701..24669609 [GRCh38]
Chr22:23046186..25065576 [GRCh37]
Chr22:21376186..23395576 [NCBI36]
Chr22:22q11.22-11.23
uncertain significance
GRCh38/hg38 22q11.23(chr22:23285152-24723136)x3 copy number gain See cases [RCV000053164] Chr22:23285152..24723136 [GRCh38]
Chr22:23627339..25119103 [GRCh37]
Chr22:21957339..23449103 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.21-11.23(chr22:21443815-24235645)x1 copy number loss See cases [RCV000053074] Chr22:21443815..24235645 [GRCh38]
Chr22:21798104..24631613 [GRCh37]
Chr22:20128104..22961613 [NCBI36]
Chr22:22q11.21-11.23
pathogenic
GRCh38/hg38 22q11.21-11.23(chr22:21454461-24247296)x1 copy number loss See cases [RCV000053077] Chr22:21454461..24247296 [GRCh38]
Chr22:21808750..24643264 [GRCh37]
Chr22:20138750..22973264 [NCBI36]
Chr22:22q11.21-11.23
pathogenic
GRCh38/hg38 22q11.21-11.23(chr22:21454661-24289119)x1 copy number loss Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053079]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053079]|See cases [RCV000053079] Chr22:21454661..24289119 [GRCh38]
Chr22:21808950..24685087 [GRCh37]
Chr22:20138950..23015087 [NCBI36]
Chr22:22q11.21-11.23
pathogenic
NM_003073.3(SMARCB1):c.548C>T (p.Pro183Leu) single nucleotide variant Malignant melanoma [RCV000063876] Chr22:23803342 [GRCh38]
Chr22:24145529 [GRCh37]
Chr22:22475529 [NCBI36]
Chr22:22q11.23
not provided
NM_003073.5(SMARCB1):c.549C>T (p.Pro183=) single nucleotide variant not provided [RCV000941200] Chr22:23803343 [GRCh38]
Chr22:24145530 [GRCh37]
Chr22:22475530 [NCBI36]
Chr22:22q11.23
likely benign|not provided
NM_003073.3(SMARCB1):c.562C>T (p.Pro188Ser) single nucleotide variant Malignant melanoma [RCV000063878] Chr22:23803356 [GRCh38]
Chr22:24145543 [GRCh37]
Chr22:22475543 [NCBI36]
Chr22:22q11.23
not provided
NM_003073.3(SMARCB1):c.563C>T (p.Pro188Leu) single nucleotide variant Malignant melanoma [RCV000063879] Chr22:23803357 [GRCh38]
Chr22:24145544 [GRCh37]
Chr22:22475544 [NCBI36]
Chr22:22q11.23
not provided
NM_003073.5(SMARCB1):c.1A>G (p.Met1Val) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000563927]|Rhabdoid tumor predisposition syndrome 1 [RCV001150088]|Schwannomatosis 1 [RCV001150089]|not provided [RCV000456257]|not specified [RCV000122071] Chr22:23787170 [GRCh38]
Chr22:24129357 [GRCh37]
Chr22:22q11.23
benign|likely benign|uncertain significance|not provided
NM_003073.5(SMARCB1):c.500+41G>A single nucleotide variant not specified [RCV000119889] Chr22:23801122 [GRCh38]
Chr22:24143309 [GRCh37]
Chr22:22q11.23
not provided
NM_003073.5(SMARCB1):c.500+65G>A single nucleotide variant not provided [RCV000837359]|not specified [RCV000119890] Chr22:23801146 [GRCh38]
Chr22:24143333 [GRCh37]
Chr22:22q11.23
likely benign|not provided
NM_003073.5(SMARCB1):c.500+111C>A single nucleotide variant not specified [RCV000119891] Chr22:23801192 [GRCh38]
Chr22:24143379 [GRCh37]
Chr22:22q11.23
not provided
NM_003073.5(SMARCB1):c.500+114A>G single nucleotide variant not specified [RCV000119892] Chr22:23801195 [GRCh38]
Chr22:24143382 [GRCh37]
Chr22:22q11.23
not provided
NM_003073.5(SMARCB1):c.500+116C>T single nucleotide variant not provided [RCV001546622]|not specified [RCV000119893] Chr22:23801197 [GRCh38]
Chr22:24143384 [GRCh37]
Chr22:22q11.23
likely benign|not provided
NM_003073.5(SMARCB1):c.500+234C>G single nucleotide variant not provided [RCV001711392]|not specified [RCV000119894] Chr22:23801315 [GRCh38]
Chr22:24143502 [GRCh37]
Chr22:22q11.23
benign|not provided
NM_003073.5(SMARCB1):c.500+305C>A single nucleotide variant not provided [RCV001570185]|not specified [RCV000119895] Chr22:23801386 [GRCh38]
Chr22:24143573 [GRCh37]
Chr22:22q11.23
likely benign|not provided
Single allele duplication Epilepsy [RCV001293375] Chr22:23699269..24992266 [GRCh37]
Chr22:22q11.23
pathogenic
GRCh38/hg38 22q11.1-13.33(chr22:16916608-50739836)x3 copy number gain See cases [RCV000133646] Chr22:16916608..50739836 [GRCh38]
Chr22:17397498..51178264 [GRCh37]
Chr22:15777498..49525130 [NCBI36]
Chr22:22q11.1-13.33
pathogenic
GRCh38/hg38 22q11.1-13.33(chr22:16916743-50739785)x3 copy number gain See cases [RCV000134730] Chr22:16916743..50739785 [GRCh38]
Chr22:17397633..51178213 [GRCh37]
Chr22:15777633..49525079 [NCBI36]
Chr22:22q11.1-13.33
pathogenic
GRCh38/hg38 22q11.22-11.23(chr22:22669599-24670517)x3 copy number gain See cases [RCV000136060] Chr22:22669599..24670517 [GRCh38]
Chr22:23012069..25066484 [GRCh37]
Chr22:21342069..23396484 [NCBI36]
Chr22:22q11.22-11.23
uncertain significance
GRCh38/hg38 22q11.21-11.23(chr22:20726972-24197852)x1 copy number loss See cases [RCV000136889] Chr22:20726972..24197852 [GRCh38]
Chr22:21081260..24593820 [GRCh37]
Chr22:19411260..22923820 [NCBI36]
Chr22:22q11.21-11.23
pathogenic
GRCh38/hg38 22q11.23(chr22:23787850-23954973)x3 copy number gain See cases [RCV000137648] Chr22:23787850..23954973 [GRCh38]
Chr22:24130037..24297160 [GRCh37]
Chr22:22460037..22627160 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.21-11.23(chr22:21454661-24247140)x1 copy number loss See cases [RCV000137685] Chr22:21454661..24247140 [GRCh38]
Chr22:21808950..24643108 [GRCh37]
Chr22:20138950..22973108 [NCBI36]
Chr22:22q11.21-11.23
pathogenic
GRCh38/hg38 22q11.23(chr22:23311976-24644628)x3 copy number gain See cases [RCV000137701] Chr22:23311976..24644628 [GRCh38]
Chr22:23654163..25040595 [GRCh37]
Chr22:21984163..23370595 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.22-11.23(chr22:22660239-24644628)x3 copy number gain See cases [RCV000137410] Chr22:22660239..24644628 [GRCh38]
Chr22:23002709..25040595 [GRCh37]
Chr22:21332709..23370595 [NCBI36]
Chr22:22q11.22-11.23
uncertain significance
GRCh38/hg38 22q11.23(chr22:23804407-24669609)x3 copy number gain See cases [RCV000137178] Chr22:23804407..24669609 [GRCh38]
Chr22:24146594..25065576 [GRCh37]
Chr22:22476594..23395576 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.23-12.3(chr22:23279231-36247369)x3 copy number gain See cases [RCV000138172] Chr22:23279231..36247369 [GRCh38]
Chr22:23621418..36643415 [GRCh37]
Chr22:21951418..34973361 [NCBI36]
Chr22:22q11.23-12.3
pathogenic
GRCh38/hg38 22q11.23(chr22:23311976-24600238)x3 copy number gain See cases [RCV000137995] Chr22:23311976..24600238 [GRCh38]
Chr22:23654163..24996205 [GRCh37]
Chr22:21984163..23326205 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.22-11.23(chr22:22660239-24600238)x3 copy number gain See cases [RCV000137795] Chr22:22660239..24600238 [GRCh38]
Chr22:23002709..24996205 [GRCh37]
Chr22:21332709..23326205 [NCBI36]
Chr22:22q11.22-11.23
uncertain significance
GRCh38/hg38 22q11.21-12.3(chr22:20907226-37187347)x3 copy number gain See cases [RCV000137926] Chr22:20907226..37187347 [GRCh38]
Chr22:21261514..37583387 [GRCh37]
Chr22:19591514..35913333 [NCBI36]
Chr22:22q11.21-12.3
pathogenic
GRCh38/hg38 22q11.21-11.23(chr22:21207181-24247140)x3 copy number gain See cases [RCV000138673] Chr22:21207181..24247140 [GRCh38]
Chr22:21561470..24643108 [GRCh37]
Chr22:19891470..22973108 [NCBI36]
Chr22:22q11.21-11.23
uncertain significance
GRCh38/hg38 22q11.22-11.23(chr22:22660239-24596054)x3 copy number gain See cases [RCV000138249] Chr22:22660239..24596054 [GRCh38]
Chr22:23002709..24992021 [GRCh37]
Chr22:21332709..23322021 [NCBI36]
Chr22:22q11.22-11.23
uncertain significance
GRCh38/hg38 22q11.23(chr22:23311976-24669609)x3 copy number gain See cases [RCV000139440] Chr22:23311976..24669609 [GRCh38]
Chr22:23654163..25065576 [GRCh37]
Chr22:21984163..23395576 [NCBI36]
Chr22:22q11.23
likely benign|uncertain significance
GRCh38/hg38 22q11.22-11.23(chr22:22655333-24663664)x3 copy number gain See cases [RCV000141936] Chr22:22655333..24663664 [GRCh38]
Chr22:22997803..25059631 [GRCh37]
Chr22:21327803..23389631 [NCBI36]
Chr22:22q11.22-11.23
uncertain significance
GRCh38/hg38 22q11.23(chr22:23308686-24647020)x3 copy number gain See cases [RCV000141802] Chr22:23308686..24647020 [GRCh38]
Chr22:23650873..25042987 [GRCh37]
Chr22:21980873..23372987 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.22-11.23(chr22:22655333-24630890)x3 copy number gain See cases [RCV000142221] Chr22:22655333..24630890 [GRCh38]
Chr22:22997803..25026857 [GRCh37]
Chr22:21327803..23356857 [NCBI36]
Chr22:22q11.22-11.23
uncertain significance
GRCh38/hg38 22q11.22-11.23(chr22:22655333-24647020)x3 copy number gain See cases [RCV000143750] Chr22:22655333..24647020 [GRCh38]
Chr22:22997803..25042987 [GRCh37]
Chr22:21327803..23372987 [NCBI36]
Chr22:22q11.22-11.23
uncertain significance
GRCh38/hg38 22q11.22-11.23(chr22:22669543-24563859)x3 copy number gain See cases [RCV000148079] Chr22:22669543..24563859 [GRCh38]
Chr22:23012013..24959827 [GRCh37]
Chr22:21342013..23289827 [NCBI36]
Chr22:22q11.22-11.23
uncertain significance
GRCh38/hg38 22q11.23(chr22:23348201-24647020)x3 copy number gain See cases [RCV000143627] Chr22:23348201..24647020 [GRCh38]
Chr22:23690388..25042987 [GRCh37]
Chr22:22020388..23372987 [NCBI36]
Chr22:22q11.23
uncertain significance
GRCh38/hg38 22q11.22-11.23(chr22:22920775-24606692)x3 copy number gain See cases [RCV000143543] Chr22:22920775..24606692 [GRCh38]
Chr22:23262947..25002659 [GRCh37]
Chr22:21592947..23332659 [NCBI36]
Chr22:22q11.22-11.23
uncertain significance
GRCh38/hg38 22q11.23(chr22:23310399-24643051)x3 copy number gain See cases [RCV000143562] Chr22:23310399..24643051 [GRCh38]
Chr22:23652586..25039018 [GRCh37]
Chr22:21982586..23369018 [NCBI36]
Chr22:22q11.23
likely benign|uncertain significance
GRCh38/hg38 22q11.23(chr22:23792169-23850856)x3 copy number gain See cases [RCV000143579] Chr22:23792169..23850856 [GRCh38]
Chr22:24134356..24193043 [GRCh37]
Chr22:22464356..22523043 [NCBI36]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.606C>T (p.Asp202=) single nucleotide variant not provided [RCV000639938]|not specified [RCV000153974] Chr22:23803400 [GRCh38]
Chr22:24145587 [GRCh37]
Chr22:22q11.23
likely benign
GRCh38/hg38 22q11.23(chr22:23377984-24563859)x3 copy number gain See cases [RCV000148169] Chr22:23377984..24563859 [GRCh38]
Chr22:23720171..24959827 [GRCh37]
Chr22:22050171..23289827 [NCBI36]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.362+8G>A single nucleotide variant not provided [RCV000153973] Chr22:23793696 [GRCh38]
Chr22:24135883 [GRCh37]
Chr22:22q11.23
conflicting interpretations of pathogenicity|uncertain significance
GRCh37/hg19 22q11.23(chr22:23891773-24991691)x3 copy number gain See cases [RCV000203419] Chr22:23891773..24991691 [GRCh37]
Chr22:22q11.23
likely pathogenic
NM_003073.5(SMARCB1):c.512A>G (p.His171Arg) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001023589]|not provided [RCV000178872] Chr22:23803306 [GRCh38]
Chr22:24145493 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.585C>T (p.Ile195=) single nucleotide variant not provided [RCV000178873] Chr22:23803379 [GRCh38]
Chr22:24145566 [GRCh37]
Chr22:22q11.23
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_003073.5(SMARCB1):c.888G>T (p.Lys296Asn) single nucleotide variant History of neurodevelopmental disorder [RCV000718171]|Rhabdoid tumor predisposition syndrome 1 [RCV000470193]|not provided [RCV000179853]|not specified [RCV000781856] Chr22:23825317 [GRCh38]
Chr22:24167504 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1033G>T (p.Asp345Tyr) single nucleotide variant not provided [RCV000180231] Chr22:23833618 [GRCh38]
Chr22:24175805 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1087A>G (p.Lys363Glu) single nucleotide variant Mental retardation, autosomal dominant 15 [RCV000194966]|not provided [RCV000515012] Chr22:23833672 [GRCh38]
Chr22:24175859 [GRCh37]
Chr22:22q11.23
pathogenic|likely pathogenic
GRCh37/hg19 22q11.22-11.23(chr22:23258229-25046803)x3 copy number gain See cases [RCV000239808] Chr22:23258229..25046803 [GRCh37]
Chr22:22q11.22-11.23
pathogenic
NM_003073.5(SMARCB1):c.1096C>T (p.Arg366Cys) single nucleotide variant Mental retardation, autosomal dominant 15 [RCV001782753]|not provided [RCV000255465] Chr22:23833681 [GRCh38]
Chr22:24175868 [GRCh37]
Chr22:22q11.23
pathogenic|likely pathogenic
NM_003073.5(SMARCB1):c.695C>T (p.Thr232Met) single nucleotide variant not provided [RCV000548946] Chr22:23816836 [GRCh38]
Chr22:24159023 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.749C>T (p.Thr250Met) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001026501]|not provided [RCV000550022] Chr22:23816890 [GRCh38]
Chr22:24159077 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1115C>T (p.Thr372Met) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000561787]|not provided [RCV000539836] Chr22:23833700 [GRCh38]
Chr22:24175887 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1070C>G (p.Thr357Arg) single nucleotide variant Mental retardation, autosomal dominant 15 [RCV000677690] Chr22:23833655 [GRCh38]
Chr22:24175842 [GRCh37]
Chr22:22q11.23
likely pathogenic
