ELANE (elastase, neutrophil expressed) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: ELANE (elastase, neutrophil expressed) Homo sapiens
Analyze
Symbol: ELANE
Name: elastase, neutrophil expressed
RGD ID: 1317469
HGNC Page HGNC:3309
Description: Enables several functions, including heparin binding activity; protease binding activity; and serine-type endopeptidase activity. Involved in several processes, including defense response to Gram-negative bacterium; positive regulation of smooth muscle cell proliferation; and regulation of gene expression. Acts upstream of or within proteolysis. Located in cell surface; extracellular space; and secretory granule. Part of transcription repressor complex. Implicated in cyclic hematopoiesis; periodontitis; severe congenital neutropenia; and severe congenital neutropenia 1. Biomarker of COVID-19; disseminated intravascular coagulation; essential thrombocythemia; polycythemia vera; and severe congenital neutropenia.
Type: protein-coding
RefSeq Status: REVIEWED
Previously known as: bone marrow serine protease; ELA2; elastase 2, neutrophil; elastase-2; GE; granulocyte-derived elastase; HLE; HNE; human leukocyte elastase; leukocyte elastase; medullasin; NE; neutrophil elastase; PMN elastase; PMN-E; polymorphonuclear elastase; polymorphonuclear leukocyte elastase; SCN1
RGD Orthologs
Mouse
Rat
Bonobo
Dog
Pig
Green Monkey
Alliance Genes
More Info more info ...
Allele / Splice: See ClinVar data
Latest Assembly: GRCh38 - Human Genome Assembly GRCh38
Position:
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh3819852,303 - 856,243 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh38.p13 Ensembl19851,014 - 856,247 (+)EnsemblGRCh38hg38GRCh38
GRCh3719852,303 - 856,243 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 3619803,291 - 807,246 (+)NCBINCBI36Build 36hg18NCBI36
Build 3419803,290 - 807,244NCBI
Celera19777,442 - 781,374 (+)NCBICelera
Cytogenetic Map19p13.3NCBI
HuRef19621,154 - 625,109 (+)NCBIHuRef
CHM1_119851,692 - 855,840 (+)NCBICHM1_1
T2T-CHM13v2.019808,411 - 812,352 (+)NCBIT2T-CHM13v2.0
JBrowse: View Region in Genome Browser (JBrowse)
Model


Gene Ontology Annotations     Click to see Annotation Detail View

Molecular Function

Molecular Pathway Annotations     Click to see Annotation Detail View
Phenotype Annotations     Click to see Annotation Detail View

Human Phenotype
Abdominal pain  (IAGP)
Abnormality of the mouth  (IAGP)
Acute lymphoblastic leukemia  (IAGP)
Acute monocytic leukemia  (IAGP)
Acute myeloid leukemia  (IAGP)
Anemia  (IAGP)
Antineutrophil antibody positivity  (IAGP)
Aplastic anemia  (IAGP)
Atrophy of alveolar ridges  (IAGP)
Autosomal dominant inheritance  (IAGP)
Bacteremia  (IAGP)
Bone pain  (IAGP)
Cellulitis  (IAGP)
Cerebral palsy  (IAGP)
Cervical lymphadenopathy  (IAGP)
Congenital agranulocytosis  (IAGP)
Cyclic neutropenia  (IAGP)
Decreased eosinophil count  (IAGP)
Diarrhea  (IAGP)
Enterocolitis  (IAGP)
Eosinophilia  (IAGP)
Fatigue  (IAGP)
Fever  (IAGP)
Gingivitis  (IAGP)
Growth abnormality  (IAGP)
Headache  (IAGP)
Hemangioma  (IAGP)
Increased circulating antibody level  (IAGP)
Infantile onset  (IAGP)
Lymphopenia  (IAGP)
Monocytosis  (IAGP)
Myelodysplasia  (IAGP)
Neutropenia  (IAGP)
Opportunistic infection  (IAGP)
Oral ulcer  (IAGP)
Osteopenia  (IAGP)
Otitis media  (IAGP)
Perianal abscess  (IAGP)
Periodic fever  (IAGP)
Periodontitis  (IAGP)
Peritonitis  (IAGP)
Pharyngitis  (IAGP)
Pneumonia  (IAGP)
Premature loss of permanent teeth  (IAGP)
Premature loss of teeth  (IAGP)
Pyoderma gangrenosum  (IAGP)
Recurrent aphthous stomatitis  (IAGP)
Recurrent bacterial infections  (IAGP)
Recurrent ear infections  (IAGP)
Recurrent infection of the gastrointestinal tract  (IAGP)
Recurrent sinopulmonary infections  (IAGP)
Recurrent skin infections  (IAGP)
Recurrent tonsillitis  (IAGP)
Recurrent viral infections  (IAGP)
Respiratory tract infection  (IAGP)
Rhinitis  (IAGP)
Sepsis  (IAGP)
Severe infection  (IAGP)
Sinusitis  (IAGP)
Thrombocytopenia  (IAGP)
Thrombocytosis  (IAGP)
Tooth abscess  (IAGP)
References

References - curated
# Reference Title Reference Citation
1. Mice lacking neutrophil elastase reveal impaired host defense against gram negative bacterial sepsis. Belaaouaj A, etal., Nat Med. 1998 May;4(5):615-8.
2. Neutrophil elastase inhibitor (ONO-5046) attenuates reperfusion-induced hepatic microcirculatory derangement, energy depletion and lipid peroxidation in rats. Chen HM, etal., Shock. 1999 Dec;12(6):462-7.
3. Different clinical phenotypes in familial severe congenital neutropenia cases with same mutation of the ELANE gene. Cho HK and Jeon IS, J Korean Med Sci. 2014 Mar;29(3):452-5. doi: 10.3346/jkms.2014.29.3.452. Epub 2014 Feb 27.
4. Neutrophil elastase and syndecan shedding contribute to antithrombin depletion in murine anthrax. Chung MC, etal., FEMS Immunol Med Microbiol. 2008 Dec;54(3):309-18. doi: 10.1111/j.1574-695X.2008.00480.x.
5. Role of neutrophil depletion and elastase inhibition in modifying skeletal muscle reperfusion injury. Crinnion JN, etal., Cardiovasc Surg. 1994 Dec;2(6):749-53.
6. Inflammation Profiling of Critically Ill Coronavirus Disease 2019 Patients. Fraser DD, etal., Crit Care Explor. 2020 Jun 22;2(6):e0144. doi: 10.1097/CCE.0000000000000144. eCollection 2020 Jun.
7. GOAs Human GO annotations GOA_HUMAN data from the GO Consortium
8. Neutrophil elastase inhibitor (ONO-5046) prevents lung hemorrhage induced by lipopolysaccharide in rat model of cerulein pancreatitis. Guo L, etal., Dig Dis Sci. 1995 Oct;40(10):2177-83.
9. Role of neutrophil elastase in development of pulmonary vascular injury and septic shock in rats. Harada N, etal., Shock. 2008 Oct;30(4):379-87. doi: 10.1097/SHK.0b013e3181673e2c.
10. Disseminated intravascular coagulation at an early phase of trauma is associated with consumption coagulopathy and excessive fibrinolysis both by plasmin and neutrophil elastase. Hayakawa M, etal., Surgery. 2011 Feb;149(2):221-30. doi: 10.1016/j.surg.2010.06.010. Epub 2010 Jul 23.
11. Benefical effect of neutrophil elastase inhibitor on renal warm ischemia-reperfusion injury in the rat. Hayama T, etal., Transplant Proc. 2006 Sep;38(7):2201-2.
12. Mac-1 (CD11b/CD18) links inflammation and thrombosis after glomerular injury. Hirahashi J, etal., Circulation. 2009 Sep 29;120(13):1255-65. Epub 2009 Sep 14.
13. Beneficial effect of an inhibitor of leukocyte elastase (EPI-hNE-4) in presence of repeated lung injuries. Honore S, etal., Shock. 2004 Aug;22(2):131-6.
14. Mutations in ELA2, encoding neutrophil elastase, define a 21-day biological clock in cyclic haematopoiesis. Horwitz M, etal., Nat Genet. 1999 Dec;23(4):433-6.
15. The effects of a new human leukocyte elastase inhibitor (recombinant guamerin) on cerulein-induced pancreatitis in rats. Jo YJ, etal., Int Immunopharmacol. 2008 Jul;8(7):959-66. doi: 10.1016/j.intimp.2008.02.014. Epub 2008 Mar 27.
16. Neutrophil elastase is needed for neutrophil emigration into lungs in ventilator-induced lung injury. Kaynar AM, etal., Am J Respir Cell Mol Biol. 2008 Jul;39(1):53-60. doi: 10.1165/rcmb.2007-0315OC. Epub 2008 Feb 14.
17. Neutrophil elastase inhibitor, sivelestat sodium hydrate prevents ischemia-reperfusion injury in the rat bladder. Kono T, etal., Mol Cell Biochem. 2008 Apr;311(1-2):87-92. doi: 10.1007/s11010-007-9698-9. Epub 2007 Dec 30.
18. A novel oral neutrophil elastase inhibitor (ONO-6818) inhibits human neutrophil elastase-induced emphysema in rats. Kuraki T, etal., Am J Respir Crit Care Med. 2002 Aug 15;166(4):496-500.
19. Four novel ELANE mutations in patients with congenital neutropenia. Kurnikova M, etal., Pediatr Blood Cancer. 2011 Aug;57(2):332-5. doi: 10.1002/pbc.23104. Epub 2011 Mar 21.
20. Role of neutrophil elastase in stress-induced gastric mucosal injury in rats. Liu W, etal., J Lab Clin Med. 1998 Nov;132(5):432-9.
21. Thrombin generation and activated protein C resistance in patients with essential thrombocythemia and polycythemia vera. Marchetti M, etal., Blood. 2008 Nov 15;112(10):4061-8. doi: 10.1182/blood-2008-06-164087. Epub 2008 Sep 3.
22. Neutrophil elastase inhibitor attenuates hippocampal neuronal damage after transient forebrain ischemia in rats. Matayoshi H, etal., Brain Res. 2009 Mar 9;1259:98-106. doi: 10.1016/j.brainres.2008.12.070. Epub 2009 Jan 10.
23. Addition of a neutrophil elastase inhibitor to the organ flushing solution decreases lung reperfusion injury in rat lung transplantation. Mori H, etal., Eur J Cardiothorac Surg. 2007 Nov;32(5):791-5. Epub 2007 Sep 20.
24. Effect of plant neutrophil elastase inhibitor on leucocyte migration, adhesion and cytokine release in inflammatory conditions. Oliveira C, etal., Br J Pharmacol. 2010 Oct;161(4):899-910. doi: 10.1111/j.1476-5381.2010.00924.x.
25. OMIM Disease Annotation Pipeline OMIM Disease Annotation Pipeline
26. KEGG Annotation Import Pipeline Pipeline to import KEGG annotations from KEGG into RGD
27. Oxidative burst and neutrophil elastase contribute to clearance of Aspergillus fumigatus pneumonia in mice. Prufer S, etal., Immunobiology. 2014 Feb;219(2):87-96. doi: 10.1016/j.imbio.2013.08.010. Epub 2013 Aug 30.
28. ClinVar Automated Import and Annotation Pipeline RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
29. Data Import for Chemical-Gene Interactions RGD automated import pipeline for gene-chemical interactions
30. RGD HPO Phenotype Annotation Pipeline RGD automated import pipeline for human HPO-to-gene-to-disease annotations
31. Neutrophil elastase inhibition reduces cerebral ischemic damage in the middle cerebral artery occlusion. Shimakura A, etal., Brain Res. 2000 Mar 6;858(1):55-60.
32. Neutrophil elastase is severely down-regulated in severe congenital neutropenia independent of ELA2 or HAX1 mutations but dependent on LEF-1. Skokowa J, etal., Blood. 2009 Oct 1;114(14):3044-51. doi: 10.1182/blood-2008-11-188755. Epub 2009 Jul 20.
33. Effects of elastase inhibitor on the epithelial cell apoptosis in bleomycin-induced pulmonary fibrosis. Song JS, etal., Exp Lung Res. 2009 Dec;35(10):817-29. doi: 10.3109/01902140902912527.
34. Neutrophil elastase may play a key role in developing symptomatic disseminated intravascular coagulation and multiple organ failure in patients with head injury. Takahasi H, etal., J Trauma. 2000 Jul;49(1):86-91.
35. Role of neutrophil elastase in compression-induced spinal cord injury in rats. Taoka Y, etal., Brain Res. 1998 Jul 20;799(2):264-9.
36. A neutrophil elastase inhibitor, sivelestat, ameliorates lung injury after hemorrhagic shock in rats. Toda Y, etal., Int J Mol Med. 2007 Feb;19(2):237-43.
37. Histochemical localization of neutral proteases released during development of rat periradicular lesion. Tsuji M, etal., Arch Oral Biol. 2009 Dec;54(12):1128-35. doi: 10.1016/j.archoralbio.2009.10.003. Epub 2009 Nov 12.
38. Effects of lecithinized superoxide dismutase and a neutrophil elastase inhibitor (ONO-5046) on hyperoxic lung injury in rat. Yamamoto H, etal., Eur J Pharmacol. 2000 Dec 8;409(2):179-83.
39. The involvement of nitric oxide, nitric oxide synthase, neutrophil elastase, myeloperoxidase and proinflammatory cytokines in the acute lung injury caused by phorbol myristate acetate. Yang YL, etal., J Biomed Sci. 2008 Jul;15(4):499-507. doi: 10.1007/s11373-008-9238-y. Epub 2008 Feb 19.
40. Mutations in the ELANE gene are associated with development of periodontitis in patients with severe congenital neutropenia. Ye Y, etal., J Clin Immunol. 2011 Dec;31(6):936-45. doi: 10.1007/s10875-011-9572-0. Epub 2011 Jul 29.
Additional References at PubMed
PMID:1518849   PMID:1558967   PMID:1859409   PMID:2164060   PMID:2318847   PMID:2322278   PMID:2437112   PMID:2462434   PMID:2501794   PMID:2538548   PMID:2681419   PMID:2775493  
PMID:2822677   PMID:2902087   PMID:2911584   PMID:3391280   PMID:3422232   PMID:3427074   PMID:3479752   PMID:3550808   PMID:3640709   PMID:6980881   PMID:7521069   PMID:7713495  
PMID:8011628   PMID:8463250   PMID:8718849   PMID:8864963   PMID:9111002   PMID:9124593   PMID:9242537   PMID:9565572   PMID:10102815   PMID:10471600   PMID:10512713   PMID:10702419  
PMID:10859319   PMID:10867014   PMID:10924364   PMID:10978167   PMID:11001877   PMID:11389039   PMID:11520773   PMID:11675333   PMID:11846296   PMID:11907569   PMID:11928814   PMID:11948122  
PMID:12020136   PMID:12042033   PMID:12068293   PMID:12083479   PMID:12091371   PMID:12114510   PMID:12117418   PMID:12183836   PMID:12189154   PMID:12190311   PMID:12223522   PMID:12393522  
PMID:12444202   PMID:12477932   PMID:12483111   PMID:12526812   PMID:12531874   PMID:12538645   PMID:12700588   PMID:12745650   PMID:12771009   PMID:12778173   PMID:12782302   PMID:12853121  
PMID:12876407   PMID:12887060   PMID:12893759   PMID:12933574   PMID:12934194   PMID:14587040   PMID:14636558   PMID:14673143   PMID:14688365   PMID:14705961   PMID:14730209   PMID:14962902  
PMID:15010259   PMID:15059607   PMID:15131125   PMID:15140022   PMID:15161642   PMID:15203218   PMID:15245434   PMID:15489334   PMID:15595387   PMID:15601827   PMID:15614130   PMID:15657182  
PMID:15718918   PMID:15892999   PMID:15941909   PMID:16079102   PMID:16127146   PMID:16148149   PMID:16244764   PMID:16282197   PMID:16321984   PMID:16551967   PMID:16624642   PMID:16670064  
PMID:16690986   PMID:17023068   PMID:17088257   PMID:17187068   PMID:17395013   PMID:17397908   PMID:17412886   PMID:17436313   PMID:17622939   PMID:17690184   PMID:17761833   PMID:17785837  
PMID:17853021   PMID:17998887   PMID:18028488   PMID:18043239   PMID:18178964   PMID:18194283   PMID:18211966   PMID:18278188   PMID:18295791   PMID:18399311   PMID:18403643   PMID:18476621  
PMID:18485588   PMID:18669870   PMID:18710383   PMID:18799464   PMID:18980523   PMID:19056867   PMID:19132232   PMID:19180801   PMID:19197381   PMID:19251947   PMID:19307610   PMID:19362143  
PMID:19415009   PMID:19506020   PMID:19542452   PMID:19590686   PMID:19620298   PMID:19763368   PMID:19775295   PMID:19789190   PMID:20007580   PMID:20033193   PMID:20111696   PMID:20179351  
PMID:20301705   PMID:20346360   PMID:20354035   PMID:20376727   PMID:20411049   PMID:20421939   PMID:20423453   PMID:20453419   PMID:20521180   PMID:20582973   PMID:20627279   PMID:20634941  
PMID:20646231   PMID:20803142   PMID:20828556   PMID:20883273   PMID:20932306   PMID:20974816   PMID:21193404   PMID:21206270   PMID:21236472   PMID:21448199   PMID:21475777   PMID:21477798  
PMID:21488974   PMID:21576245   PMID:21605276   PMID:21731773   PMID:21843618   PMID:21873635   PMID:21979170   PMID:22174830   PMID:22407864   PMID:22500123   PMID:22683569   PMID:22915586  
PMID:22918834   PMID:22993338   PMID:22996420   PMID:23001948   PMID:23351986   PMID:23392769   PMID:23454784   PMID:23463630   PMID:23533145   PMID:23564510   PMID:23692169   PMID:23741370  
PMID:23819644   PMID:23911525   PMID:24023624   PMID:24052258   PMID:24184683   PMID:24513040   PMID:24816969   PMID:24848868   PMID:24877096   PMID:24914212   PMID:24929239   PMID:25037231  
PMID:25092677   PMID:25162927   PMID:25195861   PMID:25248056   PMID:25284053   PMID:25427142   PMID:25465717   PMID:25645918   PMID:25652853   PMID:25666548   PMID:25857284   PMID:25878251  
PMID:25893670   PMID:25912133   PMID:25956321   PMID:26018813   PMID:26174650   PMID:26193632   PMID:26221769   PMID:26269588   PMID:26372354   PMID:26444279   PMID:26567890   PMID:26874351  
PMID:26881964   PMID:26939803   PMID:27035679   PMID:27093231   PMID:27101808   PMID:27339896   PMID:27892542   PMID:27935111   PMID:27942017   PMID:28004483   PMID:28073911   PMID:28074935  
PMID:28187039   PMID:28344315   PMID:28468826   PMID:28507169   PMID:28630087   PMID:28754797   PMID:28888033   PMID:29046295   PMID:29478914   PMID:29539421   PMID:29624923   PMID:29767240  
PMID:29976235   PMID:30056589   PMID:30219097   PMID:30343390   PMID:30452386   PMID:30635825   PMID:30827416   PMID:31009763   PMID:31362723   PMID:31427279   PMID:31466461   PMID:31490025  
PMID:31536960   PMID:31622584   PMID:31626976   PMID:31658467   PMID:31749032   PMID:31842908   PMID:31887298   PMID:31945345   PMID:31963828   PMID:31991297   PMID:32203420   PMID:32299910  
PMID:32303641   PMID:32499333   PMID:32924109   PMID:32981934   PMID:32991313   PMID:33085168   PMID:33179225   PMID:33198714   PMID:33510372   PMID:33556558   PMID:33560392   PMID:33748632  
PMID:33961781   PMID:33964209   PMID:34130299   PMID:34181952   PMID:34261337   PMID:34270864   PMID:34340247   PMID:34439732   PMID:34500777   PMID:34536744   PMID:34580954   PMID:34597246  
PMID:34599140   PMID:34681796   PMID:35062217   PMID:35915986  


Genomics

Comparative Map Data
ELANE
(Homo sapiens - human)
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh3819852,303 - 856,243 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh38.p13 Ensembl19851,014 - 856,247 (+)EnsemblGRCh38hg38GRCh38
GRCh3719852,303 - 856,243 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 3619803,291 - 807,246 (+)NCBINCBI36Build 36hg18NCBI36
Build 3419803,290 - 807,244NCBI
Celera19777,442 - 781,374 (+)NCBICelera
Cytogenetic Map19p13.3NCBI
HuRef19621,154 - 625,109 (+)NCBIHuRef
CHM1_119851,692 - 855,840 (+)NCBICHM1_1
T2T-CHM13v2.019808,411 - 812,352 (+)NCBIT2T-CHM13v2.0
Elane
(Mus musculus - house mouse)
Mouse AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCm391079,722,146 - 79,724,050 (+)NCBIGRCm39GRCm39mm39
GRCm39 Ensembl1079,722,081 - 79,724,049 (+)EnsemblGRCm39 Ensembl
GRCm381079,886,312 - 79,888,216 (+)NCBIGRCm38GRCm38mm10GRCm38
GRCm38.p6 Ensembl1079,886,247 - 79,888,215 (+)EnsemblGRCm38mm10GRCm38
MGSCv371079,349,057 - 79,350,961 (+)NCBIGRCm37MGSCv37mm9NCBIm37
MGSCv361079,289,464 - 79,291,246 (+)NCBIMGSCv36mm8
Celera1080,901,123 - 80,903,026 (+)NCBICelera
Cytogenetic Map10C1NCBI
cM Map1039.72NCBI
Elane
(Rattus norvegicus - Norway rat)
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
mRatBN7.279,817,251 - 9,819,174 (-)NCBImRatBN7.2mRatBN7.2
mRatBN7.2 Ensembl79,817,252 - 9,819,100 (-)EnsemblmRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx712,699,238 - 12,701,086 (-)NCBIRnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0714,574,555 - 14,576,403 (-)NCBIRnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0712,435,754 - 12,437,602 (-)NCBIRnor_WKY
Rnor_6.0712,638,320 - 12,640,168 (-)NCBIRnor6.0Rnor_6.0rn6Rnor6.0
Rnor_6.0 Ensembl712,638,322 - 12,640,232 (-)EnsemblRnor6.0rn6Rnor6.0
Rnor_5.0712,808,042 - 12,809,890 (-)NCBIRnor5.0Rnor_5.0rn5Rnor5.0
RGSC_v3.4711,329,642 - 11,331,490 (-)NCBIRGSC3.4RGSC_v3.4rn4RGSC3.4
RGSC_v3.1711,329,643 - 11,331,467 (-)NCBI
Celera77,992,002 - 7,993,850 (-)NCBICelera
Cytogenetic Map7q11NCBI
ELANE
(Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
PanPan1.119820,455 - 828,181 (+)NCBIpanpan1.1PanPan1.1panPan2
Mhudiblu_PPA_v019276,499 - 280,598 (-)NCBIMhudiblu_PPA_v0Mhudiblu_PPA_v0panPan3
ELANE
(Canis lupus familiaris - dog)
Dog AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
CanFam3.12057,789,044 - 57,790,932 (-)NCBICanFam3.1CanFam3.1canFam3CanFam3.1
CanFam3.1 Ensembl2057,788,062 - 57,790,932 (-)EnsemblCanFam3.1canFam3CanFam3.1
Dog10K_Boxer_Tasha2057,591,060 - 57,592,948 (-)NCBIDog10K_Boxer_Tasha
ROS_Cfam_1.02058,531,328 - 58,533,216 (-)NCBIROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl2058,531,329 - 58,533,196 (-)EnsemblROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.12057,586,105 - 57,588,011 (-)NCBIUMICH_Zoey_3.1
UNSW_CanFamBas_1.02058,065,758 - 58,067,646 (-)NCBIUNSW_CanFamBas_1.0
UU_Cfam_GSD_1.02058,268,788 - 58,270,676 (-)NCBIUU_Cfam_GSD_1.0
ELANE
(Sus scrofa - pig)
Pig AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Sscrofa11.1 Ensembl277,509,344 - 77,516,027 (-)EnsemblSscrofa11.1susScr11Sscrofa11.1
Sscrofa11.1277,513,769 - 77,516,118 (-)NCBISscrofa11.1Sscrofa11.1susScr11Sscrofa11.1
Sscrofa10.2277,480,250 - 77,485,906 (+)NCBISscrofa10.2Sscrofa10.2susScr3
ELANE
(Chlorocebus sabaeus - green monkey)
Green Monkey AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChlSab1.16599,392 - 604,925 (+)NCBIChlSab1.1ChlSab1.1chlSab2
ChlSab1.1 Ensembl6601,217 - 604,725 (+)EnsemblChlSab1.1ChlSab1.1 EnsemblchlSab2
Vero_WHO_p1.0NW_0236660818,311,933 - 8,315,809 (-)NCBIVero_WHO_p1.0Vero_WHO_p1.0