NM_003073.4(SMARCB1):c.987-?_*338dup510 duplication Rhabdoid tumor predisposition syndrome 1 [RCV000229760] Chr22:23833572..23834518 [GRCh38]
Chr22:24175759..24176705 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.4(SMARCB1):c.-207-?_*338dup1703 duplication Rhabdoid tumor predisposition syndrome 1 [RCV000229963] Chr22:23786963..23834518 [GRCh38]
Chr22:24129150..24176705 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.362+7C>T single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000295652]|Schwannomatosis 1 [RCV000334379]|not provided [RCV000588573]|not specified [RCV000435723] Chr22:23793695 [GRCh38]
Chr22:24135882 [GRCh37]
Chr22:22q11.23
benign|likely benign
NM_003073.5(SMARCB1):c.438A>G (p.Pro146=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000562937]|Rhabdoid tumor predisposition syndrome 1 [RCV001143958]|Schwannomatosis 1 [RCV001143959]|not provided [RCV000587734]|not specified [RCV000252116] Chr22:23801019 [GRCh38]
Chr22:24143206 [GRCh37]
Chr22:22q11.23
benign|likely benign
NM_003073.5(SMARCB1):c.*82C>T single nucleotide variant Schwannoma [RCV000626834]|Schwannomatosis 1 [RCV000656363]|not provided [RCV000231611] Chr22:23834262 [GRCh38]
Chr22:24176449 [GRCh37]
Chr22:22q11.23
pathogenic|likely pathogenic
NM_003073.5(SMARCB1):c.267C>T (p.Thr89=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000563318]|not provided [RCV000226513]|not specified [RCV000507447] Chr22:23793593 [GRCh38]
Chr22:24135780 [GRCh37]
Chr22:22q11.23
benign|likely benign
NM_003073.5(SMARCB1):c.897G>T (p.Ser299=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001018586]|not provided [RCV000226975] Chr22:23825326 [GRCh38]
Chr22:24167513 [GRCh37]
Chr22:22q11.23
likely benign
GRCh37/hg19 22q11.21-12.1(chr22:18738296-25914592)x1 copy number loss Premature ovarian failure [RCV000225330] Chr22:18738296..25914592 [GRCh37]
Chr22:22q11.21-12.1
benign
GRCh37/hg19 22q11.22-11.23(chr22:22976696-25053311)x3 copy number gain See cases [RCV000239999] Chr22:22976696..25053311 [GRCh37]
Chr22:22q11.22-11.23
pathogenic
GRCh37/hg19 22q11.1-13.33(chr22:16054691-51237518)x3 copy number gain See cases [RCV000240091] Chr22:16054691..51237518 [GRCh37]
Chr22:22q11.1-13.33
pathogenic
NC_000022.11:g.(?_23793553)_(23793694_?)del deletion Rhabdoid tumor predisposition syndrome 1 [RCV000526442]|not provided [RCV001385466] Chr22:23793553..23793694 [GRCh38]
Chr22:24135740..24135881 [GRCh37]
Chr22:22q11.23
pathogenic
GRCh37/hg19 22q11.23(chr22:23950632-24276233)x4 copy number gain See cases [RCV000240514] Chr22:23950632..24276233 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.22-11.23(chr22:22988879-24276233)x3 copy number gain See cases [RCV000240234] Chr22:22988879..24276233 [GRCh37]
Chr22:22q11.22-11.23
pathogenic
GRCh37/hg19 22q11.23(chr22:24132414-24256480)x3 copy number gain See cases [RCV000240452] Chr22:24132414..24256480 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.1-12.1(chr22:16054691-27296513)x3 copy number gain See cases [RCV000240348] Chr22:16054691..27296513 [GRCh37]
Chr22:22q11.1-12.1
pathogenic
NM_003073.5(SMARCB1):c.987-4G>A single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000566752]|not provided [RCV000539083] Chr22:23833568 [GRCh38]
Chr22:24175755 [GRCh37]
Chr22:22q11.23
likely benign|uncertain significance
NM_003073.5(SMARCB1):c.723C>T (p.Ile241=) single nucleotide variant Coffin-Siris syndrome [RCV000269507]|Hereditary cancer-predisposing syndrome [RCV000572980]|Rhabdoid tumor predisposition syndrome [RCV000365158]|Schwannomatosis [RCV000308154]|not provided [RCV001417685] Chr22:23816864 [GRCh38]
Chr22:24159051 [GRCh37]
Chr22:22q11.23
likely benign|uncertain significance
NM_003073.5(SMARCB1):c.-107A>G single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000381217]|Schwannomatosis 1 [RCV000327800] Chr22:23787063 [GRCh38]
Chr22:24129250 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.*116dup duplication Rhabdoid tumor predisposition syndrome [RCV000402538]|Schwannomatosis [RCV000365731]|not provided [RCV001712131] Chr22:23834293..23834294 [GRCh38]
Chr22:24176480..24176481 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.987-4G>C single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000334169]|Schwannomatosis 1 [RCV000372477]|not provided [RCV001487925] Chr22:23833568 [GRCh38]
Chr22:24175755 [GRCh37]
Chr22:22q11.23
likely benign|uncertain significance
NM_003073.5(SMARCB1):c.1131T>C (p.Arg377=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000575989]|not provided [RCV000465162]|not specified [RCV000313849] Chr22:23834153 [GRCh38]
Chr22:24176340 [GRCh37]
Chr22:22q11.23
benign|likely benign
NM_003073.5(SMARCB1):c.*279G>A single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000354802]|Schwannomatosis 1 [RCV000262402] Chr22:23834459 [GRCh38]
Chr22:24176646 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.-115C>T single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000266742]|Schwannomatosis 1 [RCV000324271] Chr22:23787055 [GRCh38]
Chr22:24129242 [GRCh37]
Chr22:22q11.23
benign|likely benign
NM_003073.5(SMARCB1):c.*293C>T single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000376653]|Schwannomatosis 1 [RCV000319716] Chr22:23834473 [GRCh38]
Chr22:24176660 [GRCh37]
Chr22:22q11.23
benign|likely benign
NM_003073.5(SMARCB1):c.*17C>T single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000391464]|Schwannomatosis 1 [RCV000286295] Chr22:23834197 [GRCh38]
Chr22:24176384 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.*113C>T single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000277702]|Schwannomatosis 1 [RCV000313009] Chr22:23834293 [GRCh38]
Chr22:24176480 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.-17C>T single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000384656]|Schwannomatosis 1 [RCV000349906] Chr22:23787153 [GRCh38]
Chr22:24129340 [GRCh37]
Chr22:22q11.23
benign|uncertain significance
NM_003073.5(SMARCB1):c.*15C>A single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000283881]|Schwannomatosis 1 [RCV000391435] Chr22:23834195 [GRCh38]
Chr22:24176382 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.-117C>T single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000302245]|Schwannomatosis 1 [RCV000263350]|not provided [RCV001597107] Chr22:23787053 [GRCh38]
Chr22:24129240 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.607G>A (p.Ala203Thr) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001024873]|Rhabdoid tumor predisposition syndrome 1 [RCV000337956]|Rhabdoid tumor predisposition syndrome 2 [RCV001789772]|Schwannomatosis 1 [RCV000299341]|not provided [RCV000559614] Chr22:23803401 [GRCh38]
Chr22:24145588 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.628+13C>T single nucleotide variant Mental retardation, autosomal dominant 15 [RCV001335092]|Rhabdoid tumor predisposition syndrome 1 [RCV000407869]|Schwannomatosis 1 [RCV000361783]|not provided [RCV001528356]|not specified [RCV000431220] Chr22:23803435 [GRCh38]
Chr22:24145622 [GRCh37]
Chr22:22q11.23
benign|likely benign|uncertain significance
NM_003073.5(SMARCB1):c.*12_*14dup duplication Coffin-Siris syndrome [RCV000376011]|Rhabdoid tumor predisposition syndrome [RCV000280146]|Schwannomatosis [RCV000318782] Chr22:23834189..23834190 [GRCh38]
Chr22:24176376..24176377 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.110G>C (p.Arg37Pro) single nucleotide variant Adenoid cystic carcinoma [RCV000585761] Chr22:23791772 [GRCh38]
Chr22:24133959 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.-148T>C single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000405783]|Schwannomatosis 1 [RCV000352505] Chr22:23787022 [GRCh38]
Chr22:24129209 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.-157G>A single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000384333]|Schwannomatosis 1 [RCV000343657] Chr22:23787013 [GRCh38]
Chr22:24129200 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.-149C>T single nucleotide variant Coffin-Siris syndrome [RCV000314095]|Rhabdoid tumor predisposition syndrome [RCV000407097]|Schwannomatosis [RCV000349631] Chr22:23787021 [GRCh38]
Chr22:24129208 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.10:g.(?_24133937)_(24176373_?)dup duplication Rhabdoid tumor predisposition syndrome 1 [RCV000550328] Chr22:23791750..23834186 [GRCh38]
Chr22:24133937..24176373 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.444C>G (p.Ser148=) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000639934]|not provided [RCV001396223] Chr22:23801025 [GRCh38]
Chr22:24143212 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.528C>A (p.Ile176=) single nucleotide variant not provided [RCV000639936] Chr22:23803322 [GRCh38]
Chr22:24145509 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.399C>T (p.Pro133=) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000639937]|not provided [RCV001424696] Chr22:23800980 [GRCh38]
Chr22:24143167 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.90C>T (p.Ser30=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001018851]|none provided [RCV001285366]|not provided [RCV000639931] Chr22:23787259 [GRCh38]
Chr22:24129446 [GRCh37]
Chr22:22q11.23
likely benign|uncertain significance
NM_003073.5(SMARCB1):c.132C>T (p.Tyr44=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001011071]|not provided [RCV000639927] Chr22:23791794 [GRCh38]
Chr22:24133981 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.731A>T (p.Gln244Leu) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000639925]|not provided [RCV001304760] Chr22:23816872 [GRCh38]
Chr22:24159059 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.696G>T (p.Thr232=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001025859]|not provided [RCV000639917] Chr22:23816837 [GRCh38]
Chr22:24159024 [GRCh37]
Chr22:22q11.23
likely benign|uncertain significance
NM_003073.5(SMARCB1):c.1029G>T (p.Thr343=) single nucleotide variant not provided [RCV000639933] Chr22:23833614 [GRCh38]
Chr22:24175801 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.169G>A (p.Val57Met) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001012689]|not provided [RCV000639926] Chr22:23791831 [GRCh38]
Chr22:24134018 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1ATG[3] (p.Met4del) microsatellite not provided [RCV000639922] Chr22:23787170..23787172 [GRCh38]
Chr22:24129357..24129359 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1143G>A (p.Thr381=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000574712]|not provided [RCV001063097] Chr22:23834165 [GRCh38]
Chr22:24176352 [GRCh37]
Chr22:22q11.23
likely benign|uncertain significance
NM_003073.5(SMARCB1):c.967C>A (p.Gln323Lys) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000567770] Chr22:23825396 [GRCh38]
Chr22:24167583 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.520G>T (p.Ala174Ser) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000572555]|not provided [RCV000794971] Chr22:23803314 [GRCh38]
Chr22:24145501 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.744C>T (p.Tyr248=) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000537381]|not provided [RCV001475012] Chr22:23816885 [GRCh38]
Chr22:24159072 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1121G>A (p.Arg374Gln) single nucleotide variant Inborn genetic diseases [RCV000622632]|Mental retardation, autosomal dominant 15 [RCV000850606]|SMARCB1-related BAFopathy [RCV001533136]|not provided [RCV000412754] Chr22:23834143 [GRCh38]
Chr22:24176330 [GRCh37]
Chr22:22q11.23
pathogenic|likely pathogenic
GRCh37/hg19 22q11.1-13.33(chr22:16054691-51220902)x3 copy number gain See cases [RCV000446956] Chr22:16054691..51220902 [GRCh37]
Chr22:22q11.1-13.33
pathogenic
GRCh37/hg19 22q11.22-11.23(chr22:23258938-25002659)x3 copy number gain See cases [RCV000446585] Chr22:23258938..25002659 [GRCh37]
Chr22:22q11.22-11.23
pathogenic
NM_003073.5(SMARCB1):c.602G>A (p.Arg201Gln) single nucleotide variant Mental retardation, autosomal dominant 15 [RCV000505224] Chr22:23803396 [GRCh38]
Chr22:24145583 [GRCh37]
Chr22:22q11.23
likely pathogenic
NM_003073.5(SMARCB1):c.1119-13A>G single nucleotide variant not specified [RCV000425275] Chr22:23834128 [GRCh38]
Chr22:24176315 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.461A>G (p.Asn154Ser) single nucleotide variant not provided [RCV000433219] Chr22:23801042 [GRCh38]
Chr22:24143229 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.978C>T (p.Tyr326=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000568133]|Rhabdoid tumor predisposition syndrome 1 [RCV001148618]|Schwannomatosis 1 [RCV001148617]|not provided [RCV000473594]|not specified [RCV000444025] Chr22:23825407 [GRCh38]
Chr22:24167594 [GRCh37]
Chr22:22q11.23
benign|likely benign
GRCh37/hg19 22q11.21-11.23(chr22:21804562-24659578)x3 copy number gain See cases [RCV000445928] Chr22:21804562..24659578 [GRCh37]