Variants

.
Variants in ELANE
329 total Variants
miRNA Target Status

Predicted Target Of
Summary Value
Count of predictions:604
Count of miRNA genes:296
Interacting mature miRNAs:302
Transcripts:ENST00000263621, ENST00000590230
Prediction methods:Miranda, Rnahybrid
Result types:miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Markers in Region
RH47200  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh3719856,092 - 856,225UniSTSGRCh37
Build 3619807,092 - 807,225RGDNCBI36
Celera19781,220 - 781,353RGD
Cytogenetic Map19p13.3UniSTS
HuRef19624,955 - 625,088UniSTS
GeneMap99-GB4 RH Map195.85UniSTS
RH77978  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh3719856,092 - 856,226UniSTSGRCh37
Build 3619807,092 - 807,226RGDNCBI36
Celera19781,220 - 781,354RGD
Cytogenetic Map19p13.3UniSTS
HuRef19624,955 - 625,089UniSTS
GeneMap99-GB4 RH Map1918.31UniSTS


Expression


RNA-SEQ Expression
High: > 1000 TPM value   Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM   Below Cutoff: < 0.5 TPM

alimentary part of gastrointestinal system circulatory system endocrine system exocrine system hemolymphoid system hepatobiliary system integumental system musculoskeletal system nervous system renal system reproductive system respiratory system sensory system visual system adipose tissue appendage entire extraembryonic component
High 49 65 2 1
Medium 122 600 119 11 754 9 331 94 18 1 35 407 2 124 134
Low 2024 1804 1169 303 456 147 3179 1825 1672 114 879 905 159 1 1077 2108 2
Below cutoff 154 484 323 215 124 212 578 242 1647 169 373 138 8 3 512 1

Sequence

Nucleotide Sequences
RefSeq Transcripts NG_009627 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001972 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_011527775 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_011527776 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AC004799 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC112706 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC212840 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AH001514 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY596461 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC074816 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC074817 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BI254663 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CD613590 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471139 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CP068259 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D00187 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  EU617980 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  J03545 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M27783 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M34379 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X05875 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Y00477 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles

Reference Sequences
RefSeq Acc Id: ENST00000263621   ⟹   ENSP00000263621
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl19852,303 - 856,243 (+)Ensembl
RefSeq Acc Id: ENST00000590230   ⟹   ENSP00000466090
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl19851,014 - 856,247 (+)Ensembl
RefSeq Acc Id: NM_001972   ⟹   NP_001963
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh3819852,303 - 856,243 (+)NCBI
GRCh3719850,989 - 856,246 (+)NCBI
Build 3619803,291 - 807,246 (+)NCBI Archive
HuRef19621,154 - 625,109 (+)ENTREZGENE
CHM1_119851,610 - 855,840 (+)NCBI
T2T-CHM13v2.019808,411 - 812,352 (+)NCBI
Sequence:
Reference Sequences
RefSeq Acc Id: NP_001963   ⟸   NM_001972
- Peptide Label: preproprotein
- UniProtKB: Q6LDP5 (UniProtKB/Swiss-Prot),   P08246 (UniProtKB/Swiss-Prot)
- Sequence:
RefSeq Acc Id: ENSP00000466090   ⟸   ENST00000590230
RefSeq Acc Id: ENSP00000263621   ⟸   ENST00000263621
Protein Domains
Peptidase S1

Protein Structures
Name Modeler Protein Id AA Range Protein Structure
AF-P08246-F1-model_v2 AlphaFold P08246 1-267 view protein structure

Promoters
RGD ID:7237743
Promoter ID:EPDNEW_H24617
Type:initiation region
Name:ELANE_1
Description:elastase, neutrophil expressed
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Experiment Methods:Single-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh3819852,303 - 852,363EPDNEW

Clinical Variants
Name Type Condition(s) Position(s) Clinical significance
NM_001972.4(ELANE):c.67+1del deletion not provided [RCV000254820] Chr19:852391 [GRCh38]
Chr19:852391 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.176T>G (p.Leu59Arg) single nucleotide variant not provided [RCV000519150] Chr19:852984 [GRCh38]
Chr19:852984 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.659G>A (p.Arg220Gln) single nucleotide variant Cyclical neutropenia [RCV000018222]|Cyclical neutropenia [RCV001794454]|not provided [RCV000522053] Chr19:856019 [GRCh38]
Chr19:856019 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.618G>T (p.Leu206Phe) single nucleotide variant Cyclical neutropenia [RCV000018223] Chr19:855978 [GRCh38]
Chr19:855978 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.182C>T (p.Ala61Val) single nucleotide variant Autoinflammatory syndrome [RCV002262567]|Cyclical neutropenia [RCV000018224]|Cyclical neutropenia [RCV001794455] Chr19:852990 [GRCh38]
Chr19:852990 [GRCh37]
Chr19:19p13.3
pathogenic
ELANE, IVS4DS, G-A, +1 single nucleotide variant Cyclical neutropenia [RCV000018225] Chr19:19p13.3 pathogenic
ELANE, IVS4DS, G-A, +5 single nucleotide variant Cyclical neutropenia [RCV000018226] Chr19:19p13.3 pathogenic
NM_001972.4(ELANE):c.416C>T (p.Pro139Leu) single nucleotide variant Cyclical neutropenia [RCV001794456]|Neutropenia, severe congenital, 1, autosomal dominant [RCV000018227]|not provided [RCV000220001] Chr19:855613 [GRCh38]
Chr19:855613 [GRCh37]
Chr19:19p13.3
pathogenic|likely pathogenic
NM_001972.4(ELANE):c.214G>A (p.Val72Met) single nucleotide variant Neutropenia, severe congenital, 1, autosomal dominant [RCV000018228] Chr19:853022 [GRCh38]
Chr19:853022 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.377C>T (p.Ser126Leu) single nucleotide variant Cyclical neutropenia [RCV000990116]|Cyclical neutropenia [RCV001794457]|Neutropenia, severe congenital, 1, autosomal dominant [RCV000018229]|not specified [RCV000508432] Chr19:855574 [GRCh38]
Chr19:855574 [GRCh37]
Chr19:19p13.3
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity
NM_001972.4(ELANE):c.211T>C (p.Cys71Arg) single nucleotide variant Neutropenia, severe congenital, 1, autosomal dominant [RCV000018230] Chr19:853019 [GRCh38]
Chr19:853019 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.640G>A (p.Gly214Arg) single nucleotide variant Cyclical neutropenia [RCV001336413]|Cyclical neutropenia [RCV001851904]|Neutropenia, severe congenital, 1, autosomal dominant [RCV000018232]|not provided [RCV000214338] Chr19:856000 [GRCh38]
Chr19:856000 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.16C>A (p.Arg6=) single nucleotide variant Autoinflammatory syndrome [RCV002263779]|Cyclical neutropenia [RCV001796110]|not provided [RCV001724050] Chr19:852344 [GRCh38]
Chr19:852344 [GRCh37]
Chr19:19p13.3
benign|likely benign
GRCh38/hg38 19p13.3(chr19:259395-2555149)x3 copy number gain See cases [RCV000051044] Chr19:259395..2555149 [GRCh38]
Chr19:259395..2555147 [GRCh37]
Chr19:210395..2506147 [NCBI36]
Chr19:19p13.3
pathogenic
GRCh38/hg38 19p13.3(chr19:591812-1358152)x3 copy number gain See cases [RCV000052877] Chr19:591812..1358152 [GRCh38]
Chr19:591812..1358151 [GRCh37]
Chr19:542812..1309151 [NCBI36]
Chr19:19p13.3
pathogenic
GRCh38/hg38 19p13.3(chr19:259395-1952650)x3 copy number gain See cases [RCV000052875] Chr19:259395..1952650 [GRCh38]
Chr19:259395..1952649 [GRCh37]
Chr19:210395..1903649 [NCBI36]
Chr19:19p13.3
pathogenic
GRCh38/hg38 19p13.3-13.2(chr19:265917-8564134)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052876]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052876]|See cases [RCV000052876] Chr19:265917..8564134 [GRCh38]
Chr19:265917..8629018 [GRCh37]
Chr19:216917..8535018 [NCBI36]
Chr19:19p13.3-13.2
pathogenic
GRCh38/hg38 19p13.3(chr19:233565-4699472)x3 copy number gain See cases [RCV000052575] Chr19:233565..4699472 [GRCh38]
Chr19:233565..4699484 [GRCh37]
Chr19:184565..4650484 [NCBI36]
Chr19:19p13.3
pathogenic
GRCh38/hg38 19p13.3(chr19:677680-899104)x3 copy number gain See cases [RCV000054105] Chr19:677680..899104 [GRCh38]
Chr19:677680..899104 [GRCh37]
Chr19:628680..850104 [NCBI36]
Chr19:19p13.3
uncertain significance
GRCh38/hg38 19p13.3(chr19:266117-1076399)x1 copy number loss Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053911]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053911]|See cases [RCV000053911] Chr19:266117..1076399 [GRCh38]
Chr19:266117..1076398 [GRCh37]
Chr19:217117..1027398 [NCBI36]
Chr19:19p13.3
pathogenic
GRCh38/hg38 19p13.3(chr19:259195-1351363)x1 copy number loss See cases [RCV000053910] Chr19:259195..1351363 [GRCh38]
Chr19:259195..1351362 [GRCh37]
Chr19:210195..1302362 [NCBI36]
Chr19:19p13.3
pathogenic
NM_001972.3(ELANE):c.-41C>A single nucleotide variant Cyclical neutropenia [RCV001795234]|not provided [RCV001812028]|not specified [RCV000124882] Chr19:852288 [GRCh38]
Chr19:852288 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.126C>T (p.Pro42=) single nucleotide variant not specified [RCV000124877] Chr19:852934 [GRCh38]
Chr19:852934 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.606C>A (p.Ser202=) single nucleotide variant Cyclical neutropenia [RCV001795230]|not provided [RCV001812026]|not specified [RCV000247387] Chr19:855966 [GRCh38]
Chr19:855966 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.606C>T (p.Ser202=) single nucleotide variant Autoinflammatory syndrome [RCV002262719]|Cyclical neutropenia [RCV001795231]|not specified [RCV000124879] Chr19:855966 [GRCh38]
Chr19:855966 [GRCh37]
Chr19:19p13.3
benign|likely benign|conflicting interpretations of pathogenicity
NM_001972.4(ELANE):c.655G>A (p.Val219Ile) single nucleotide variant Autoinflammatory syndrome [RCV002262720]|Cyclical neutropenia [RCV000990118]|Cyclical neutropenia [RCV001795232]|not provided [RCV001704049]|not specified [RCV000124880] Chr19:856015 [GRCh38]
Chr19:856015 [GRCh37]
Chr19:19p13.3
benign|likely benign|conflicting interpretations of pathogenicity
NM_001972.4(ELANE):c.785C>T (p.Pro262Leu) single nucleotide variant Autoinflammatory syndrome [RCV002262721]|Cyclical neutropenia [RCV001795233]|not provided [RCV001812027]|not specified [RCV000124881] Chr19:856145 [GRCh38]
Chr19:856145 [GRCh37]
Chr19:19p13.3
benign|likely benign|conflicting interpretations of pathogenicity
NM_001972.4(ELANE):c.556G>A (p.Val186Ile) single nucleotide variant Cyclical neutropenia [RCV001795476]|not provided [RCV000766904]|not specified [RCV000255381] Chr19:855753 [GRCh38]
Chr19:855753 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.52G>C (p.Ala18Pro) single nucleotide variant Cyclical neutropenia [RCV000190505] Chr19:852380 [GRCh38]
Chr19:852380 [GRCh37]
Chr19:19p13.3
likely pathogenic|uncertain significance
NM_001972.4(ELANE):c.561C>A (p.Cys187Ter) single nucleotide variant Neutropenia, severe congenital, 1, autosomal dominant [RCV000190507] Chr19:855758 [GRCh38]
Chr19:855758 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.661G>T (p.Gly221Ter) single nucleotide variant Cyclical neutropenia [RCV001796457] Chr19:856021 [GRCh38]
Chr19:856021 [GRCh37]
Chr19:19p13.3
uncertain significance
GRCh38/hg38 19p13.3(chr19:839492-995558)x1 copy number loss See cases [RCV000134491] Chr19:839492..995558 [GRCh38]
Chr19:839492..995557 [GRCh37]
Chr19:790492..946557 [NCBI36]
Chr19:19p13.3
pathogenic
GRCh38/hg38 19p13.3(chr19:421537-2897921)x3 copy number gain See cases [RCV000134894] Chr19:421537..2897921 [GRCh38]
Chr19:421537..2897919 [GRCh37]
Chr19:372537..2848919 [NCBI36]
Chr19:19p13.3
likely pathogenic
GRCh38/hg38 19p13.3(chr19:259395-2068507)x3 copy number gain See cases [RCV000135433] Chr19:259395..2068507 [GRCh38]
Chr19:259395..2068506 [GRCh37]
Chr19:210395..2019506 [NCBI36]
Chr19:19p13.3
pathogenic
GRCh38/hg38 19p13.3(chr19:786550-1297500)x1 copy number loss See cases [RCV000136733] Chr19:786550..1297500 [GRCh38]
Chr19:786550..1297499 [GRCh37]
Chr19:737550..1248499 [NCBI36]
Chr19:19p13.3
pathogenic
GRCh38/hg38 19p13.3(chr19:275925-1892276)x3 copy number gain See cases [RCV000141358] Chr19:275925..1892276 [GRCh38]
Chr19:275925..1892275 [GRCh37]
Chr19:226925..1843275 [NCBI36]
Chr19:19p13.3
pathogenic
GRCh38/hg38 19p13.3(chr19:259395-6795611)x3 copy number gain See cases [RCV000142627] Chr19:259395..6795611 [GRCh38]
Chr19:259395..6795622 [GRCh37]
Chr19:210395..6746622 [NCBI36]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.598-3C>G single nucleotide variant Cyclical neutropenia [RCV000157220] Chr19:855955 [GRCh38]
Chr19:855955 [GRCh37]
Chr19:19p13.3
likely pathogenic
GRCh37/hg19 19p13.3(chr19:823554-1206859)x3 copy number gain See cases [RCV000203438] Chr19:823554..1206859 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.174C>T (p.Thr58=) single nucleotide variant Autoinflammatory syndrome [RCV002263780]|Cyclical neutropenia [RCV001796111]|not provided [RCV001724051] Chr19:852982 [GRCh38]
Chr19:852982 [GRCh37]
Chr19:19p13.3
benign|likely benign
NM_001972.4(ELANE):c.235G>T (p.Ala79Ser) single nucleotide variant not provided [RCV000756070] Chr19:853272 [GRCh38]
Chr19:853272 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.598-1G>A single nucleotide variant X-linked severe congenital neutropenia [RCV000215566]|not provided [RCV000578634] Chr19:855957 [GRCh38]
Chr19:855957 [GRCh37]
Chr19:19p13.3
pathogenic|uncertain significance
NM_001972.4(ELANE):c.22G>A (p.Ala8Thr) single nucleotide variant Cyclical neutropenia [RCV001857779]|not provided [RCV000227588] Chr19:852350 [GRCh38]
Chr19:852350 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.431G>A (p.Arg144His) single nucleotide variant Cyclical neutropenia [RCV001795375]|not provided [RCV000228382] Chr19:855628 [GRCh38]
Chr19:855628 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.217G>A (p.Ala73Thr) single nucleotide variant Autoinflammatory syndrome [RCV002262840]|Cyclical neutropenia [RCV001795379]|not provided [RCV000229821] Chr19:853025 [GRCh38]
Chr19:853025 [GRCh37]
Chr19:19p13.3
likely pathogenic|uncertain significance
NM_001972.4(ELANE):c.23C>T (p.Ala8Val) single nucleotide variant not provided [RCV000230281] Chr19:852351 [GRCh38]
Chr19:852351 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.140T>C (p.Leu47Pro) single nucleotide variant Cyclical neutropenia [RCV001795378]|not provided [RCV000225846] Chr19:852948 [GRCh38]
Chr19:852948 [GRCh37]
Chr19:19p13.3
pathogenic|uncertain significance
NM_001972.4(ELANE):c.258_269dup (p.His87_Ser90dup) duplication not provided [RCV000226787] Chr19:853293..853294 [GRCh38]
Chr19:853293..853294 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.558C>A (p.Val186=) single nucleotide variant not provided [RCV000226863] Chr19:855755 [GRCh38]
Chr19:855755 [GRCh37]
Chr19:19p13.3
pathogenic|conflicting interpretations of pathogenicity|uncertain significance
NM_001972.4(ELANE):c.137C>A (p.Ser46Tyr) single nucleotide variant not provided [RCV000227061] Chr19:852945 [GRCh38]
Chr19:852945 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.578G>A (p.Arg193Gln) single nucleotide variant Cyclical neutropenia [RCV001795380]|not provided [RCV000227502] Chr19:855775 [GRCh38]
Chr19:855775 [GRCh37]
Chr19:19p13.3
pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_001972.4(ELANE):c.568G>A (p.Val190Met) single nucleotide variant Autoinflammatory syndrome [RCV002262842]|not provided [RCV000231022]|not specified [RCV001820785] Chr19:855765 [GRCh38]
Chr19:855765 [GRCh37]
Chr19:19p13.3
likely pathogenic|likely benign|uncertain significance
NM_001972.4(ELANE):c.212G>T (p.Cys71Phe) single nucleotide variant not provided [RCV000228283] Chr19:853020 [GRCh38]
Chr19:853020 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.605C>T (p.Ser202Phe) single nucleotide variant not provided [RCV000228433] Chr19:855965 [GRCh38]
Chr19:855965 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.452G>T (p.Cys151Phe) single nucleotide variant not provided [RCV000228921] Chr19:855649 [GRCh38]
Chr19:855649 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.502G>A (p.Val168Ile) single nucleotide variant not provided [RCV000231895] Chr19:855699 [GRCh38]
Chr19:855699 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.597+1G>A single nucleotide variant Cyclical neutropenia [RCV000018225]|Cyclical neutropenia [RCV001795376]|Neutropenia, severe congenital, 1, autosomal dominant [RCV001267759]|not provided [RCV000229570] Chr19:855795 [GRCh38]
Chr19:855795 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.275G>A (p.Arg92Gln) single nucleotide variant Autoinflammatory syndrome [RCV002262837]|Cyclical neutropenia [RCV001857780]|not provided [RCV000232115] Chr19:853312 [GRCh38]
Chr19:853312 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.437G>A (p.Gly146Asp) single nucleotide variant not provided [RCV000232361] Chr19:855634 [GRCh38]
Chr19:855634 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.427C>T (p.Arg143Cys) single nucleotide variant Autoinflammatory syndrome [RCV002262841]|Cyclical neutropenia [RCV001857782]|not provided [RCV000232534] Chr19:855624 [GRCh38]