Chr22:22q11.21-11.23
pathogenic
GRCh37/hg19 22q11.22-11.23(chr22:22997802-25002659)x3 copy number gain See cases [RCV000445706] Chr22:22997802..25002659 [GRCh37]
Chr22:22q11.22-11.23
likely pathogenic
GRCh37/hg19 22q11.22-11.23(chr22:23258229-25046758)x3 copy number gain See cases [RCV000445819] Chr22:23258229..25046758 [GRCh37]
Chr22:22q11.22-11.23
pathogenic
GRCh37/hg19 22q11.23(chr22:23652517-25042987)x3 copy number gain See cases [RCV000448006] Chr22:23652517..25042987 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.1-13.33(chr22:16054691-51237463)x3 copy number gain See cases [RCV000448847] Chr22:16054691..51237463 [GRCh37]
Chr22:22q11.1-13.33
pathogenic
NC_000022.10:g.(?_23667751)_(25041986_?)dup duplication Schizophrenia [RCV000416698] Chr22:23667751..25041986 [GRCh37]
Chr22:21997751..23371986 [NCBI36]
Chr22:22q11.23
likely pathogenic
NC_000022.10:g.(?_22971580)_(25041986_?)dup duplication Schizophrenia [RCV000416783] Chr22:22971580..25041986 [GRCh37]
Chr22:21301580..23371986 [NCBI36]
Chr22:22q11.22-11.23
likely pathogenic
GRCh37/hg19 22q11.23(chr22:23739611-24544632)x4 copy number gain See cases [RCV000448428] Chr22:23739611..24544632 [GRCh37]
Chr22:22q11.23
pathogenic
NC_000022.10:g.(?_23667751)_(24991609_?)dup duplication Schizophrenia [RCV000416915] Chr22:23667751..24991609 [GRCh37]
Chr22:21997751..23321609 [NCBI36]
Chr22:22q11.23
likely pathogenic
NM_003073.5(SMARCB1):c.987C>T (p.Ser329=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001019855]|not provided [RCV000459154] Chr22:23833572 [GRCh38]
Chr22:24175759 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.856_858del (p.Lys286del) deletion Hereditary cancer-predisposing syndrome [RCV001018005]|not provided [RCV000466779] Chr22:23825283..23825285 [GRCh38]
Chr22:24167470..24167472 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.750G>A (p.Thr250=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001026516]|not provided [RCV000462884] Chr22:23816891 [GRCh38]
Chr22:24159078 [GRCh37]
Chr22:22q11.23
likely benign|uncertain significance
NM_003073.5(SMARCB1):c.987-5C>T single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000568873]|not provided [RCV000474410] Chr22:23833567 [GRCh38]
Chr22:24175754 [GRCh37]
Chr22:22q11.23
benign|likely benign|uncertain significance
NM_003073.5(SMARCB1):c.712G>A (p.Ala238Thr) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000571182]|not provided [RCV000459629] Chr22:23816853 [GRCh38]
Chr22:24159040 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.765G>A (p.Glu255=) single nucleotide variant not provided [RCV000459663] Chr22:23816906 [GRCh38]
Chr22:24159093 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.466A>G (p.Met156Val) single nucleotide variant not provided [RCV000474805] Chr22:23801047 [GRCh38]
Chr22:24143234 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.790A>C (p.Ile264Leu) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000471122]|not provided [RCV001318104] Chr22:23816931 [GRCh38]
Chr22:24159118 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.713C>T (p.Ala238Val) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000474946]|not provided [RCV001373222] Chr22:23816854 [GRCh38]
Chr22:24159041 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.444C>T (p.Ser148=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000568751]|not provided [RCV000592528] Chr22:23801025 [GRCh38]
Chr22:24143212 [GRCh37]
Chr22:22q11.23
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_003073.5(SMARCB1):c.118C>T (p.Arg40Ter) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000467994]|not provided [RCV001390068] Chr22:23791780 [GRCh38]
Chr22:24133967 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.1116G>A (p.Thr372=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000575853]|not provided [RCV000468029] Chr22:23833701 [GRCh38]
Chr22:24175888 [GRCh37]
Chr22:22q11.23
benign|likely benign
NM_003073.5(SMARCB1):c.969_976del (p.Lys324fs) deletion Rhabdoid tumor predisposition syndrome 1 [RCV000464666]|not provided [RCV001387723] Chr22:23825398..23825405 [GRCh38]
Chr22:24167585..24167592 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.93+7C>T single nucleotide variant not provided [RCV000464726] Chr22:23787269 [GRCh38]
Chr22:24129456 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.358C>T (p.Leu120Phe) single nucleotide variant not provided [RCV000461202] Chr22:23793684 [GRCh38]
Chr22:24135871 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.237C>T (p.His79=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001015324]|not provided [RCV000476179] Chr22:23793563 [GRCh38]
Chr22:24135750 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1143G>C (p.Thr381=) single nucleotide variant not provided [RCV000461395] Chr22:23834165 [GRCh38]
Chr22:24176352 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1149G>A (p.Pro383=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000571800]|not provided [RCV000465096] Chr22:23834171 [GRCh38]
Chr22:24176358 [GRCh37]
Chr22:22q11.23
likely benign|uncertain significance
NM_003073.5(SMARCB1):c.366A>T (p.Glu122Asp) single nucleotide variant not provided [RCV000472643] Chr22:23800947 [GRCh38]
Chr22:24143134 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.152G>A (p.Trp51Ter) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000458044]|not provided [RCV001380948] Chr22:23791814 [GRCh38]
Chr22:24134001 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.696G>A (p.Thr232=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000565982]|Rhabdoid tumor predisposition syndrome 1 [RCV001145859]|Schwannomatosis 1 [RCV001145858]|not provided [RCV000458101] Chr22:23816837 [GRCh38]
Chr22:24159024 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.158G>T (p.Arg53Leu) single nucleotide variant Schwannomatosis 1 [RCV000785603]|not provided [RCV000490024] Chr22:23791820 [GRCh38]
Chr22:24134007 [GRCh37]
Chr22:22q11.23
pathogenic|conflicting interpretations of pathogenicity|uncertain significance
NM_003073.5(SMARCB1):c.1032C>T (p.Gly344=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000573343]|Rhabdoid tumor predisposition syndrome 1 [RCV001148620]|Schwannomatosis 1 [RCV001148619]|not provided [RCV000513195] Chr22:23833617 [GRCh38]
Chr22:24175804 [GRCh37]
Chr22:22q11.23
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_003073.5(SMARCB1):c.741C>G (p.Ser247=) single nucleotide variant not provided [RCV000953410]|not specified [RCV000504278] Chr22:23816882 [GRCh38]
Chr22:24159069 [GRCh37]
Chr22:22q11.23
likely benign
GRCh37/hg19 22q11.23(chr22:24134807-24271732)x3 copy number gain See cases [RCV000510555] Chr22:24134807..24271732 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.672C>T (p.Asp224=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001025585]|not provided [RCV000560422]|not specified [RCV000502209] Chr22:23816813 [GRCh38]
Chr22:24159000 [GRCh37]
Chr22:22q11.23
likely benign
GRCh37/hg19 22q11.23(chr22:24174144-24261143)x3 copy number gain See cases [RCV000510701] Chr22:24174144..24261143 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.21-11.23(chr22:21798907-24963935)x3 copy number gain See cases [RCV000510487] Chr22:21798907..24963935 [GRCh37]
Chr22:22q11.21-11.23
uncertain significance
GRCh37/hg19 22q11.23(chr22:23690387-25039018)x3 copy number gain See cases [RCV000511883] Chr22:23690387..25039018 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.22-11.23(chr22:22997802-25033630)x3 copy number gain See cases [RCV000511378] Chr22:22997802..25033630 [GRCh37]
Chr22:22q11.22-11.23
uncertain significance
GRCh37/hg19 22q11.23(chr22:24174144-24258392)x3 copy number gain See cases [RCV000511524] Chr22:24174144..24258392 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.23(chr22:23690387-25066472)x3 copy number gain See cases [RCV000511837] Chr22:23690387..25066472 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.23(chr22:23690387-24666092)x1 copy number loss See cases [RCV000511065] Chr22:23690387..24666092 [GRCh37]
Chr22:22q11.23
pathogenic
GRCh37/hg19 22q11.1-13.33(chr22:16888900-51197838) copy number gain See cases [RCV000510873] Chr22:16888900..51197838 [GRCh37]
Chr22:22q11.1-13.33
pathogenic
GRCh37/hg19 22q11.23-12.3(chr22:23637907-36614412)x3 copy number gain See cases [RCV000511098] Chr22:23637907..36614412 [GRCh37]
Chr22:22q11.23-12.3
pathogenic
NC_000022.11:g.(?_23787164)_(23834186_?)del deletion Rhabdoid tumor predisposition syndrome 1 [RCV000537984] Chr22:23787164..23834186 [GRCh38]
Chr22:24129351..24176373 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.69C>G (p.Gly23=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001025893]|not provided [RCV000525085] Chr22:23787238 [GRCh38]
Chr22:24129425 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.795+9C>T single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000525885]|not provided [RCV001431390] Chr22:23816945 [GRCh38]
Chr22:24159132 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.946C>T (p.Arg316Trp) single nucleotide variant not provided [RCV000526648] Chr22:23825375 [GRCh38]
Chr22:24167562 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1028C>T (p.Thr343Met) single nucleotide variant not provided [RCV000527241] Chr22:23833613 [GRCh38]
Chr22:24175800 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.351dup (p.Thr118fs) duplication Neoplasm of the central nervous system [RCV000584809] Chr22:23793671..23793672 [GRCh38]
Chr22:24135858..24135859 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.42C>T (p.Pro14=) single nucleotide variant not provided [RCV000529128] Chr22:23787211 [GRCh38]
Chr22:24129398 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.539C>T (p.Ala180Val) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000530191]|not provided [RCV001302919] Chr22:23803333 [GRCh38]
Chr22:24145520 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.184A>T (p.Lys62Ter) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000532865] Chr22:23791846 [GRCh38]
Chr22:24134033 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.613A>T (p.Thr205Ser) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000535529]|not provided [RCV001365838] Chr22:23803407 [GRCh38]
Chr22:24145594 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1118+1G>A single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000538739]|not provided [RCV001390393] Chr22:23833704 [GRCh38]
Chr22:24175891 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.460A>T (p.Asn154Tyr) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000569808] Chr22:23801041 [GRCh38]
Chr22:24143228 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.178_179del (p.Arg60fs) microsatellite Hereditary cancer-predisposing syndrome [RCV000561914] Chr22:23791836..23791837 [GRCh38]
Chr22:24134023..24134024 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.601C>T (p.Arg201Ter) single nucleotide variant not provided [RCV000639914] Chr22:23803395 [GRCh38]
Chr22:24145582 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.1017C>T (p.Ala339=) single nucleotide variant not provided [RCV000639930] Chr22:23833602 [GRCh38]
Chr22:24175789 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1074C>T (p.Asp358=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001009848]|not provided [RCV000639929] Chr22:23833659 [GRCh38]
Chr22:24175846 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1097G>A (p.Arg366His) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000639921]|not provided [RCV001302083] Chr22:23833682 [GRCh38]
Chr22:24175869 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.193G>T (p.Ala65Ser) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000639918] Chr22:23791855 [GRCh38]
Chr22:24134042 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.23(chr22:23720171-25065576) copy number gain Cerebellar ataxia [RCV000626496] Chr22:23720171..25065576 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.79A>C (p.Met27Leu) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000538179]|not provided [RCV001345457] Chr22:23787248 [GRCh38]
Chr22:24129435 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.-11C>G single nucleotide variant not specified [RCV000615354] Chr22:23787159 [GRCh38]
Chr22:24129346 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.747C>T (p.Pro249=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV000571948]|not provided [RCV000864263] Chr22:23816888 [GRCh38]
Chr22:24159075 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.232+5G>A single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000540623]|not provided [RCV001316084] Chr22:23791899 [GRCh38]
Chr22:24134086 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1066_1067del (p.Leu356fs) microsatellite not provided [RCV000639915] Chr22:23833649..23833650 [GRCh38]