Chr19:855624 [GRCh37]
Chr19:19p13.3
likely pathogenic|uncertain significance
NM_001972.4(ELANE):c.573G>C (p.Arg191Ser) single nucleotide variant not provided [RCV000232592] Chr19:855770 [GRCh38]
Chr19:855770 [GRCh37]
Chr19:19p13.3
likely pathogenic|uncertain significance
NM_001972.4(ELANE):c.746C>T (p.Ser249Phe) single nucleotide variant Autoinflammatory syndrome [RCV002262839]|Cyclical neutropenia [RCV001795377]|not provided [RCV001722269] Chr19:856106 [GRCh38]
Chr19:856106 [GRCh37]
Chr19:19p13.3
likely pathogenic|benign|likely benign|uncertain significance
NM_001972.4(ELANE):c.407C>T (p.Ala136Val) single nucleotide variant Cyclical neutropenia [RCV001857781]|not provided [RCV000233854] Chr19:855604 [GRCh38]
Chr19:855604 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.442G>A (p.Gly148Arg) single nucleotide variant Autoinflammatory syndrome [RCV002262838]|not specified [RCV000226068] Chr19:855639 [GRCh38]
Chr19:855639 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.77T>C (p.Leu26Pro) single nucleotide variant not provided [RCV000234442] Chr19:852885 [GRCh38]
Chr19:852885 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.336_359del (p.Asn113_Ile120del) deletion not provided [RCV000234597] Chr19:853372..853395 [GRCh38]
Chr19:853372..853395 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.597+20C>T single nucleotide variant not specified [RCV000235665] Chr19:855814 [GRCh38]
Chr19:855814 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.60G>A (p.Leu20=) single nucleotide variant not specified [RCV000236034] Chr19:852388 [GRCh38]
Chr19:852388 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.597+5G>A single nucleotide variant Cyclical neutropenia [RCV000018226]|Cyclical neutropenia [RCV001795382]|Neutropenia [RCV001003809]|not provided [RCV000236267] Chr19:855799 [GRCh38]
Chr19:855799 [GRCh37]
Chr19:19p13.3
pathogenic|likely pathogenic
NM_001972.4(ELANE):c.597+1G>C single nucleotide variant not provided [RCV000237098] Chr19:855795 [GRCh38]
Chr19:855795 [GRCh37]
Chr19:19p13.3
pathogenic
GRCh37/hg19 19p13.3(chr19:260912-1163934)x3 copy number gain See cases [RCV000239425] Chr19:260912..1163934 [GRCh37]
Chr19:19p13.3
pathogenic
NC_000019.9:g.(?_852323)_(1207208_?)dup duplication Peutz-Jeghers syndrome [RCV000527991] Chr19:852323..1207208 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.171C>T (p.Ala57=) single nucleotide variant Cyclical neutropenia [RCV001795445]|not provided [RCV000644045]|not specified [RCV000251221] Chr19:852979 [GRCh38]
Chr19:852979 [GRCh37]
Chr19:19p13.3
benign|likely benign
NM_001972.4(ELANE):c.742C>T (p.Arg248Cys) single nucleotide variant not specified [RCV000251857] Chr19:856102 [GRCh38]
Chr19:856102 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.99C>T (p.Gly33=) single nucleotide variant Autoinflammatory syndrome [RCV002262879]|Cyclical neutropenia [RCV001795449]|not provided [RCV001723848]|not specified [RCV000252023] Chr19:852907 [GRCh38]
Chr19:852907 [GRCh37]
Chr19:19p13.3
benign|likely benign
NM_001972.4(ELANE):c.628G>A (p.Gly210Arg) single nucleotide variant not provided [RCV000255959] Chr19:855988 [GRCh38]
Chr19:855988 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.390C>T (p.Asn130=) single nucleotide variant Autoinflammatory syndrome [RCV002262876]|Cyclical neutropenia [RCV001795446]|not provided [RCV001723847]|not specified [RCV000242403] Chr19:855587 [GRCh38]
Chr19:855587 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.654C>T (p.Phe218=) single nucleotide variant Autoinflammatory syndrome [RCV002262877]|Cyclical neutropenia [RCV001795447]|not provided [RCV001651162]|not specified [RCV000242718] Chr19:856014 [GRCh38]
Chr19:856014 [GRCh37]
Chr19:19p13.3
benign|likely benign
NM_001972.4(ELANE):c.770C>T (p.Pro257Leu) single nucleotide variant Autoinflammatory syndrome [RCV002262878]|Cyclical neutropenia [RCV001795448]|not provided [RCV000444348]|not specified [RCV000243329] Chr19:856130 [GRCh38]
Chr19:856130 [GRCh37]
Chr19:19p13.3
benign|likely benign|conflicting interpretations of pathogenicity
GRCh37/hg19 19p13.3(chr19:277373-2555164)x3 copy number gain See cases [RCV000240507] Chr19:277373..2555164 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.290A>C (p.Gln97Pro) single nucleotide variant not provided [RCV000489490] Chr19:853327 [GRCh38]
Chr19:853327 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.2T>C (p.Met1Thr) single nucleotide variant not provided [RCV001269610] Chr19:852330 [GRCh38]
Chr19:852330 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.265C>T (p.Leu89Phe) single nucleotide variant Cyclical neutropenia [RCV001865511]|not provided [RCV000489799] Chr19:853302 [GRCh38]
Chr19:853302 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.137C>T (p.Ser46Phe) single nucleotide variant Cyclical neutropenia [RCV001865281]|not provided [RCV000413867] Chr19:852945 [GRCh38]
Chr19:852945 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.2(ELANE):c.600_601dupGG duplication not provided [RCV000413923] Chr19:855956..855957 [GRCh38]
Chr19:855956..855957 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.*15G>T single nucleotide variant not specified [RCV000418532] Chr19:856179 [GRCh38]
Chr19:856179 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.170C>T (p.Ala57Val) single nucleotide variant not provided [RCV000429848] Chr19:852978 [GRCh38]
Chr19:852978 [GRCh37]
Chr19:19p13.3
pathogenic|likely pathogenic
NM_001972.4(ELANE):c.581_582inv (p.Gln194Pro) inversion not provided [RCV000483486] Chr19:855778..855779 [GRCh38]
Chr19:855778..855779 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.251T>C (p.Leu84Pro) single nucleotide variant Cyclical neutropenia [RCV001796069]|not provided [RCV000482349] Chr19:853288 [GRCh38]
Chr19:853288 [GRCh37]
Chr19:19p13.3
likely pathogenic|uncertain significance
NM_001972.4(ELANE):c.456G>A (p.Leu152=) single nucleotide variant Cyclical neutropenia [RCV001796070]|not provided [RCV000766906]|not specified [RCV000485469] Chr19:855653 [GRCh38]
Chr19:855653 [GRCh37]
Chr19:19p13.3
likely benign|uncertain significance
NM_001972.4(ELANE):c.490G>C (p.Gly164Arg) single nucleotide variant Autoinflammatory syndrome [RCV002263725]|Cyclical neutropenia [RCV001796093]|not provided [RCV000523047] Chr19:855687 [GRCh38]
Chr19:855687 [GRCh37]
Chr19:19p13.3
likely benign|uncertain significance
NM_001972.4(ELANE):c.308G>T (p.Arg103Leu) single nucleotide variant not provided [RCV000478914] Chr19:853345 [GRCh38]
Chr19:853345 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.627C>T (p.Asn209=) single nucleotide variant Cyclical neutropenia [RCV001796077]|not provided [RCV001722425]|not specified [RCV000501474] Chr19:855987 [GRCh38]
Chr19:855987 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.375G>A (p.Gly125=) single nucleotide variant Cyclical neutropenia [RCV001796079]|not provided [RCV000868380]|not specified [RCV000503923] Chr19:855572 [GRCh38]
Chr19:855572 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.68-12G>T single nucleotide variant not specified [RCV000499469] Chr19:852864 [GRCh38]
Chr19:852864 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.338A>T (p.Asn113Ile) single nucleotide variant not specified [RCV000500242] Chr19:853375 [GRCh38]
Chr19:853375 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.21C>T (p.Leu7=) single nucleotide variant Cyclical neutropenia [RCV001796078]|not provided [RCV001697006]|not specified [RCV000502498] Chr19:852349 [GRCh38]
Chr19:852349 [GRCh37]
Chr19:19p13.3
benign|likely benign
NM_001972.4(ELANE):c.305A>C (p.Gln102Pro) single nucleotide variant not provided [RCV000498633] Chr19:853342 [GRCh38]
Chr19:853342 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.472C>G (p.Leu158Val) single nucleotide variant not provided [RCV000493766] Chr19:855669 [GRCh38]
Chr19:855669 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.358A>T (p.Ile120Phe) single nucleotide variant not provided [RCV000493833] Chr19:853395 [GRCh38]
Chr19:853395 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.241C>T (p.Arg81Trp) single nucleotide variant not provided [RCV000493843] Chr19:853278 [GRCh38]
Chr19:853278 [GRCh37]
Chr19:19p13.3
uncertain significance
GRCh37/hg19 19p13.3(chr19:260911-1965786)x3 copy number gain See cases [RCV000511452] Chr19:260911..1965786 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.641G>T (p.Gly214Val) single nucleotide variant not specified [RCV000508068] Chr19:856001 [GRCh38]
Chr19:856001 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.157C>T (p.His53Tyr) single nucleotide variant not provided [RCV000493329] Chr19:852965 [GRCh38]
Chr19:852965 [GRCh37]
Chr19:19p13.3
likely pathogenic
GRCh37/hg19 19p13.3(chr19:415092-715725)x3 copy number gain See cases [RCV000511102] Chr19:415092..715725 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.428G>A (p.Arg143His) single nucleotide variant Autoinflammatory syndrome [RCV002263830]|Cyclical neutropenia [RCV001796138]|not provided [RCV001719050]|not specified [RCV001821747] Chr19:855625 [GRCh38]
Chr19:855625 [GRCh37]
Chr19:19p13.3
likely benign|uncertain significance
NM_001972.4(ELANE):c.784C>T (p.Pro262Ser) single nucleotide variant Cyclical neutropenia [RCV001796155]|not provided [RCV000644037] Chr19:856144 [GRCh38]
Chr19:856144 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.235G>C (p.Ala79Pro) single nucleotide variant Cyclical neutropenia [RCV001796161] Chr19:853272 [GRCh38]
Chr19:853272 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.378G>A (p.Ser126=) single nucleotide variant Cyclical neutropenia [RCV001796156] Chr19:855575 [GRCh38]
Chr19:855575 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.452G>A (p.Cys151Tyr) single nucleotide variant Cyclical neutropenia [RCV001796160]|Neutropenia, severe congenital, 1, autosomal dominant [RCV001332066] Chr19:855649 [GRCh38]
Chr19:855649 [GRCh37]
Chr19:19p13.3
pathogenic
GRCh37/hg19 19p13.3-q13.43(chr19:260912-58956888)x3 copy number gain See cases [RCV000511289] Chr19:260912..58956888 [GRCh37]
Chr19:19p13.3-q13.43
pathogenic|uncertain significance
NM_001972.4(ELANE):c.68-13G>A single nucleotide variant Cyclical neutropenia [RCV001868057]|not specified [RCV000615499] Chr19:852863 [GRCh38]
Chr19:852863 [GRCh37]
Chr19:19p13.3
likely benign|uncertain significance
NM_001972.4(ELANE):c.519C>T (p.Asn173=) single nucleotide variant Cyclical neutropenia [RCV001796137]|not specified [RCV000600722] Chr19:855716 [GRCh38]
Chr19:855716 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.367-16G>A single nucleotide variant not specified [RCV000610464] Chr19:855548 [GRCh38]
Chr19:855548 [GRCh37]
Chr19:19p13.3
likely benign
GRCh37/hg19 19p13.3-q13.43(chr19:260912-58956888) copy number gain See cases [RCV000512296] Chr19:260912..58956888 [GRCh37]
Chr19:19p13.3-q13.43
pathogenic
NM_001972.4(ELANE):c.36C>A (p.Leu12=) single nucleotide variant Cyclical neutropenia [RCV001868040]|not specified [RCV000608667] Chr19:852364 [GRCh38]
Chr19:852364 [GRCh37]
Chr19:19p13.3
likely benign|uncertain significance
NM_001972.4(ELANE):c.268T>C (p.Ser90Pro) single nucleotide variant not specified [RCV000611383] Chr19:853305 [GRCh38]
Chr19:853305 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.119C>T (p.Ala40Val) single nucleotide variant Cyclical neutropenia [RCV001796109] Chr19:852927 [GRCh38]
Chr19:852927 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.597+10C>G single nucleotide variant Autoinflammatory syndrome [RCV002263822]|Cyclical neutropenia [RCV001796135]|not provided [RCV001722602] Chr19:855804 [GRCh38]
Chr19:855804 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.172A>C (p.Thr58Pro) single nucleotide variant Cyclical neutropenia [RCV001796157] Chr19:852980 [GRCh38]
Chr19:852980 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.38C>G (p.Ala13Gly) single nucleotide variant Cyclical neutropenia [RCV001796158] Chr19:852366 [GRCh38]
Chr19:852366 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.665G>A (p.Gly222Asp) single nucleotide variant Cyclical neutropenia [RCV001796159] Chr19:856025 [GRCh38]
Chr19:856025 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.24G>C (p.Ala8=) single nucleotide variant Cyclical neutropenia [RCV001796162] Chr19:852352 [GRCh38]
Chr19:852352 [GRCh37]
Chr19:19p13.3
likely benign
GRCh37/hg19 19p13.3(chr19:266117-1094614)x3 copy number gain not provided [RCV000513059] Chr19:266117..1094614 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.614C>G (p.Pro205Arg) single nucleotide variant not provided [RCV000585894] Chr19:855974 [GRCh38]
Chr19:855974 [GRCh37]
Chr19:19p13.3
likely pathogenic
GRCh37/hg19 19p13.3(chr19:259395-3152419) copy number gain Global developmental delay [RCV000626520] Chr19:259395..3152419 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.136_141del (p.Ser46_Leu47del) deletion not provided [RCV000658809] Chr19:852942..852947 [GRCh38]
Chr19:852942..852947 [GRCh37]
Chr19:19p13.3
likely pathogenic
GRCh37/hg19 19p13.3(chr19:715724-1438636)x3 copy number gain not provided [RCV000684086] Chr19:715724..1438636 [GRCh37]
Chr19:19p13.3
uncertain significance
GRCh37/hg19 19p13.3(chr19:260911-3200875)x3 copy number gain not provided [RCV000684094] Chr19:260911..3200875 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.10G>A (p.Gly4Ser) single nucleotide variant Cyclical neutropenia [RCV001796187]|Neutropenia, severe congenital, 1, autosomal dominant [RCV001332065] Chr19:852338 [GRCh38]
Chr19:852338 [GRCh37]
Chr19:19p13.3
uncertain significance
NC_000019.9:g.(?_852323)_(1222011_?)del deletion Peutz-Jeghers syndrome [RCV000708465] Chr19:852323..1222011 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.364C>T (p.Gln122Ter) single nucleotide variant Cyclical neutropenia [RCV001796179] Chr19:853401 [GRCh38]
Chr19:853401 [GRCh37]
Chr19:19p13.3
pathogenic|uncertain significance
NM_001972.4(ELANE):c.419C>T (p.Ala140Val) single nucleotide variant Cyclical neutropenia [RCV001796181] Chr19:855616 [GRCh38]
Chr19:855616 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.12CCG[3] (p.Arg6dup) microsatellite Cyclical neutropenia [RCV001796183] Chr19:852338..852339 [GRCh38]
Chr19:852338..852339 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.748G>A (p.Glu250Lys) single nucleotide variant Cyclical neutropenia [RCV001796184] Chr19:856108 [GRCh38]
Chr19:856108 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.342G>T (p.Leu114Phe) single nucleotide variant Cyclical neutropenia [RCV001796188] Chr19:853379 [GRCh38]
Chr19:853379 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.647C>T (p.Ala216Val) single nucleotide variant Cyclical neutropenia [RCV001796192] Chr19:856007 [GRCh38]
Chr19:856007 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.637C>T (p.His213Tyr) single nucleotide variant Cyclical neutropenia [RCV001796194] Chr19:855997 [GRCh38]
Chr19:855997 [GRCh37]
Chr19:19p13.3
uncertain significance
NC_000019.9:g.(?_852319)_(1226656_?)dup duplication Peutz-Jeghers syndrome [RCV000707897] Chr19:852319..1226656 [GRCh37]
Chr19:19p13.3
uncertain significance
NC_000019.9:g.(?_852323)_(1226652_?)del deletion Peutz-Jeghers syndrome [RCV000708221] Chr19:852323..1226652 [GRCh37]
Chr19:19p13.3
pathogenic
GRCh37/hg19 19p13.3-q13.43(chr19:68029-59110290)x3 copy number gain not provided [RCV000752439] Chr19:68029..59110290 [GRCh37]
Chr19:19p13.3-q13.43
pathogenic
GRCh37/hg19 19p13.3(chr19:789890-859214)x3 copy number gain not provided [RCV000739945] Chr19:789890..859214 [GRCh37]
Chr19:19p13.3
benign
GRCh37/hg19 19p13.3-q13.43(chr19:260912-59097160)x3 copy number gain not provided [RCV000752444] Chr19:260912..59097160 [GRCh37]
Chr19:19p13.3-q13.43
pathogenic
Single allele single nucleotide variant not provided [RCV001645786] Chr19:852238 [GRCh38]
Chr19:852238 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.533C>A (p.Thr178Lys) single nucleotide variant not provided [RCV001812441] Chr19:855730 [GRCh38]
Chr19:855730 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.368T>C (p.Leu123Pro) single nucleotide variant Neutropenia, severe congenital, 1, autosomal dominant [RCV001594428] Chr19:855565 [GRCh38]
Chr19:855565 [GRCh37]
Chr19:19p13.3
likely pathogenic
Single allele single nucleotide variant not provided [RCV001645244] Chr19:852234 [GRCh38]
Chr19:852234 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.67+199A>G single nucleotide variant not provided [RCV001725552] Chr19:852594 [GRCh38]
Chr19:852594 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.67+209_67+210del deletion not provided [RCV001725556] Chr19:852595..852596 [GRCh38]
Chr19:852595..852596 [GRCh37]
Chr19:19p13.3
benign
GRCh37/hg19 19p13.3(chr19:423160-1429367)x3 copy number gain not provided [RCV000752449] Chr19:423160..1429367 [GRCh37]
Chr19:19p13.3
uncertain significance
GRCh37/hg19 19p13.3(chr19:789890-880080)x3 copy number gain not provided [RCV000752464] Chr19:789890..880080 [GRCh37]
Chr19:19p13.3
benign
GRCh37/hg19 19p13.3(chr19:789890-941603)x3 copy number gain not provided [RCV000752465] Chr19:789890..941603 [GRCh37]
Chr19:19p13.3
benign
GRCh37/hg19 19p13.3(chr19:801381-945710)x3 copy number gain not provided [RCV000752467] Chr19:801381..945710 [GRCh37]
Chr19:19p13.3
benign
GRCh37/hg19 19p13.3(chr19:801381-1008645)x3 copy number gain not provided [RCV000752468] Chr19:801381..1008645 [GRCh37]
Chr19:19p13.3
benign
GRCh37/hg19 19p13.3(chr19:804080-879947)x3 copy number gain not provided [RCV000752469] Chr19:804080..879947 [GRCh37]
Chr19:19p13.3
benign
GRCh37/hg19 19p13.3(chr19:804908-931523)x3 copy number gain not provided [RCV000752470] Chr19:804908..931523 [GRCh37]
Chr19:19p13.3
benign
GRCh37/hg19 19p13.3(chr19:804908-1008216)x3 copy number gain not provided [RCV000752471] Chr19:804908..1008216 [GRCh37]
Chr19:19p13.3
benign
GRCh37/hg19 19p13.3(chr19:839158-857215)x1 copy number loss not provided [RCV000752472] Chr19:839158..857215 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.67+210dup duplication not provided [RCV001724879] Chr19:852594..852595 [GRCh38]
Chr19:852594..852595 [GRCh37]
Chr19:19p13.3
benign
Single allele microsatellite not provided [RCV001681645] Chr19:856430..856431 [GRCh38]
Chr19:856430..856431 [GRCh37]
Chr19:19p13.3
benign
Single allele single nucleotide variant not provided [RCV001725008] Chr19:852285 [GRCh38]
Chr19:852285 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.68-19G>A single nucleotide variant not provided [RCV001725014] Chr19:852857 [GRCh38]
Chr19:852857 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.396C>T (p.Asn132=) single nucleotide variant not provided [RCV000867603] Chr19:855593 [GRCh38]
Chr19:855593 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.687C>T (p.Pro229=) single nucleotide variant Cyclical neutropenia [RCV001796289]|not provided [RCV001536401] Chr19:856047 [GRCh38]
Chr19:856047 [GRCh37]
Chr19:19p13.3
benign|likely benign
NM_001972.4(ELANE):c.630G>A (p.Gly210=) single nucleotide variant not provided [RCV000899740] Chr19:855990 [GRCh38]
Chr19:855990 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.372C>T (p.Asn124=) single nucleotide variant Cyclical neutropenia [RCV001796284]|not provided [RCV000867175] Chr19:855569 [GRCh38]
Chr19:855569 [GRCh37]
Chr19:19p13.3
benign|likely benign
NM_001972.4(ELANE):c.659G>C (p.Arg220Pro) single nucleotide variant Cyclical neutropenia [RCV001796359] Chr19:856019 [GRCh38]
Chr19:856019 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.301G>A (p.Val101Met) single nucleotide variant Cyclical neutropenia [RCV001796353] Chr19:853338 [GRCh38]
Chr19:853338 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.634A>G (p.Ile212Val) single nucleotide variant Cyclical neutropenia [RCV001796360] Chr19:855994 [GRCh38]
Chr19:855994 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.702G>A (p.Pro234=) single nucleotide variant Cyclical neutropenia [RCV001796261]|not provided [RCV000827715] Chr19:856062 [GRCh38]
Chr19:856062 [GRCh37]
Chr19:19p13.3
likely benign|uncertain significance
NM_001972.4(ELANE):c.380C>T (p.Ala127Val) single nucleotide variant Cyclical neutropenia [RCV001796290] Chr19:855577 [GRCh38]
Chr19:855577 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.9C>T (p.Leu3=) single nucleotide variant Cyclical neutropenia [RCV001796294]|not provided [RCV000875842] Chr19:852337 [GRCh38]
Chr19:852337 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.363C>G (p.Leu121=) single nucleotide variant not provided [RCV000917451] Chr19:853400 [GRCh38]
Chr19:853400 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.380CCA[1] (p.Thr128del) microsatellite Cyclical neutropenia [RCV001796232] Chr19:855577..855579 [GRCh38]
Chr19:855577..855579 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.347A>G (p.Asn116Ser) single nucleotide variant Cyclical neutropenia [RCV001796228]|not provided [RCV001509002] Chr19:853384 [GRCh38]
Chr19:853384 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.430C>T (p.Arg144Cys) single nucleotide variant Cyclical neutropenia [RCV001796242] Chr19:855627 [GRCh38]
Chr19:855627 [GRCh37]
Chr19:19p13.3
uncertain significance
NC_000019.9:g.(?_855938)_(856184_?)dup duplication Cyclical neutropenia [RCV001796226] Chr19:855938..856184 [GRCh38]
Chr19:855938..856184 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.2(ELANE):c.-162C>T single nucleotide variant not provided [RCV000838008] Chr19:852167 [GRCh38]
Chr19:852167 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.2(ELANE):c.-225C>A single nucleotide variant not provided [RCV000836576] Chr19:852104 [GRCh38]
Chr19:852104 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.366+192G>T single nucleotide variant not provided [RCV000836801] Chr19:853595 [GRCh38]
Chr19:853595 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.67+1G>T single nucleotide variant Cyclical neutropenia [RCV001796219] Chr19:852396 [GRCh38]
Chr19:852396 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.298G>A (p.Ala100Thr) single nucleotide variant Cyclical neutropenia [RCV001796252] Chr19:853335 [GRCh38]
Chr19:853335 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.493A>G (p.Ile165Val) single nucleotide variant Cyclical neutropenia [RCV001796256] Chr19:855690 [GRCh38]
Chr19:855690 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.133G>T (p.Val45Leu) single nucleotide variant not provided [RCV000788897] Chr19:852941 [GRCh38]
Chr19:852941 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.333C>G (p.Pro111=) single nucleotide variant Cyclical neutropenia [RCV001796216]|not provided [RCV000788909] Chr19:853370 [GRCh38]
Chr19:853370 [GRCh37]
Chr19:19p13.3
likely benign|uncertain significance
NM_001972.4(ELANE):c.70A>C (p.Thr24Pro) single nucleotide variant Cyclical neutropenia [RCV001796245] Chr19:852878 [GRCh38]
Chr19:852878 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.367-1G>C single nucleotide variant Cyclical neutropenia [RCV001796218] Chr19:855563 [GRCh38]
Chr19:855563 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.64G>C (p.Gly22Arg) single nucleotide variant Cyclical neutropenia [RCV001796257] Chr19:852392 [GRCh38]
Chr19:852392 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.2(ELANE):c.-353G>A single nucleotide variant not provided [RCV000826592] Chr19:851976 [GRCh38]
Chr19:851976 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.353T>A (p.Ile118Asn) single nucleotide variant Cyclical neutropenia [RCV001796236] Chr19:853390 [GRCh38]
Chr19:853390 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.589G>A (p.Val197Ile) single nucleotide variant Cyclical neutropenia [RCV001796229] Chr19:855786 [GRCh38]
Chr19:855786 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.68-107_68-85del microsatellite not provided [RCV000829572] Chr19:852731..852753 [GRCh38]
Chr19:852731..852753 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.14G>A (p.Arg5His) single nucleotide variant Cyclical neutropenia [RCV001796251] Chr19:852342 [GRCh38]
Chr19:852342 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.262A>G (p.Asn88Asp) single nucleotide variant Cyclical neutropenia [RCV001796349] Chr19:853299 [GRCh38]
Chr19:853299 [GRCh37]
Chr19:19p13.3
uncertain significance
GRCh37/hg19 19p13.3(chr19:260911-3501271)x3 copy number gain not provided [RCV001007025] Chr19:260911..3501271 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.39C>G (p.Ala13=) single nucleotide variant Cyclical neutropenia [RCV001796239] Chr19:852367 [GRCh38]
Chr19:852367 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.256G>T (p.Ala86Ser) single nucleotide variant Cyclical neutropenia [RCV001796230] Chr19:853293 [GRCh38]
Chr19:853293 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.567C>G (p.Leu189=) single nucleotide variant Cyclical neutropenia [RCV001796225] Chr19:855764 [GRCh38]
Chr19:855764 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.727G>T (p.Asp243Tyr) single nucleotide variant Cyclical neutropenia [RCV001796235] Chr19:856087 [GRCh38]
Chr19:856087 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.292G>A (p.Val98Met) single nucleotide variant Cyclical neutropenia [RCV001796254] Chr19:853329 [GRCh38]
Chr19:853329 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.778C>A (p.Pro260Thr) single nucleotide variant Autoinflammatory syndrome [RCV002264025]|Cyclical neutropenia [RCV001796260]|not provided [RCV000827714] Chr19:856138 [GRCh38]
Chr19:856138 [GRCh37]
Chr19:19p13.3
likely benign|uncertain significance
NM_001972.4(ELANE):c.308G>C (p.Arg103Pro) single nucleotide variant Cyclical neutropenia [RCV001796350] Chr19:853345 [GRCh38]
Chr19:853345 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.418G>A (p.Ala140Thr) single nucleotide variant not provided [RCV000996709] Chr19:855615 [GRCh38]
Chr19:855615 [GRCh37]
Chr19:19p13.3
uncertain significance
NC_000019.9:g.(?_589926)_(1401495_?)dup duplication Cerebral creatine deficiency syndrome [RCV001032652] Chr19:589926..1401495 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.618G>C (p.Leu206Phe) single nucleotide variant Cyclical neutropenia [RCV000990117] Chr19:855978 [GRCh38]