Chr22:24175836..24175837 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.822C>G (p.Ser274=) single nucleotide variant not provided [RCV000639940] Chr22:23825251 [GRCh38]
Chr22:24167438 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.369G>A (p.Gln123=) single nucleotide variant not provided [RCV000639932] Chr22:23800950 [GRCh38]
Chr22:24143137 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1118+6C>G single nucleotide variant not provided [RCV000639924] Chr22:23833709 [GRCh38]
Chr22:24175896 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.690G>A (p.Pro230=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001025795]|not provided [RCV000536593] Chr22:23816831 [GRCh38]
Chr22:24159018 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.78C>T (p.Tyr26=) single nucleotide variant not provided [RCV000639935] Chr22:23787247 [GRCh38]
Chr22:24129434 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.889C>T (p.Leu297=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001018459]|not provided [RCV000639939] Chr22:23825318 [GRCh38]
Chr22:24167505 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.27C>T (p.Thr9=) single nucleotide variant not provided [RCV000639941] Chr22:23787196 [GRCh38]
Chr22:24129383 [GRCh37]
Chr22:22q11.23
likely benign
NC_000022.11:g.(?_23833566)_(23834186_?)del deletion Rhabdoid tumor predisposition syndrome 1 [RCV000639942]|not provided [RCV001377104] Chr22:23833566..23834186 [GRCh38]
Chr22:24175753..24176373 [GRCh37]
Chr22:22q11.23
likely pathogenic
NM_003073.5(SMARCB1):c.309C>T (p.Asn103=) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV001143956]|Schwannomatosis 1 [RCV001143957]|not provided [RCV000639928] Chr22:23793635 [GRCh38]
Chr22:24135822 [GRCh37]
Chr22:22q11.23
likely benign|uncertain significance
NM_003073.5(SMARCB1):c.880G>A (p.Ala294Thr) single nucleotide variant Inborn genetic diseases [RCV001266391]|Rhabdoid tumor predisposition syndrome 1 [RCV000639920]|not provided [RCV001320942] Chr22:23825309 [GRCh38]
Chr22:24167496 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1022G>A (p.Arg341Gln) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001017037]|not provided [RCV000639919] Chr22:23833607 [GRCh38]
Chr22:24175794 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.986+5G>T single nucleotide variant not provided [RCV000656313] Chr22:23825420 [GRCh38]
Chr22:24167607 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.23(chr22:23653979-25066472)x3 copy number gain See cases [RCV000512168] Chr22:23653979..25066472 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.1-13.33(chr22:16888900-51197838)x3 copy number gain See cases [RCV000512333] Chr22:16888900..51197838 [GRCh37]
Chr22:22q11.1-13.33
pathogenic
GRCh37/hg19 22q11.23(chr22:23652549-25042987)x3 copy number gain See cases [RCV000512454] Chr22:23652549..25042987 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.538G>A (p.Ala180Thr) single nucleotide variant not provided [RCV000686356] Chr22:23803332 [GRCh38]
Chr22:24145519 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1033G>A (p.Asp345Asn) single nucleotide variant not provided [RCV000658077] Chr22:23833618 [GRCh38]
Chr22:24175805 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1089G>T (p.Lys363Asn) single nucleotide variant Mental retardation, autosomal dominant 15 [RCV000680105]|SMARCB1-related BAFopathy [RCV001533135]|not provided [RCV001543528] Chr22:23833674 [GRCh38]
Chr22:24175861 [GRCh37]
Chr22:22q11.23
likely pathogenic|uncertain significance
NM_003073.5(SMARCB1):c.985A>G (p.Ser329Gly) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000686274]|not provided [RCV001371010] Chr22:23825414 [GRCh38]
Chr22:24167601 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.22-11.23(chr22:22951048-25156289)x3 copy number gain not provided [RCV000684506] Chr22:22951048..25156289 [GRCh37]
Chr22:22q11.22-11.23
likely pathogenic
GRCh37/hg19 22q11.21-11.23(chr22:21465661-24653491)x1 copy number loss not provided [RCV000684518] Chr22:21465661..24653491 [GRCh37]
Chr22:22q11.21-11.23
pathogenic
GRCh37/hg19 22q11.21-11.23(chr22:21465661-24885806)x1 copy number loss not provided [RCV000684520] Chr22:21465661..24885806 [GRCh37]
Chr22:22q11.21-11.23
pathogenic
GRCh37/hg19 22q11.22-12.3(chr22:22460754-35198232)x3 copy number gain not provided [RCV000684530] Chr22:22460754..35198232 [GRCh37]
Chr22:22q11.22-12.3
pathogenic
GRCh37/hg19 22q11.23(chr22:23650871-25002659)x3 copy number gain not provided [RCV000684494] Chr22:23650871..25002659 [GRCh37]
Chr22:22q11.23
likely pathogenic
GRCh37/hg19 22q11.22-11.23(chr22:22945889-25059631)x3 copy number gain not provided [RCV000684504] Chr22:22945889..25059631 [GRCh37]
Chr22:22q11.22-11.23
pathogenic|likely pathogenic
NM_003073.5(SMARCB1):c.14C>T (p.Ala5Val) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000700027]|not provided [RCV001371361] Chr22:23787183 [GRCh38]
Chr22:24129370 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.559G>T (p.Val187Phe) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001024308]|not provided [RCV000704235] Chr22:23803353 [GRCh38]
Chr22:24145540 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.790A>G (p.Ile264Val) single nucleotide variant not provided [RCV000704305] Chr22:23816931 [GRCh38]
Chr22:24159118 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1070C>T (p.Thr357Ile) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000704445]|not provided [RCV000997886] Chr22:23833655 [GRCh38]
Chr22:24175842 [GRCh37]
Chr22:22q11.23
likely pathogenic
NM_003073.5(SMARCB1):c.166A>T (p.Thr56Ser) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000694816]|not provided [RCV001349010] Chr22:23791828 [GRCh38]
Chr22:24134015 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.469G>T (p.Gly157Cys) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000691011]|not provided [RCV001373532] Chr22:23801050 [GRCh38]
Chr22:24143237 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.10:g.(?_24129347)_(24176377_?)dup duplication not provided [RCV000707825] Chr22:23787160..23834190 [GRCh38]
Chr22:24129347..24176377 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.233-2A>G single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000705437]|not provided [RCV001379024] Chr22:23793557 [GRCh38]
Chr22:24135744 [GRCh37]
Chr22:22q11.23
likely pathogenic
NC_000022.10:g.(?_24175749)_(24176377_?)dup duplication not provided [RCV000707805] Chr22:23833562..23834190 [GRCh38]
Chr22:24175749..24176377 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.755G>A (p.Ser252Asn) single nucleotide variant not provided [RCV000699647] Chr22:23816896 [GRCh38]
Chr22:24159083 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.508G>A (p.Asp170Asn) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000685503]|not provided [RCV001307493] Chr22:23803302 [GRCh38]
Chr22:24145489 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.302A>G (p.Asp101Gly) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000706448]|not provided [RCV001342433] Chr22:23793628 [GRCh38]
Chr22:24135815 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.10:g.(?_24133933)_(24176377_?)dup duplication not provided [RCV000708481] Chr22:23791746..23834190 [GRCh38]
Chr22:24133933..24176377 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1059G>A (p.Leu353=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001009762]|Rhabdoid tumor predisposition syndrome 1 [RCV000701235]|not provided [RCV001366383] Chr22:23833644 [GRCh38]
Chr22:24175831 [GRCh37]
Chr22:22q11.23
likely benign|uncertain significance
NM_003073.5(SMARCB1):c.501C>G (p.Cys167Trp) single nucleotide variant not provided [RCV000697410] Chr22:23803295 [GRCh38]
Chr22:24145482 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.582G>C (p.Glu194Asp) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000692767]|not provided [RCV001347819] Chr22:23803376 [GRCh38]
Chr22:24145563 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.284A>G (p.Glu95Gly) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000706887]|not provided [RCV001306982] Chr22:23793610 [GRCh38]
Chr22:24135797 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.673G>T (p.Asp225Tyr) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000704918]|not provided [RCV001370261] Chr22:23816814 [GRCh38]
Chr22:24159001 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1029G>A (p.Thr343=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001017067]|not provided [RCV000688669] Chr22:23833614 [GRCh38]
Chr22:24175801 [GRCh37]
Chr22:22q11.23
likely benign|uncertain significance
NM_003073.5(SMARCB1):c.828G>A (p.Val276=) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000696937]|not provided [RCV001359166] Chr22:23825257 [GRCh38]
Chr22:24167444 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.362+1G>A single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV000706102]|not provided [RCV001380039] Chr22:23793689 [GRCh38]
Chr22:24135876 [GRCh37]
Chr22:22q11.23
pathogenic
GRCh37/hg19 22q11.22-11.23(chr22:22962195-25002659)x3 copy number gain not provided [RCV000846628] Chr22:22962195..25002659 [GRCh37]
Chr22:22q11.22-11.23
pathogenic
NM_003073.5(SMARCB1):c.537C>T (p.Asn179=) single nucleotide variant History of neurodevelopmental disorder [RCV000719288]|not provided [RCV000867969] Chr22:23803331 [GRCh38]
Chr22:24145518 [GRCh37]
Chr22:22q11.23
likely benign
Single allele duplication Schizophrenia [RCV000754256] Chr22:22624794..24654160 [GRCh38]
Chr22:22q11.22-11.23
likely pathogenic
Single allele duplication Schizophrenia [RCV000754258] Chr22:23317839..24597843 [GRCh38]
Chr22:22q11.23
likely pathogenic
Single allele duplication Schizophrenia [RCV000754259] Chr22:23317839..24654160 [GRCh38]
Chr22:22q11.23
likely pathogenic
GRCh37/hg19 22q11.1-13.33(chr22:16054667-51243435)x3 copy number gain not provided [RCV000741689] Chr22:16054667..51243435 [GRCh37]
Chr22:22q11.1-13.33
pathogenic
GRCh37/hg19 22q11.1-13.33(chr22:16114244-51195728)x3 copy number gain not provided [RCV000741691] Chr22:16114244..51195728 [GRCh37]
Chr22:22q11.1-13.33
pathogenic
GRCh37/hg19 22q11.23(chr22:24129005-24133570)x0 copy number loss not provided [RCV000741864] Chr22:24129005..24133570 [GRCh37]
Chr22:22q11.23
benign
GRCh37/hg19 22q11.1-13.33(chr22:16114244-51211392)x3 copy number gain not provided [RCV000741692] Chr22:16114244..51211392 [GRCh37]
Chr22:22q11.1-13.33
pathogenic
NM_003073.5(SMARCB1):c.796-4_796-3del deletion Hereditary cancer-predisposing syndrome [RCV001027006]|not provided [RCV000871248] Chr22:23825220..23825221 [GRCh38]
Chr22:24167407..24167408 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.492C>T (p.Phe164=) single nucleotide variant not provided [RCV000871479] Chr22:23801073 [GRCh38]
Chr22:24143260 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1084_1086del (p.Glu362del) deletion Mental retardation, autosomal dominant 15 [RCV001594445] Chr22:23833668..23833670 [GRCh38]
Chr22:24175855..24175857 [GRCh37]
Chr22:22q11.23
likely pathogenic
NM_003073.5(SMARCB1):c.628+116A>G single nucleotide variant not provided [RCV001571722] Chr22:23803538 [GRCh38]
Chr22:24145725 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.351del (p.Thr118fs) deletion Teratoid tumor, atypical [RCV000853299] Chr22:23793672 [GRCh38]
Chr22:24135859 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.93+104_93+105del deletion not provided [RCV001690512] Chr22:23787365..23787366 [GRCh38]
Chr22:24129552..24129553 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.1098C>T (p.Arg366=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001017282]|not provided [RCV000872779] Chr22:23833683 [GRCh38]
Chr22:24175870 [GRCh37]
Chr22:22q11.23
benign|likely benign
NM_003073.5(SMARCB1):c.362+248T>C single nucleotide variant not provided [RCV001546256] Chr22:23793936 [GRCh38]
Chr22:24136123 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.93+135C>A single nucleotide variant not provided [RCV001548114] Chr22:23787397 [GRCh38]
Chr22:24129584 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.93+818C>T single nucleotide variant not provided [RCV001669141] Chr22:23788080 [GRCh38]
Chr22:24130267 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.987-6T>C single nucleotide variant not provided [RCV000978949] Chr22:23833566 [GRCh38]
Chr22:24175753 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1142C>G (p.Thr381Arg) single nucleotide variant not provided [RCV000762051] Chr22:23834164 [GRCh38]
Chr22:24176351 [GRCh37]
Chr22:22q11.23
likely pathogenic|conflicting interpretations of pathogenicity
Single allele single nucleotide variant not provided [RCV001576532] Chr22:23786925 [GRCh38]
Chr22:24129112 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.362+1G>C single nucleotide variant not provided [RCV000786807] Chr22:23793689 [GRCh38]
Chr22:24135876 [GRCh37]