Chr19:855978 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.669C>A (p.Cys223Ter) single nucleotide variant Cyclical neutropenia [RCV000990119]|Cyclical neutropenia [RCV001858720] Chr19:856029 [GRCh38]
Chr19:856029 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.354C>G (p.Ile118Met) single nucleotide variant Cyclical neutropenia [RCV001796400] Chr19:853391 [GRCh38]
Chr19:853391 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.163_165del (p.Cys55del) deletion Cyclical neutropenia [RCV001796383] Chr19:852970..852972 [GRCh38]
Chr19:852970..852972 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.487C>A (p.Arg163Ser) single nucleotide variant Cyclical neutropenia [RCV001796401] Chr19:855684 [GRCh38]
Chr19:855684 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.607G>C (p.Gly203Arg) single nucleotide variant Cyclical neutropenia [RCV001796389]|Neutropenia, severe congenital, 1, autosomal dominant [RCV001824168] Chr19:855967 [GRCh38]
Chr19:855967 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.652T>C (p.Phe218Leu) single nucleotide variant Cyclical neutropenia [RCV001796390] Chr19:856012 [GRCh38]
Chr19:856012 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.467G>C (p.Trp156Ser) single nucleotide variant Cyclical neutropenia [RCV001796395] Chr19:855664 [GRCh38]
Chr19:855664 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.658C>T (p.Arg220Trp) single nucleotide variant Cyclical neutropenia [RCV001796405] Chr19:856018 [GRCh38]
Chr19:856018 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.505C>A (p.Leu169Met) single nucleotide variant Cyclical neutropenia [RCV001796392] Chr19:855702 [GRCh38]
Chr19:855702 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.372C>A (p.Asn124Lys) single nucleotide variant Cyclical neutropenia [RCV001796409] Chr19:855569 [GRCh38]
Chr19:855569 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.269C>T (p.Ser90Leu) single nucleotide variant Cyclical neutropenia [RCV001796388] Chr19:853306 [GRCh38]
Chr19:853306 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.136T>C (p.Ser46Pro) single nucleotide variant Cyclical neutropenia [RCV001796396] Chr19:852944 [GRCh38]
Chr19:852944 [GRCh37]
Chr19:19p13.3
likely pathogenic
GRCh37/hg19 19p13.3(chr19:260911-4788357)x3 copy number gain not provided [RCV000846988] Chr19:260911..4788357 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.511G>A (p.Glu171Lys) single nucleotide variant Cyclical neutropenia [RCV001796399] Chr19:855708 [GRCh38]
Chr19:855708 [GRCh37]
Chr19:19p13.3
uncertain significance
Single allele single nucleotide variant not provided [RCV001567659] Chr19:856422 [GRCh38]
Chr19:856422 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.-11C>T single nucleotide variant not provided [RCV001725003] Chr19:852318 [GRCh38]
Chr19:852318 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.204C>T (p.Ala68=) single nucleotide variant not provided [RCV001619156] Chr19:853012 [GRCh38]
Chr19:853012 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.519C>A (p.Asn173Lys) single nucleotide variant not provided [RCV001672234] Chr19:855716 [GRCh38]
Chr19:855716 [GRCh37]
Chr19:19p13.3
benign
Single allele single nucleotide variant not provided [RCV001639451] Chr19:852288 [GRCh38]
Chr19:852288 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.68-15C>A single nucleotide variant Cyclical neutropenia [RCV002073191]|not provided [RCV001680047] Chr19:852861 [GRCh38]
Chr19:852861 [GRCh37]
Chr19:19p13.3
benign
Single allele single nucleotide variant not provided [RCV001685043] Chr19:852044 [GRCh38]
Chr19:852044 [GRCh37]
Chr19:19p13.3
benign
Single allele single nucleotide variant not provided [RCV001685743] Chr19:852287 [GRCh38]
Chr19:852287 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.68-145GATCCCGTGGGTTCCCGGTGGGG[3] microsatellite not provided [RCV001589650] Chr19:852730..852731 [GRCh38]
Chr19:852730..852731 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.68-64C>T single nucleotide variant not provided [RCV001652851] Chr19:852812 [GRCh38]
Chr19:852812 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.366+135C>T single nucleotide variant not provided [RCV001673604] Chr19:853538 [GRCh38]
Chr19:853538 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.*40C>G single nucleotide variant not provided [RCV001595176] Chr19:856204 [GRCh38]
Chr19:856204 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.524C>T (p.Thr175Met) single nucleotide variant Autoinflammatory syndrome [RCV002264027]|Cyclical neutropenia [RCV001796283]|not provided [RCV001597224] Chr19:855721 [GRCh38]
Chr19:855721 [GRCh37]
Chr19:19p13.3
likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_001972.4(ELANE):c.752A>C (p.Asp251Ala) single nucleotide variant Cyclical neutropenia [RCV001796394] Chr19:856112 [GRCh38]
Chr19:856112 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.623G>T (p.Cys208Phe) single nucleotide variant Cyclical neutropenia [RCV001796402] Chr19:855983 [GRCh38]
Chr19:855983 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.662G>T (p.Gly221Val) single nucleotide variant Cyclical neutropenia [RCV001796407] Chr19:856022 [GRCh38]
Chr19:856022 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.23C>G (p.Ala8Gly) single nucleotide variant Cyclical neutropenia [RCV001796411] Chr19:852351 [GRCh38]
Chr19:852351 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.598-4A>G single nucleotide variant not provided [RCV000935062] Chr19:855954 [GRCh38]
Chr19:855954 [GRCh37]
Chr19:19p13.3
likely benign
Single allele single nucleotide variant not provided [RCV001577984] Chr19:856301 [GRCh38]
Chr19:856301 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.284C>G (p.Thr95Ser) single nucleotide variant Neutropenia, severe congenital, 1, autosomal dominant [RCV002250874] Chr19:853321 [GRCh38]
Chr19:853321 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.366+12C>A single nucleotide variant Cyclical neutropenia [RCV002073381]|not provided [RCV001723231]|not specified [RCV001821966] Chr19:853415 [GRCh38]
Chr19:853415 [GRCh37]
Chr19:19p13.3
benign|likely benign
NM_001972.4(ELANE):c.68-84T>C single nucleotide variant not provided [RCV001654809] Chr19:852792 [GRCh38]
Chr19:852792 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.63G>T (p.Leu21=) single nucleotide variant Cyclical neutropenia [RCV002073028]|not provided [RCV001657635] Chr19:852391 [GRCh38]
Chr19:852391 [GRCh37]
Chr19:19p13.3
benign|likely benign
NM_001972.4(ELANE):c.366+66G>C single nucleotide variant not provided [RCV001723228] Chr19:853469 [GRCh38]
Chr19:853469 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.224+31C>G single nucleotide variant not provided [RCV001723229] Chr19:853063 [GRCh38]
Chr19:853063 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.224+99del deletion not provided [RCV001675354] Chr19:853123 [GRCh38]
Chr19:853123 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.68-106G>A single nucleotide variant not provided [RCV001637240] Chr19:852770 [GRCh38]
Chr19:852770 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.303G>A (p.Val101=) single nucleotide variant not provided [RCV001676324] Chr19:853340 [GRCh38]
Chr19:853340 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.68-129G>A single nucleotide variant not provided [RCV001657594] Chr19:852747 [GRCh38]
Chr19:852747 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.597+66G>A single nucleotide variant not provided [RCV001620309] Chr19:855860 [GRCh38]
Chr19:855860 [GRCh37]
Chr19:19p13.3
benign
Single allele single nucleotide variant not provided [RCV001674368] Chr19:856426 [GRCh38]
Chr19:856426 [GRCh37]
Chr19:19p13.3
benign
Single allele single nucleotide variant not provided [RCV001659215] Chr19:852205 [GRCh38]
Chr19:852205 [GRCh37]
Chr19:19p13.3
benign
Single allele duplication not provided [RCV001610870] Chr19:856416..856417 [GRCh38]
Chr19:856416..856417 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.68-79G>A single nucleotide variant not provided [RCV001648805] Chr19:852797 [GRCh38]
Chr19:852797 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.366+32C>T single nucleotide variant not provided [RCV001612031] Chr19:853435 [GRCh38]
Chr19:853435 [GRCh37]
Chr19:19p13.3
benign
GRCh37/hg19 19p13.3(chr19:260912-4384674)x3 copy number gain See cases [RCV001007443] Chr19:260912..4384674 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.68-61T>A single nucleotide variant not provided [RCV001725022] Chr19:852815 [GRCh38]
Chr19:852815 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.366+299G>T single nucleotide variant not provided [RCV001565922] Chr19:853702 [GRCh38]
Chr19:853702 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.597+65C>T single nucleotide variant not provided [RCV001683874] Chr19:855859 [GRCh38]
Chr19:855859 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.366+10G>A single nucleotide variant not provided [RCV001643903] Chr19:853413 [GRCh38]
Chr19:853413 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.67+210del deletion not provided [RCV001725554] Chr19:852595 [GRCh38]
Chr19:852595 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.565C>A (p.Leu189Ile) single nucleotide variant Cyclical neutropenia [RCV001796347] Chr19:855762 [GRCh38]
Chr19:855762 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.233G>C (p.Arg78Pro) single nucleotide variant Cyclical neutropenia [RCV001796348] Chr19:853270 [GRCh38]
Chr19:853270 [GRCh37]
Chr19:19p13.3
uncertain significance
NC_000019.10:g.(?_852288)_(856184_?)del deletion Cyclical neutropenia [RCV001796344] Chr19:852288..856184 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.701C>T (p.Pro234Leu) single nucleotide variant Cyclical neutropenia [RCV001796341]|not specified [RCV001002463] Chr19:856061 [GRCh38]
Chr19:856061 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.*2A>G single nucleotide variant Hereditary angioedema with normal C1Inh [RCV001027425] Chr19:856166 [GRCh38]
Chr19:856166 [GRCh37]
Chr19:19p13.3
not provided
NM_001972.4(ELANE):c.607G>T (p.Gly203Cys) single nucleotide variant Cyclical neutropenia [RCV001796387] Chr19:855967 [GRCh38]
Chr19:855967 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.367-10_367-9dup duplication Autoinflammatory syndrome [RCV002264165]|Cyclical neutropenia [RCV001796356] Chr19:855552..855553 [GRCh38]
Chr19:855552..855553 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.118G>A (p.Ala40Thr) single nucleotide variant Cyclical neutropenia [RCV001796404] Chr19:852926 [GRCh38]
Chr19:852926 [GRCh37]
Chr19:19p13.3
uncertain significance
NC_000019.9:g.(?_852319)_(1226656_?)del deletion Peutz-Jeghers syndrome [RCV001033903] Chr19:852319..1226656 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.597+5_597+8del deletion Cyclical neutropenia [RCV001796386] Chr19:855798..855801 [GRCh38]
Chr19:855798..855801 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.373G>A (p.Gly125Arg) single nucleotide variant Cyclical neutropenia [RCV001858907]|not specified [RCV001000513] Chr19:855570 [GRCh38]
Chr19:855570 [GRCh37]
Chr19:19p13.3
uncertain significance
NC_000019.9:g.(?_852326)_(1226646_?)del deletion Peutz-Jeghers syndrome [RCV001033230] Chr19:852326..1226646 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.343C>A (p.Leu115Ile) single nucleotide variant Cyclical neutropenia [RCV001796403] Chr19:853380 [GRCh38]
Chr19:853380 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.253G>A (p.Gly85Arg) single nucleotide variant Cyclical neutropenia [RCV001796346] Chr19:853290 [GRCh38]
Chr19:853290 [GRCh37]
Chr19:19p13.3
likely pathogenic|uncertain significance
NM_001972.4(ELANE):c.367C>G (p.Leu123Val) single nucleotide variant Neutropenia, severe congenital, 1, autosomal dominant [RCV001255175] Chr19:855564 [GRCh38]
Chr19:855564 [GRCh37]
Chr19:19p13.3
uncertain significance
GRCh37/hg19 19p13.3(chr19:260911-2256387)x3 copy number gain See cases [RCV002285065] Chr19:260911..2256387 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.377C>G (p.Ser126Trp) single nucleotide variant Cyclical neutropenia [RCV001994518] Chr19:855574 [GRCh38]
Chr19:855574 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.322G>C (p.Gly108Arg) single nucleotide variant Neutropenia, severe congenital, 1, autosomal dominant [RCV001260994] Chr19:853359 [GRCh38]
Chr19:853359 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.722G>A (p.Trp241Ter) single nucleotide variant Cyclical neutropenia [RCV001880158]|not provided [RCV001268083] Chr19:856082 [GRCh38]
Chr19:856082 [GRCh37]
Chr19:19p13.3
pathogenic|likely pathogenic
NM_001972.4(ELANE):c.90T>G (p.Ile30Met) single nucleotide variant not provided [RCV001269857] Chr19:852898 [GRCh38]
Chr19:852898 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.194T>A (p.Val65Asp) single nucleotide variant not provided [RCV001269858] Chr19:853002 [GRCh38]
Chr19:853002 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.619G>T (p.Val207Phe) single nucleotide variant Cyclical neutropenia [RCV002003362] Chr19:855979 [GRCh38]