Chr22:22q11.23
not provided
NM_003073.5(SMARCB1):c.520G>A (p.Ala174Thr) single nucleotide variant not provided [RCV000997885] Chr22:23803314 [GRCh38]
Chr22:24145501 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.363-6C>T single nucleotide variant not provided [RCV000923579] Chr22:23800938 [GRCh38]
Chr22:24143125 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1095C>A (p.Ile365=) single nucleotide variant not provided [RCV000937018] Chr22:23833680 [GRCh38]
Chr22:24175867 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.783C>T (p.Arg261=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001026863]|not provided [RCV000870539] Chr22:23816924 [GRCh38]
Chr22:24159111 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.55C>T (p.Leu19=) single nucleotide variant not provided [RCV000981410] Chr22:23787224 [GRCh38]
Chr22:24129411 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.634T>C (p.Leu212=) single nucleotide variant not provided [RCV000983558] Chr22:23816775 [GRCh38]
Chr22:24158962 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.972G>A (p.Lys324=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001019688]|not provided [RCV001453981] Chr22:23825401 [GRCh38]
Chr22:24167588 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.244A>G (p.Thr82Ala) single nucleotide variant not provided [RCV001041061] Chr22:23793570 [GRCh38]
Chr22:24135757 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.11:g.(?_23816760)_(23816946_?)dup duplication not provided [RCV001031605] Chr22:24158947..24159133 [GRCh37]
Chr22:22q11.23
pathogenic
NC_000022.11:g.(?_23787160)_(23825425_?)dup duplication not provided [RCV001032753] Chr22:24129347..24167612 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.11:g.(?_23787170)_(23834262_?)del deletion not provided [RCV001032976] Chr22:24129357..24176449 [GRCh37]
Chr22:22q11.23
pathogenic
NC_000022.10:g.(?_24129357)_(24836024_?)dup duplication not provided [RCV001031059] Chr22:24129357..24836024 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.463C>T (p.Arg155Cys) single nucleotide variant not provided [RCV001035963] Chr22:23801044 [GRCh38]
Chr22:24143231 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.11:g.(?_23816760)_(23834262_?)dup duplication not provided [RCV001033242] Chr22:24158947..24176449 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1118+5C>T single nucleotide variant not provided [RCV000806971] Chr22:23833708 [GRCh38]
Chr22:24175895 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1142C>T (p.Thr381Met) single nucleotide variant not provided [RCV000807460] Chr22:23834164 [GRCh38]
Chr22:24176351 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.23(chr22:23653987-25158391) copy number gain not provided [RCV000767635] Chr22:23653987..25158391 [GRCh37]
Chr22:22q11.23
likely pathogenic
NM_003073.5(SMARCB1):c.1120C>T (p.Arg374Trp) single nucleotide variant not provided [RCV000782071] Chr22:23834142 [GRCh38]
Chr22:24176329 [GRCh37]
Chr22:22q11.23
pathogenic
NC_000022.10:g.(?_24175753)_(24176372_?)dup duplication not provided [RCV000817278] Chr22:23833566..23834185 [GRCh38]
Chr22:24175753..24176372 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.531T>C (p.His177=) single nucleotide variant not provided [RCV000981878] Chr22:23803325 [GRCh38]
Chr22:24145512 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.117C>T (p.Phe39=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001010157]|not provided [RCV000869023] Chr22:23791779 [GRCh38]
Chr22:24133966 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.888G>A (p.Lys296=) single nucleotide variant not provided [RCV000946337] Chr22:23825317 [GRCh38]
Chr22:24167504 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.501-8A>G single nucleotide variant not provided [RCV000873235] Chr22:23803287 [GRCh38]
Chr22:24145474 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.141C>T (p.Tyr47=) single nucleotide variant not provided [RCV000932028] Chr22:23791803 [GRCh38]
Chr22:24133990 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.498T>C (p.Leu166=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001023374]|not provided [RCV000909700] Chr22:23801079 [GRCh38]
Chr22:24143266 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.975C>A (p.Thr325=) single nucleotide variant not provided [RCV000945082] Chr22:23825404 [GRCh38]
Chr22:24167591 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.333C>G (p.Ser111=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001020033] Chr22:23793659 [GRCh38]
Chr22:24135846 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.628+5A>C single nucleotide variant not provided [RCV000822420] Chr22:23803427 [GRCh38]
Chr22:24145614 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.934_981del (p.Ala312_Ala327del) deletion not provided [RCV000797222] Chr22:23825362..23825409 [GRCh38]
Chr22:24167549..24167596 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.986+3A>G single nucleotide variant not provided [RCV000802604] Chr22:23825418 [GRCh38]
Chr22:24167605 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.11:g.(?_23787160)_(23834190_?)del deletion not provided [RCV000822546] Chr22:23787160..23834190 [GRCh38]
Chr22:24129347..24176377 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.997C>T (p.Leu333=) single nucleotide variant not provided [RCV000870692] Chr22:23833582 [GRCh38]
Chr22:24175769 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.374C>G (p.Ala125Gly) single nucleotide variant not provided [RCV000814830] Chr22:23800955 [GRCh38]
Chr22:24143142 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.11:g.23786685G>A single nucleotide variant not provided [RCV000833387] Chr22:23786685 [GRCh38]
Chr22:24128872 [GRCh37]
Chr22:22q11.23
benign
NC_000022.11:g.23786743C>T single nucleotide variant not provided [RCV000833388] Chr22:23786743 [GRCh38]
Chr22:24128930 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.329T>C (p.Val110Ala) single nucleotide variant not provided [RCV000806044] Chr22:23793655 [GRCh38]
Chr22:24135842 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.11:g.(?_23787160)_(23787272_?)del deletion not provided [RCV000822554] Chr22:23787160..23787272 [GRCh38]
Chr22:24129347..24129459 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.93+44G>C single nucleotide variant not provided [RCV000836381] Chr22:23787306 [GRCh38]
Chr22:24129493 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.1118+184T>A single nucleotide variant not provided [RCV000836382] Chr22:23833887 [GRCh38]
Chr22:24176074 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1129C>G (p.Arg377Gly) single nucleotide variant NK-cell enteropathy [RCV000791312] Chr22:23834151 [GRCh38]
Chr22:24176338 [GRCh37]
Chr22:22q11.23
likely pathogenic
NC_000022.11:g.23786942G>T single nucleotide variant not provided [RCV000836566] Chr22:23786942 [GRCh38]
Chr22:24129129 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.501-164C>T single nucleotide variant not provided [RCV000836578] Chr22:23803131 [GRCh38]
Chr22:24145318 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.628+118C>T single nucleotide variant not provided [RCV000836581] Chr22:23803540 [GRCh38]
Chr22:24145727 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.795+121G>A single nucleotide variant not provided [RCV000836582] Chr22:23817057 [GRCh38]
Chr22:24159244 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.795+153A>G single nucleotide variant not provided [RCV000836584] Chr22:23817089 [GRCh38]
Chr22:24159276 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.795+184A>T single nucleotide variant not provided [RCV000836585] Chr22:23817120 [GRCh38]
Chr22:24159307 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.795+198T>C single nucleotide variant not provided [RCV000836586] Chr22:23817134 [GRCh38]
Chr22:24159321 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.795+203C>T single nucleotide variant not provided [RCV000836587] Chr22:23817139 [GRCh38]
Chr22:24159326 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.796-246G>A single nucleotide variant not provided [RCV000836588] Chr22:23824979 [GRCh38]
Chr22:24167166 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.796-227C>T single nucleotide variant not provided [RCV000836589] Chr22:23824998 [GRCh38]
Chr22:24167185 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.629-62A>G single nucleotide variant not provided [RCV000836594] Chr22:23816708 [GRCh38]
Chr22:24158895 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.1118+163G>T single nucleotide variant not provided [RCV000836596] Chr22:23833866 [GRCh38]
Chr22:24176053 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.1119-164G>A single nucleotide variant not provided [RCV000836597] Chr22:23833977 [GRCh38]
Chr22:24176164 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.1119-41G>A single nucleotide variant not provided [RCV000836598] Chr22:23834100 [GRCh38]
Chr22:24176287 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.987-139G>A single nucleotide variant not provided [RCV000836602] Chr22:23833433 [GRCh38]
Chr22:24175620 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.262G>T (p.Val88Leu) single nucleotide variant not provided [RCV000808802] Chr22:23793588 [GRCh38]
Chr22:24135775 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.11:g.23786818T>G single nucleotide variant not provided [RCV000844284] Chr22:23786818 [GRCh38]
Chr22:24129005 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.232+313T>C single nucleotide variant not provided [RCV000844285] Chr22:23792207 [GRCh38]
Chr22:24134394 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.629-260G>C single nucleotide variant not provided [RCV000844286] Chr22:23816510 [GRCh38]
Chr22:24158697 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.629-277C>T single nucleotide variant not provided [RCV000844287] Chr22:23816493 [GRCh38]
Chr22:24158680 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.986+300C>G single nucleotide variant not provided [RCV000844288] Chr22:23825715 [GRCh38]
Chr22:24167902 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.93+105GC[7] microsatellite not provided [RCV000836580] Chr22:23787367..23787368 [GRCh38]
Chr22:24129554..24129555 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.340A>C (p.Thr114Pro) single nucleotide variant not provided [RCV000811924] Chr22:23793666 [GRCh38]
Chr22:24135853 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.22-11.23(chr22:22998284-25119103)x3 copy number gain Global developmental delay [RCV000787284] Chr22:22998284..25119103 [GRCh37]
Chr22:22q11.22-11.23
likely pathogenic
NM_003073.5(SMARCB1):c.979G>A (p.Ala327Thr) single nucleotide variant not provided [RCV000817372] Chr22:23825408 [GRCh38]
Chr22:24167595 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.565A>G (p.Ile189Val) single nucleotide variant not provided [RCV000823454] Chr22:23803359 [GRCh38]
Chr22:24145546 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.434T>G (p.Val145Gly) single nucleotide variant not provided [RCV000801245] Chr22:23801015 [GRCh38]
Chr22:24143202 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.628+200T>C single nucleotide variant not provided [RCV000836579] Chr22:23803622 [GRCh38]
Chr22:24145809 [GRCh37]
Chr22:22q11.23
benign
GRCh37/hg19 22q11.23(chr22:24134356-24354513)x3 copy number gain not provided [RCV000848818] Chr22:24134356..24354513 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.362+63A>G single nucleotide variant not provided [RCV000837357] Chr22:23793751 [GRCh38]
Chr22:24135938 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.362+132C>T single nucleotide variant not provided [RCV000837358] Chr22:23793820 [GRCh38]
Chr22:24136007 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.301G>A (p.Asp101Asn) single nucleotide variant not provided [RCV000809326] Chr22:23793627 [GRCh38]
Chr22:24135814 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.500+1G>A single nucleotide variant not provided [RCV000786808] Chr22:23801082 [GRCh38]
Chr22:24143269 [GRCh37]
Chr22:22q11.23
not provided
GRCh37/hg19 22q11.21-11.23(chr22:20732808-25193541)x3 copy number gain not provided [RCV001007169] Chr22:20732808..25193541 [GRCh37]
Chr22:22q11.21-11.23
pathogenic
NM_003073.5(SMARCB1):c.795+3A>G single nucleotide variant not provided [RCV001056177] Chr22:23816939 [GRCh38]
Chr22:24159126 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1118+8T>C single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV001148622]|Schwannomatosis 1 [RCV001148621] Chr22:23833711 [GRCh38]
Chr22:24175898 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.*100C>G single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV001150204]|Schwannomatosis 1 [RCV001150203] Chr22:23834280 [GRCh38]
Chr22:24176467 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.633G>A (p.Lys211=) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV001145857]|Schwannomatosis 1 [RCV001145856] Chr22:23816774 [GRCh38]
Chr22:24158961 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.196T>G (p.Ser66Ala) single nucleotide variant not provided [RCV000812599] Chr22:23791858 [GRCh38]
Chr22:24134045 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.93+99_93+127del deletion not provided [RCV000833868] Chr22:23787354..23787382 [GRCh38]
Chr22:24129541..24129569 [GRCh37]
Chr22:22q11.23
benign
NC_000022.11:g.23801146G>A single nucleotide variant not provided [RCV000837359] Chr22:24143333 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.629-202T>G single nucleotide variant not provided [RCV000837360] Chr22:23816568 [GRCh38]
Chr22:24158755 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.987-109C>T single nucleotide variant not provided [RCV000837361] Chr22:23833463 [GRCh38]
Chr22:24175650 [GRCh37]
Chr22:22q11.23
benign
GRCh37/hg19 22q11.23(chr22:23652517-25002659)x3 copy number gain 22q11.2 distal duplication syndrome [RCV000788073] Chr22:23652517..25002659 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.10:g.(?_24143121)_(24176377_?)dup duplication not provided [RCV000800035] Chr22:23800934..23834190 [GRCh38]
Chr22:24143121..24176377 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.64G>A (p.Asp22Asn) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001025345]|not provided [RCV000800215] Chr22:23787233 [GRCh38]
Chr22:24129420 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.668G>A (p.Cys223Tyr) single nucleotide variant not provided [RCV000816847] Chr22:23816809 [GRCh38]
Chr22:24158996 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.735C>A (p.Ile245=) single nucleotide variant not provided [RCV000964784] Chr22:23816876 [GRCh38]
Chr22:24159063 [GRCh37]
Chr22:22q11.23
likely benign
Single allele duplication not provided [RCV000845076] Chr22:24133746..24257275 [GRCh37]
Chr22:22q11.23
not provided
NM_003073.5(SMARCB1):c.-184G>A single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV001145751]|Schwannomatosis 1 [RCV001145752] Chr22:23786986 [GRCh38]
Chr22:24129173 [GRCh37]
Chr22:22q11.23
benign
GRCh37/hg19 22q11.23(chr22:24173393-24261143)x3 copy number gain not provided [RCV000845931] Chr22:24173393..24261143 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.845A>G (p.Asp282Gly) single nucleotide variant not provided [RCV001056819] Chr22:23825274 [GRCh38]
Chr22:24167461 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.22-11.23(chr22:22962196-25145601)x3 copy number gain not provided [RCV000845609] Chr22:22962196..25145601 [GRCh37]
Chr22:22q11.22-11.23
pathogenic
GRCh37/hg19 22q11.23(chr22:23650200-25066472)x3 copy number gain not provided [RCV000849234] Chr22:23650200..25066472 [GRCh37]
Chr22:22q11.23
pathogenic
GRCh37/hg19 22q11.23(chr22:23698818-25042987)x3 copy number gain not provided [RCV000849671] Chr22:23698818..25042987 [GRCh37]
Chr22:22q11.23
pathogenic
GRCh37/hg19 22q11.23(chr22:24171304-24258403)x3 copy number gain not provided [RCV000849745] Chr22:24171304..24258403 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.433G>A (p.Val145Met) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001022323] Chr22:23801014 [GRCh38]
Chr22:24143201 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.22-11.23(chr22:22962196-25059631)x3 copy number gain not provided [RCV000847639] Chr22:22962196..25059631 [GRCh37]
Chr22:22q11.22-11.23
pathogenic
GRCh37/hg19 22q11.23(chr22:23650871-25066472)x3 copy number gain not provided [RCV000845636] Chr22:23650871..25066472 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.448A>G (p.Thr150Ala) single nucleotide variant not provided [RCV001057392] Chr22:23801029 [GRCh38]
Chr22:24143216 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.759_761del (p.Ile253_Leu254delinsMet) deletion not provided [RCV001211495] Chr22:23816899..23816901 [GRCh38]
Chr22:24159086..24159088 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1133T>C (p.Leu378Pro) single nucleotide variant not provided [RCV001171554] Chr22:23834155 [GRCh38]
Chr22:24176342 [GRCh37]
Chr22:22q11.23
likely pathogenic
NM_003073.5(SMARCB1):c.-3G>T single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001021634] Chr22:23787167 [GRCh38]
Chr22:24129354 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.829G>A (p.Asp277Asn) single nucleotide variant not provided [RCV001212160] Chr22:23825258 [GRCh38]
Chr22:24167445 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.935C>T (p.Ala312Val) single nucleotide variant not provided [RCV001208314] Chr22:23825364 [GRCh38]
Chr22:24167551 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.185A>T (p.Lys62Ile) single nucleotide variant not provided [RCV001222107] Chr22:23791847 [GRCh38]
Chr22:24134034 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.947G>A (p.Arg316Gln) single nucleotide variant not provided [RCV001223908] Chr22:23825376 [GRCh38]
Chr22:24167563 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.868C>G (p.Pro290Ala) single nucleotide variant not provided [RCV001220775] Chr22:23825297 [GRCh38]
Chr22:24167484 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1118+4C>G single nucleotide variant not provided [RCV001222788] Chr22:23833707 [GRCh38]
Chr22:24175894 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.644del (p.Pro215fs) deletion not provided [RCV001231720] Chr22:23816784 [GRCh38]
Chr22:24158971 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.896C>T (p.Ser299Leu) single nucleotide variant not provided [RCV001206280] Chr22:23825325 [GRCh38]
Chr22:24167512 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.975C>G (p.Thr325=) single nucleotide variant not provided [RCV001220455] Chr22:23825404 [GRCh38]
Chr22:24167591 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.987C>A (p.Ser329Arg) single nucleotide variant not provided [RCV001220844] Chr22:23833572 [GRCh38]
Chr22:24175759 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.1-13.33(chr22:16888899-51197838)x3 copy number gain not provided [RCV000846344] Chr22:16888899..51197838 [GRCh37]
Chr22:22q11.1-13.33
pathogenic
NM_003073.5(SMARCB1):c.579G>A (p.Met193Ile) single nucleotide variant not provided [RCV001240464] Chr22:23803373 [GRCh38]
Chr22:24145560 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.827T>C (p.Val276Ala) single nucleotide variant not provided [RCV001214876] Chr22:23825256 [GRCh38]
Chr22:24167443 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.268del (p.Leu90fs) deletion not provided [RCV001210999] Chr22:23793592 [GRCh38]
Chr22:24135779 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.745C>T (p.Pro249Ser) single nucleotide variant not provided [RCV001238663] Chr22:23816886 [GRCh38]
Chr22:24159073 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.*33T>G single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV001150201]|Schwannomatosis 1 [RCV001150202] Chr22:23834213 [GRCh38]
Chr22:24176400 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.52C>T (p.Gln18Ter) single nucleotide variant not provided [RCV001092756] Chr22:23787221 [GRCh38]
Chr22:24129408 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.*362T>G single nucleotide variant not provided [RCV001571322] Chr22:23834542 [GRCh38]
Chr22:24176729 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1118+52A>G single nucleotide variant not provided [RCV001553270] Chr22:23833755 [GRCh38]
Chr22:24175942 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.501-23T>G single nucleotide variant not provided [RCV001560832] Chr22:23803272 [GRCh38]
Chr22:24145459 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.362+109_362+110dup duplication not provided [RCV001612236] Chr22:23793781..23793782 [GRCh38]
Chr22:24135968..24135969 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.93+682A>G single nucleotide variant not provided [RCV001568903] Chr22:23787944 [GRCh38]
Chr22:24130131 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.232+177A>G single nucleotide variant not provided [RCV001569365] Chr22:23792071 [GRCh38]
Chr22:24134258 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.986+57_986+58dup duplication not provided [RCV001717716] Chr22:23825470..23825471 [GRCh38]
Chr22:24167657..24167658 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.*314CAGGTCATGTTCAATTTCTTCAA[3] microsatellite not provided [RCV001651736] Chr22:23834490..23834491 [GRCh38]
Chr22:24176677..24176678 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.500+181C>G single nucleotide variant not provided [RCV001556907] Chr22:23801262 [GRCh38]
Chr22:24143449 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.501-87A>G single nucleotide variant not provided [RCV001716136] Chr22:23803208 [GRCh38]
Chr22:24145395 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.232+221T>C single nucleotide variant not provided [RCV001611345] Chr22:23792115 [GRCh38]
Chr22:24134302 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.1119-167_1119-164del deletion not provided [RCV001592309] Chr22:23833974..23833977 [GRCh38]
Chr22:24176161..24176164 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.362+110dup duplication not provided [RCV001718167] Chr22:23793781..23793782 [GRCh38]
Chr22:24135968..24135969 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.362+302G>C single nucleotide variant not provided [RCV001589615] Chr22:23793990 [GRCh38]
Chr22:24136177 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.93+107_93+108insGGCGCG insertion not provided [RCV001558929] Chr22:23787366..23787367 [GRCh38]
Chr22:24129553..24129554 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.93+685G>A single nucleotide variant not provided [RCV001678668] Chr22:23787947 [GRCh38]
Chr22:24130134 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.93+346T>C single nucleotide variant not provided [RCV001666089] Chr22:23787608 [GRCh38]
Chr22:24129795 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.150C>G (p.Leu50=) single nucleotide variant not provided [RCV000932326] Chr22:23791812 [GRCh38]
Chr22:24133999 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.812del (p.Gly271fs) deletion Rhabdoid tumor predisposition syndrome 1 [RCV000857232] Chr22:23825239 [GRCh38]
Chr22:24167426 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.933C>T (p.Ile311=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001019188]|not provided [RCV000910735] Chr22:23825362 [GRCh38]
Chr22:24167549 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.831C>T (p.Asp277=) single nucleotide variant not provided [RCV000867688] Chr22:23825260 [GRCh38]
Chr22:24167447 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.162A>G (p.Leu54=) single nucleotide variant not provided [RCV000873895] Chr22:23791824 [GRCh38]
Chr22:24134011 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.609C>T (p.Ala203=) single nucleotide variant not provided [RCV000931440] Chr22:23803403 [GRCh38]
Chr22:24145590 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1119-8T>A single nucleotide variant not provided [RCV000868474] Chr22:23834133 [GRCh38]
Chr22:24176320 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.637A>T (p.Met213Leu) single nucleotide variant not provided [RCV001244536] Chr22:23816778 [GRCh38]
Chr22:24158965 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.85G>C (p.Gly29Arg) single nucleotide variant not provided [RCV001219480] Chr22:23787254 [GRCh38]
Chr22:24129441 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.203A>T (p.His68Leu) single nucleotide variant not provided [RCV001202643] Chr22:23791865 [GRCh38]
Chr22:24134052 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.159_160delinsTATCTGGAGGCG (p.Leu54fs) indel not provided [RCV001245646] Chr22:23791821..23791822 [GRCh38]
Chr22:24134008..24134009 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.795+1G>A single nucleotide variant not provided [RCV001056616] Chr22:23816937 [GRCh38]
Chr22:24159124 [GRCh37]
Chr22:22q11.23
likely pathogenic
NM_003073.5(SMARCB1):c.826G>A (p.Val276Met) single nucleotide variant not provided [RCV001209319] Chr22:23825255 [GRCh38]
Chr22:24167442 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.934G>A (p.Ala312Thr) single nucleotide variant not provided [RCV001234901] Chr22:23825363 [GRCh38]
Chr22:24167550 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.*197A>C single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV001144062]|Schwannomatosis 1 [RCV001144061] Chr22:23834377 [GRCh38]
Chr22:24176564 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.104_115del (p.Tyr35_Met38del) deletion not provided [RCV001227912] Chr22:23791765..23791776 [GRCh38]
Chr22:24133952..24133963 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1107C>T (p.Asp369=) single nucleotide variant not provided [RCV000933907] Chr22:23833692 [GRCh38]
Chr22:24175879 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.432C>T (p.Ala144=) single nucleotide variant not provided [RCV000934583] Chr22:23801013 [GRCh38]
Chr22:24143200 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.501-146C>T single nucleotide variant not provided [RCV001578180] Chr22:23803149 [GRCh38]
Chr22:24145336 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.628+66G>C single nucleotide variant not provided [RCV001595820] Chr22:23803488 [GRCh38]
Chr22:24145675 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.93+425del deletion not provided [RCV001586746] Chr22:23787687 [GRCh38]
Chr22:24129874 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.362+134C>T single nucleotide variant not provided [RCV001564199] Chr22:23793822 [GRCh38]
Chr22:24136009 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.986+158A>G single nucleotide variant not provided [RCV001565729] Chr22:23825573 [GRCh38]
Chr22:24167760 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.93+123G>T single nucleotide variant not provided [RCV001576742] Chr22:23787385 [GRCh38]
Chr22:24129572 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.408C>T (p.Pro136=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001021842] Chr22:23800989 [GRCh38]
Chr22:24143176 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1052C>T (p.Pro351Leu) single nucleotide variant not provided [RCV001054947] Chr22:23833637 [GRCh38]
Chr22:24175824 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.*314CAGGTCATGTTCAATTTCTTCAA[1] microsatellite not provided [RCV001654522] Chr22:23834491..23834513 [GRCh38]
Chr22:24176678..24176700 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.986+143TCC[2] microsatellite not provided [RCV001638825] Chr22:23825558..23825560 [GRCh38]
Chr22:24167745..24167747 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.93+95GGGC[4] microsatellite not provided [RCV001716569] Chr22:23787356..23787357 [GRCh38]
Chr22:24129543..24129544 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.363-153C>T single nucleotide variant not provided [RCV001673290] Chr22:23800791 [GRCh38]
Chr22:24142978 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.93+105GC[9] microsatellite not provided [RCV001638476] Chr22:23787366..23787367 [GRCh38]
Chr22:24129553..24129554 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.70G>A (p.Glu24Lys) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001026037] Chr22:23787239 [GRCh38]
Chr22:24129426 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1157A>G (p.Ter386=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001010037] Chr22:23834179 [GRCh38]
Chr22:24176366 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1120C>A (p.Arg374=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001009921] Chr22:23834142 [GRCh38]
Chr22:24176329 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.79A>G (p.Met27Val) single nucleotide variant not provided [RCV001210994] Chr22:23787248 [GRCh38]
Chr22:24129435 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.*159C>G single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV001144059]|Schwannomatosis 1 [RCV001144060] Chr22:23834339 [GRCh38]
Chr22:24176526 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.546G>T (p.Gln182His) single nucleotide variant not provided [RCV001069090] Chr22:23803340 [GRCh38]
Chr22:24145527 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.23(chr22:23650871-25066472)x3 copy number gain not provided [RCV001007176] Chr22:23650871..25066472 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.246G>A (p.Thr82=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001015461] Chr22:23793572 [GRCh38]
Chr22:24135759 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.281C>T (p.Ser94Leu) single nucleotide variant not provided [RCV001057542] Chr22:23793607 [GRCh38]
Chr22:24135794 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.557T>C (p.Leu186Pro) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001024297]|not provided [RCV001362224] Chr22:23803351 [GRCh38]
Chr22:24145538 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.568C>T (p.Arg190Trp) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001024411]|Schwannomatosis 1 [RCV001195823]|not provided [RCV001365280] Chr22:23803362 [GRCh38]
Chr22:24145549 [GRCh37]
Chr22:22q11.23
likely pathogenic|uncertain significance
NM_003073.5(SMARCB1):c.61G>A (p.Asp21Asn) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001025002]|not provided [RCV001362384] Chr22:23787230 [GRCh38]
Chr22:24129417 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1118+4C>A single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001017383]|not provided [RCV001056825] Chr22:23833707 [GRCh38]
Chr22:24175894 [GRCh37]
Chr22:22q11.23
likely benign|uncertain significance
NM_003073.5(SMARCB1):c.1119-3C>T single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001017390]|not provided [RCV001064997] Chr22:23834138 [GRCh38]
Chr22:24176325 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1145C>T (p.Ala382Val) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001017455] Chr22:23834167 [GRCh38]
Chr22:24176354 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.628+4C>T single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001025078]|not provided [RCV001060482] Chr22:23803426 [GRCh38]
Chr22:24145613 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.849G>A (p.Met283Ile) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001017916] Chr22:23825278 [GRCh38]
Chr22:24167465 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.852A>C (p.Ser284=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001017961]|not provided [RCV001469238] Chr22:23825281 [GRCh38]
Chr22:24167468 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.334A>G (p.Ile112Val) single nucleotide variant not provided [RCV001092757] Chr22:23793660 [GRCh38]
Chr22:24135847 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.68G>A (p.Gly23Asp) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001025784]|not provided [RCV001373774] Chr22:23787237 [GRCh38]
Chr22:24129424 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.30C>T (p.Phe10=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001018642]|not provided [RCV001462575] Chr22:23787199 [GRCh38]
Chr22:24129386 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.496del (p.Leu166fs) deletion not provided [RCV001060964] Chr22:23801073 [GRCh38]
Chr22:24143260 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.94-157C>T single nucleotide variant not provided [RCV001714614] Chr22:23791599 [GRCh38]
Chr22:24133786 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.795+119T>C single nucleotide variant not provided [RCV001584956] Chr22:23817055 [GRCh38]
Chr22:24159242 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.629-126del deletion not provided [RCV001680623] Chr22:23816640 [GRCh38]
Chr22:24158827 [GRCh37]
Chr22:22q11.23
benign
Single allele duplication Mental retardation, autosomal dominant 15 [RCV001591654] Chr22:23774226..23859697 [GRCh38]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.22-11.23(chr22:22953514-25002483)x3 copy number gain not provided [RCV001007174] Chr22:22953514..25002483 [GRCh37]
Chr22:22q11.22-11.23
pathogenic
NM_003073.5(SMARCB1):c.987-319G>T single nucleotide variant not provided [RCV001612336] Chr22:23833253 [GRCh38]
Chr22:24175440 [GRCh37]
Chr22:22q11.23
benign
NM_003073.5(SMARCB1):c.550G>A (p.Glu184Lys) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001024206]|not provided [RCV001213796] Chr22:23803344 [GRCh38]
Chr22:24145531 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.767A>G (p.Asp256Gly) single nucleotide variant not provided [RCV001064608] Chr22:23816908 [GRCh38]
Chr22:24159095 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.868_870del (p.Pro290del) deletion not provided [RCV001065846] Chr22:23825295..23825297 [GRCh38]
Chr22:24167482..24167484 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.233-43A>T single nucleotide variant not provided [RCV001547913] Chr22:23793516 [GRCh38]
Chr22:24135703 [GRCh37]
Chr22:22q11.23
likely benign
NC_000022.11:g.(?_23833562)_(23834262_?)dup duplication not provided [RCV001033348] Chr22:24175749..24176449 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.80T>G (p.Met27Arg) single nucleotide variant not provided [RCV001040176] Chr22:23787249 [GRCh38]
Chr22:24129436 [GRCh37]
Chr22:22q11.23
conflicting interpretations of pathogenicity|uncertain significance
NM_003073.5(SMARCB1):c.473G>T (p.Arg158Leu) single nucleotide variant not provided [RCV001216038] Chr22:23801054 [GRCh38]
Chr22:24143241 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.866C>T (p.Ser289Leu) single nucleotide variant not provided [RCV001235907] Chr22:23825295 [GRCh38]
Chr22:24167482 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.-31C>T single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV001150086]|Schwannomatosis 1 [RCV001150087]|not provided [RCV001555394] Chr22:23787139 [GRCh38]
Chr22:24129326 [GRCh37]
Chr22:22q11.23
benign|likely benign
NM_003073.5(SMARCB1):c.-83C>T single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV001150085]|Schwannomatosis 1 [RCV001150084] Chr22:23787087 [GRCh38]
Chr22:24129274 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.21C>T (p.Ser7=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001014773] Chr22:23787190 [GRCh38]
Chr22:24129377 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.987-1G>A single nucleotide variant not provided [RCV001212881] Chr22:23833571 [GRCh38]
Chr22:24175758 [GRCh37]
Chr22:22q11.23
likely pathogenic
NM_003073.5(SMARCB1):c.736G>A (p.Glu246Lys) single nucleotide variant not provided [RCV001041873] Chr22:23816877 [GRCh38]
Chr22:24159064 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.1-12.1(chr22:16888899-27657507)x3 copy number gain not provided [RCV001007163] Chr22:16888899..27657507 [GRCh37]
Chr22:22q11.1-12.1
pathogenic
NM_003073.5(SMARCB1):c.501C>T (p.Cys167=) single nucleotide variant not provided [RCV001213593] Chr22:23803295 [GRCh38]
Chr22:24145482 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.119G>A (p.Arg40Gln) single nucleotide variant not provided [RCV001202988] Chr22:23791781 [GRCh38]
Chr22:24133968 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.11:g.(?_23787170)_(23834262_?)dup duplication not provided [RCV001031035] Chr22:24129357..24176449 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.500+6G>C single nucleotide variant not provided [RCV001206729] Chr22:23801087 [GRCh38]
Chr22:24143274 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.11:g.(?_23787160)_(23803432_?)dup duplication not provided [RCV001031917] Chr22:24129347..24145619 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.11:g.(?_23825215)_(23825425_?)del deletion not provided [RCV001032246] Chr22:24167402..24167612 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.642G>T (p.Thr214=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001025259]|not provided [RCV001480526] Chr22:23816783 [GRCh38]
Chr22:24158970 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1052dup (p.Leu352fs) duplication not provided [RCV001204478] Chr22:23833634..23833635 [GRCh38]
Chr22:24175821..24175822 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.232+1G>A single nucleotide variant not provided [RCV001248433] Chr22:23791895 [GRCh38]
Chr22:24134082 [GRCh37]
Chr22:22q11.23
likely pathogenic
NC_000022.10:g.(?_24129357)_(24836024_?)del deletion not provided [RCV001031302] Chr22:24129357..24836024 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.735C>T (p.Ile245=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001026318] Chr22:23816876 [GRCh38]
Chr22:24159063 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.44T>C (p.Val15Ala) single nucleotide variant not provided [RCV001067822] Chr22:23787213 [GRCh38]
Chr22:24129400 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.500+3G>A single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001023402] Chr22:23801084 [GRCh38]
Chr22:24143271 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.795+5G>A single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001026990]|not provided [RCV001049346] Chr22:23816941 [GRCh38]
Chr22:24159128 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.333C>T (p.Ser111=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001020036]|not provided [RCV001424499] Chr22:23793659 [GRCh38]
Chr22:24135846 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.*307A>G single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV001145961]|Schwannomatosis 1 [RCV001145960] Chr22:23834487 [GRCh38]
Chr22:24176674 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.157C>T (p.Arg53Ter) single nucleotide variant not provided [RCV001214604] Chr22:23791819 [GRCh38]
Chr22:24134006 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.1035T>C (p.Asp345=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001017089] Chr22:23833620 [GRCh38]
Chr22:24175807 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.87C>T (p.Gly29=) single nucleotide variant Hereditary cancer-predisposing syndrome [RCV001018351]|not provided [RCV001436702] Chr22:23787256 [GRCh38]
Chr22:24129443 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.1155G>T (p.Trp385Cys) single nucleotide variant not provided [RCV001065120] Chr22:23834177 [GRCh38]
Chr22:24176364 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.641C>T (p.Thr214Met) single nucleotide variant not provided [RCV001065328] Chr22:23816782 [GRCh38]
Chr22:24158969 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.67G>A (p.Gly23Ser) single nucleotide variant not provided [RCV001042293] Chr22:23787236 [GRCh38]
Chr22:24129423 [GRCh37]
Chr22:22q11.23
uncertain significance
GRCh37/hg19 22q11.1-12.1(chr22:16888899-26483608)x3 copy number gain Cat eye syndrome [RCV001263219] Chr22:16888899..26483608 [GRCh37]
Chr22:22q11.1-12.1
pathogenic
GRCh37/hg19 22q11.1-13.33(chr22:16197005-51224252)x3 copy number gain See cases [RCV001263056] Chr22:16197005..51224252 [GRCh37]
Chr22:22q11.1-13.33
pathogenic
GRCh37/hg19 22q11.22-11.23(chr22:23258368-25059827)x3 copy number gain not provided [RCV001258774] Chr22:23258368..25059827 [GRCh37]
Chr22:22q11.22-11.23
pathogenic
GRCh37/hg19 22q11.23(chr22:23650873-25043046)x3 copy number gain not provided [RCV001258776] Chr22:23650873..25043046 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.1062_1063del (p.Glu354fs) microsatellite Rhabdoid tumor predisposition syndrome 1 [RCV001335091] Chr22:23833645..23833646 [GRCh38]
Chr22:24175832..24175833 [GRCh37]
Chr22:22q11.23
pathogenic
GRCh37/hg19 22q11.23(chr22:23720181-25066484)x3 copy number gain See cases [RCV001263027] Chr22:23720181..25066484 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.10:g.(?_24129357)_(24836024_?)dup duplication not provided [RCV001324555] Chr22:24129357..24836024 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1106A>T (p.Asp369Val) single nucleotide variant Inborn genetic diseases [RCV001266328] Chr22:23833691 [GRCh38]
Chr22:24175878 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.595A>G (p.Lys199Glu) single nucleotide variant Inborn genetic diseases [RCV001265852] Chr22:23803389 [GRCh38]
Chr22:24145576 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.10:g.(?_24129357)_(24145619_?)dup duplication not provided [RCV001313997] Chr22:24129357..24145619 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.10:g.(?_24143121)_(24176449_?)dup duplication not provided [RCV001300226] Chr22:24143121..24176449 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.340A>G (p.Thr114Ala) single nucleotide variant not provided [RCV001300407] Chr22:23793666 [GRCh38]
Chr22:24135853 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.346C>A (p.Pro116Thr) single nucleotide variant not provided [RCV001296194] Chr22:23793672 [GRCh38]
Chr22:24135859 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.10:g.(?_23915453)_(24921762_?)dup duplication Agammaglobulinemia 2, autosomal recessive [RCV001301073] Chr22:23915453..24921762 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.894C>G (p.Cys298Trp) single nucleotide variant not provided [RCV001319631] Chr22:23825323 [GRCh38]
Chr22:24167510 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.245C>T (p.Thr82Met) single nucleotide variant not provided [RCV001299264] Chr22:23793571 [GRCh38]
Chr22:24135758 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.812G>A (p.Gly271Glu) single nucleotide variant Mental retardation, autosomal dominant 15 [RCV001330808]|SMARCB1-related BAFopathy [RCV001533134] Chr22:23825241 [GRCh38]
Chr22:24167428 [GRCh37]
Chr22:22q11.23
likely pathogenic
NM_003073.5(SMARCB1):c.11T>C (p.Met4Thr) single nucleotide variant not provided [RCV001349744] Chr22:23787180 [GRCh38]
Chr22:24129367 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.487A>G (p.Thr163Ala) single nucleotide variant Mental retardation, autosomal dominant 15 [RCV001330807] Chr22:23801068 [GRCh38]
Chr22:24143255 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.233-5del deletion not provided [RCV001318456] Chr22:23793553 [GRCh38]
Chr22:24135740 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.10:g.(?_24129357)_(24167612_?)dup duplication not provided [RCV001343955] Chr22:24129357..24167612 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.10:g.(?_24129361)_24282899dup duplication not provided [RCV001372279]   uncertain significance
NC_000022.10:g.(?_24130008)_(24176449_?)dup duplication not provided [RCV001372280] Chr22:24130008..24176449 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.180G>A (p.Arg60=) single nucleotide variant not provided [RCV001395642] Chr22:23791842 [GRCh38]
Chr22:24134029 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.500+10C>T single nucleotide variant not provided [RCV001327532] Chr22:23801091 [GRCh38]
Chr22:24143278 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.558G>C (p.Leu186=) single nucleotide variant not provided [RCV001392591] Chr22:23803352 [GRCh38]
Chr22:24145539 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.83_84delinsAA (p.Ile28Lys) indel not provided [RCV001371201] Chr22:23787252..23787253 [GRCh38]
Chr22:24129439..24129440 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1091A>T (p.Lys364Met) single nucleotide variant not provided [RCV001343414] Chr22:23833676 [GRCh38]
Chr22:24175863 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.233-9_233-6del deletion not provided [RCV001346323] Chr22:23793547..23793550 [GRCh38]
Chr22:24135734..24135737 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1037C>T (p.Ala346Val) single nucleotide variant not provided [RCV001373695] Chr22:23833622 [GRCh38]
Chr22:24175809 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.673G>A (p.Asp225Asn) single nucleotide variant not provided [RCV001344798] Chr22:23816814 [GRCh38]
Chr22:24159001 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.836T>G (p.Phe279Cys) single nucleotide variant not provided [RCV001317816] Chr22:23825265 [GRCh38]
Chr22:24167452 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.301G>C (p.Asp101His) single nucleotide variant not provided [RCV001346156] Chr22:23793627 [GRCh38]
Chr22:24135814 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.831C>G (p.Asp277Glu) single nucleotide variant not provided [RCV001347607] Chr22:23825260 [GRCh38]
Chr22:24167447 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.850T>G (p.Ser284Ala) single nucleotide variant not provided [RCV001363492] Chr22:23825279 [GRCh38]
Chr22:24167466 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.553G>A (p.Val185Met) single nucleotide variant not provided [RCV001370231] Chr22:23803347 [GRCh38]
Chr22:24145534 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.128T>G (p.Leu43Arg) single nucleotide variant not provided [RCV001320892] Chr22:23791790 [GRCh38]
Chr22:24133977 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.526A>C (p.Ile176Leu) single nucleotide variant not provided [RCV001351513] Chr22:23803320 [GRCh38]
Chr22:24145507 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.308A>G (p.Asn103Ser) single nucleotide variant not provided [RCV001308198] Chr22:23793634 [GRCh38]
Chr22:24135821 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.301G>T (p.Asp101Tyr) single nucleotide variant not provided [RCV001340282] Chr22:23793627 [GRCh38]
Chr22:24135814 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.790A>T (p.Ile264Phe) single nucleotide variant not provided [RCV001321232] Chr22:23816931 [GRCh38]
Chr22:24159118 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.71A>C (p.Glu24Ala) single nucleotide variant not provided [RCV001368317] Chr22:23787240 [GRCh38]
Chr22:24129427 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1132C>T (p.Leu378Phe) single nucleotide variant not provided [RCV001296679] Chr22:23834154 [GRCh38]
Chr22:24176341 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.1012A>C (p.Ile338Leu) single nucleotide variant not provided [RCV001364487] Chr22:23833597 [GRCh38]
Chr22:24175784 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.583A>T (p.Ile195Phe) single nucleotide variant not provided [RCV001337562] Chr22:23803377 [GRCh38]
Chr22:24145564 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.782G>A (p.Arg261His) single nucleotide variant not provided [RCV001370687] Chr22:23816923 [GRCh38]
Chr22:24159110 [GRCh37]
Chr22:22q11.23
uncertain significance
NC_000022.10:g.(?_24158947)_(24176449_?)dup duplication not provided [RCV001313998] Chr22:24158947..24176449 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.986+2T>C single nucleotide variant Coffin-Siris syndrome [RCV001269267] Chr22:23825417 [GRCh38]
Chr22:24167604 [GRCh37]
Chr22:22q11.23
likely pathogenic
NC_000022.10:g.(?_24129357)_(24130008_?)dup duplication not provided [RCV001300225] Chr22:24129357..24130008 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.20G>A (p.Ser7Asn) single nucleotide variant not provided [RCV001340833] Chr22:23787189 [GRCh38]
Chr22:24129376 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.555G>A (p.Val185=) single nucleotide variant not provided [RCV001412709] Chr22:23803349 [GRCh38]
Chr22:24145536 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.540A>G (p.Ala180=) single nucleotide variant not provided [RCV001395418] Chr22:23803334 [GRCh38]
Chr22:24145521 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.907T>C (p.Leu303=) single nucleotide variant not provided [RCV001413691] Chr22:23825336 [GRCh38]
Chr22:24167523 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.492C>A (p.Phe164Leu) single nucleotide variant not provided [RCV001365536] Chr22:23801073 [GRCh38]
Chr22:24143260 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.743A>G (p.Tyr248Cys) single nucleotide variant not provided [RCV001306267] Chr22:23816884 [GRCh38]
Chr22:24159071 [GRCh37]
Chr22:22q11.23
uncertain significance
NM_003073.5(SMARCB1):c.783C>A (p.Arg261=) single nucleotide variant not provided [RCV001427727] Chr22:23816924 [GRCh38]
Chr22:24159111 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.795+8A>G single nucleotide variant not provided [RCV001466732] Chr22:23816944 [GRCh38]
Chr22:24159131 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.198G>A (p.Ser66=) single nucleotide variant not provided [RCV001435996] Chr22:23791860 [GRCh38]
Chr22:24134047 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.720C>T (p.Ala240=) single nucleotide variant not provided [RCV001464914] Chr22:23816861 [GRCh38]
Chr22:24159048 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.45G>A (p.Val15=) single nucleotide variant not provided [RCV001475328] Chr22:23787214 [GRCh38]
Chr22:24129401 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.645T>G (p.Pro215=) single nucleotide variant not provided [RCV001504987] Chr22:23816786 [GRCh38]
Chr22:24158973 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.768C>T (p.Asp256=) single nucleotide variant not provided [RCV001439054] Chr22:23816909 [GRCh38]
Chr22:24159096 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.364G>T (p.Glu122Ter) single nucleotide variant not provided [RCV001390133] Chr22:23800945 [GRCh38]
Chr22:24143132 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.472C>T (p.Arg158Ter) single nucleotide variant Rhabdoid tumor predisposition syndrome 1 [RCV001523823]|not provided [RCV001390134] Chr22:23801053 [GRCh38]
Chr22:24143240 [GRCh37]
Chr22:22q11.23
pathogenic
NM_003073.5(SMARCB1):c.501-9C>T single nucleotide variant not provided [RCV001459585] Chr22:23803286 [GRCh38]
Chr22:24145473 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.711C>T (p.Ile237=) single nucleotide variant not provided [RCV001403235] Chr22:23816852 [GRCh38]
Chr22:24159039 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.315G>A (p.Glu105=) single nucleotide variant not provided [RCV001499701] Chr22:23793641 [GRCh38]
Chr22:24135828 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.552G>A (p.Glu184=) single nucleotide variant not provided [RCV001468014] Chr22:23803346 [GRCh38]
Chr22:24145533 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.93+9G>C single nucleotide variant not provided [RCV001477334] Chr22:23787271 [GRCh38]
Chr22:24129458 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.975C>T (p.Thr325=) single nucleotide variant not provided [RCV001426785] Chr22:23825404 [GRCh38]
Chr22:24167591 [GRCh37]
Chr22:22q11.23
likely benign
NM_003073.5(SMARCB1):c.798G>A (p.Leu266=) single nucleo