Chr19:855979 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.25T>C (p.Cys9Arg) single nucleotide variant Cyclical neutropenia [RCV001796450] Chr19:852353 [GRCh38]
Chr19:852353 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.573G>T (p.Arg191Ser) single nucleotide variant Cyclical neutropenia [RCV001796434] Chr19:855770 [GRCh38]
Chr19:855770 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.305A>G (p.Gln102Arg) single nucleotide variant Cyclical neutropenia [RCV001796451]|not specified [RCV001820036] Chr19:853342 [GRCh38]
Chr19:853342 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.744C>G (p.Arg248=) single nucleotide variant Cyclical neutropenia [RCV001796435] Chr19:856104 [GRCh38]
Chr19:856104 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.644T>A (p.Ile215Asn) single nucleotide variant Cyclical neutropenia [RCV001796432] Chr19:856004 [GRCh38]
Chr19:856004 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.551G>A (p.Ser184Asn) single nucleotide variant Cyclical neutropenia [RCV001796471] Chr19:855748 [GRCh38]
Chr19:855748 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.213C>T (p.Cys71=) single nucleotide variant Cyclical neutropenia [RCV001796487] Chr19:853021 [GRCh38]
Chr19:853021 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.540C>G (p.Leu180=) single nucleotide variant Cyclical neutropenia [RCV001796493] Chr19:855737 [GRCh38]
Chr19:855737 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.403G>A (p.Val135Met) single nucleotide variant Cyclical neutropenia [RCV001796437]|not provided [RCV002227270] Chr19:855600 [GRCh38]
Chr19:855600 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.264C>A (p.Asn88Lys) single nucleotide variant Cyclical neutropenia [RCV001796468] Chr19:853301 [GRCh38]
Chr19:853301 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.19C>T (p.Leu7Phe) single nucleotide variant Cyclical neutropenia [RCV001796469] Chr19:852347 [GRCh38]
Chr19:852347 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.723G>A (p.Trp241Ter) single nucleotide variant Cyclical neutropenia [RCV001796460] Chr19:856083 [GRCh38]
Chr19:856083 [GRCh37]
Chr19:19p13.3
uncertain significance
NC_000019.9:g.(?_852326)_(856164_?)dup duplication Cyclical neutropenia [RCV001796441] Chr19:852326..856164 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.233G>A (p.Arg78His) single nucleotide variant Cyclical neutropenia [RCV001796442] Chr19:853270 [GRCh38]
Chr19:853270 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.760T>C (p.Cys254Arg) single nucleotide variant Cyclical neutropenia [RCV001796470] Chr19:856120 [GRCh38]
Chr19:856120 [GRCh37]
Chr19:19p13.3
uncertain significance
NC_000019.9:g.(?_589926)_(1401495_?)dup duplication Cerebral creatine deficiency syndrome [RCV001307813] Chr19:589926..1401495 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.602del (p.Asp201fs) deletion Cyclical neutropenia [RCV001796439] Chr19:855962 [GRCh38]
Chr19:855962 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.272G>C (p.Arg91Pro) single nucleotide variant Cyclical neutropenia [RCV001796462] Chr19:853309 [GRCh38]
Chr19:853309 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.107C>G (p.Ala36Gly) single nucleotide variant Cyclical neutropenia [RCV001796454] Chr19:852915 [GRCh38]
Chr19:852915 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.66G>A (p.Gly22=) single nucleotide variant Cyclical neutropenia [RCV001796456] Chr19:852394 [GRCh38]
Chr19:852394 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.222_223insAC (p.Val75fs) insertion Cyclical neutropenia [RCV001796453] Chr19:853030..853031 [GRCh38]
Chr19:853030..853031 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.225-6C>A single nucleotide variant Cyclical neutropenia [RCV001796459] Chr19:853256 [GRCh38]
Chr19:853256 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.569T>G (p.Val190Gly) single nucleotide variant Cyclical neutropenia [RCV001796467] Chr19:855766 [GRCh38]
Chr19:855766 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.775G>C (p.Asp259His) single nucleotide variant Cyclical neutropenia [RCV001796466] Chr19:856135 [GRCh38]
Chr19:856135 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.286C>T (p.Arg96Trp) single nucleotide variant Cyclical neutropenia [RCV001796436]|not provided [RCV001760375] Chr19:853323 [GRCh38]
Chr19:853323 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.164G>C (p.Cys55Ser) single nucleotide variant not provided [RCV001269541] Chr19:852972 [GRCh38]
Chr19:852972 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.201G>T (p.Ser67=) single nucleotide variant Cyclical neutropenia [RCV001796478]|not provided [RCV001528377] Chr19:853009 [GRCh38]
Chr19:853009 [GRCh37]
Chr19:19p13.3
benign|likely benign
NM_001972.4(ELANE):c.598-2A>C single nucleotide variant Cyclical neutropenia [RCV001796431] Chr19:855956 [GRCh38]
Chr19:855956 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.224+9C>G single nucleotide variant Cyclical neutropenia [RCV001796483] Chr19:853041 [GRCh38]
Chr19:853041 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.224+9C>T single nucleotide variant Cyclical neutropenia [RCV001796527] Chr19:853041 [GRCh38]
Chr19:853041 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.366+7C>T single nucleotide variant Cyclical neutropenia [RCV001796520]|not specified [RCV002246392] Chr19:853410 [GRCh38]
Chr19:853410 [GRCh37]
Chr19:19p13.3
likely benign|uncertain significance
NM_001972.4(ELANE):c.367-7G>A single nucleotide variant Cyclical neutropenia [RCV001796507] Chr19:855557 [GRCh38]
Chr19:855557 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.51G>T (p.Pro17=) single nucleotide variant Cyclical neutropenia [RCV001796528] Chr19:852379 [GRCh38]
Chr19:852379 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.534G>T (p.Thr178=) single nucleotide variant Cyclical neutropenia [RCV001796480] Chr19:855731 [GRCh38]
Chr19:855731 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.639C>T (p.His213=) single nucleotide variant Cyclical neutropenia [RCV001796522] Chr19:855999 [GRCh38]
Chr19:855999 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.45C>G (p.Val15=) single nucleotide variant Cyclical neutropenia [RCV001796521] Chr19:852373 [GRCh38]
Chr19:852373 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.564T>C (p.Thr188=) single nucleotide variant Cyclical neutropenia [RCV001796485] Chr19:855761 [GRCh38]
Chr19:855761 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.367-8C>T single nucleotide variant Cyclical neutropenia [RCV001796492]|not provided [RCV001538412] Chr19:855556 [GRCh38]
Chr19:855556 [GRCh37]
Chr19:19p13.3
benign|likely benign
NM_001972.4(ELANE):c.495C>T (p.Ile165=) single nucleotide variant Cyclical neutropenia [RCV001796491] Chr19:855692 [GRCh38]
Chr19:855692 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.597+5G>T single nucleotide variant Cyclical neutropenia [RCV001796472] Chr19:855799 [GRCh38]
Chr19:855799 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.102G>T (p.Arg34=) single nucleotide variant Cyclical neutropenia [RCV001796482] Chr19:852910 [GRCh38]
Chr19:852910 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.114C>T (p.Pro38=) single nucleotide variant Cyclical neutropenia [RCV001796497] Chr19:852922 [GRCh38]
Chr19:852922 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.687del (p.Asp230fs) deletion Cyclical neutropenia [RCV001796473] Chr19:856044 [GRCh38]
Chr19:856044 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.258C>T (p.Ala86=) single nucleotide variant Cyclical neutropenia [RCV001796499] Chr19:853295 [GRCh38]
Chr19:853295 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.168C>T (p.Gly56=) single nucleotide variant Cyclical neutropenia [RCV001796484] Chr19:852976 [GRCh38]
Chr19:852976 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.711G>A (p.Gln237=) single nucleotide variant Cyclical neutropenia [RCV001796481] Chr19:856071 [GRCh38]
Chr19:856071 [GRCh37]
Chr19:19p13.3
likely benign
Single allele single nucleotide variant not provided [RCV001688294] Chr19:852033 [GRCh38]
Chr19:852033 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.597+3A>T single nucleotide variant not provided [RCV001509003] Chr19:855797 [GRCh38]
Chr19:855797 [GRCh37]
Chr19:19p13.3
likely pathogenic
Single allele single nucleotide variant not provided [RCV001655093] Chr19:852196 [GRCh38]
Chr19:852196 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.324C>T (p.Gly108=) single nucleotide variant Cyclical neutropenia [RCV001796503] Chr19:853361 [GRCh38]
Chr19:853361 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.225-4G>A single nucleotide variant Cyclical neutropenia [RCV001796515] Chr19:853258 [GRCh38]
Chr19:853258 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.300C>T (p.Ala100=) single nucleotide variant Cyclical neutropenia [RCV001796502] Chr19:853337 [GRCh38]
Chr19:853337 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.225-66G>T single nucleotide variant not provided [RCV001650228] Chr19:853196 [GRCh38]
Chr19:853196 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.366+9G>A single nucleotide variant Autoinflammatory syndrome [RCV002264371]|Cyclical neutropenia [RCV001796543] Chr19:853412 [GRCh38]
Chr19:853412 [GRCh37]
Chr19:19p13.3
benign|uncertain significance
NM_001972.4(ELANE):c.366+125G>A single nucleotide variant not provided [RCV001674274] Chr19:853528 [GRCh38]
Chr19:853528 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.*68C>G single nucleotide variant not provided [RCV001724882] Chr19:856232 [GRCh38]
Chr19:856232 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.102G>A (p.Arg34=) single nucleotide variant Cyclical neutropenia [RCV001796518]|not provided [RCV001655734] Chr19:852910 [GRCh38]
Chr19:852910 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.786G>C (p.Pro262=) single nucleotide variant Cyclical neutropenia [RCV001796514] Chr19:856146 [GRCh38]
Chr19:856146 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.138C>T (p.Ser46=) single nucleotide variant Cyclical neutropenia [RCV001796511] Chr19:852946 [GRCh38]
Chr19:852946 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.492G>C (p.Gly164=) single nucleotide variant Cyclical neutropenia [RCV001796504] Chr19:855689 [GRCh38]
Chr19:855689 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.600G>A (p.Gly200=) single nucleotide variant Cyclical neutropenia [RCV001796526] Chr19:855960 [GRCh38]
Chr19:855960 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.768C>T (p.His256=) single nucleotide variant Cyclical neutropenia [RCV001796523]|not specified [RCV001820201] Chr19:856128 [GRCh38]
Chr19:856128 [GRCh37]
Chr19:19p13.3
likely benign|uncertain significance
NM_001972.4(ELANE):c.417G>A (p.Pro139=) single nucleotide variant Cyclical neutropenia [RCV001796517] Chr19:855614 [GRCh38]
Chr19:855614 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.100C>T (p.Arg34Trp) single nucleotide variant Cyclical neutropenia [RCV001796510] Chr19:852908 [GRCh38]
Chr19:852908 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.367-160C>T single nucleotide variant not provided [RCV001539086] Chr19:855404 [GRCh38]
Chr19:855404 [GRCh37]
Chr19:19p13.3
benign
NM_001972.4(ELANE):c.300dup (p.Val101fs) duplication not specified [RCV002247805] Chr19:853335..853336 [GRCh38]
Chr19:853335..853336 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.641G>A (p.Gly214Glu) single nucleotide variant Neutropenia, severe congenital, 1, autosomal dominant [RCV001732835] Chr19:856001 [GRCh38]
Chr19:856001 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.577C>T (p.Arg193Trp) single nucleotide variant not provided [RCV001765155] Chr19:855774 [GRCh38]
Chr19:855774 [GRCh37]
Chr19:19p13.3
uncertain significance
GRCh37/hg19 19p13.3(chr19:260911-1319319) copy number loss Peutz-Jeghers syndrome [RCV002280635] Chr19:260911..1319319 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.223G>A (p.Val75Ile) single nucleotide variant not specified [RCV001820224] Chr19:853031 [GRCh38]
Chr19:853031 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.544del (p.Arg182fs) deletion not provided [RCV001815843] Chr19:855740 [GRCh38]
Chr19:855740 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.450G>A (p.Gln150=) single nucleotide variant Cyclical neutropenia [RCV002074272]|not specified [RCV001817165] Chr19:855647 [GRCh38]
Chr19:855647 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.108G>A (p.Ala36=) single nucleotide variant Cyclical neutropenia [RCV002074156]|not provided [RCV001811765] Chr19:852916 [GRCh38]
Chr19:852916 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.352A>G (p.Ile118Val) single nucleotide variant Cyclical neutropenia [RCV001869776]|not specified [RCV001822805] Chr19:853389 [GRCh38]
Chr19:853389 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.437_457dup (p.Gly146_Leu152dup) duplication Cyclical neutropenia [RCV001877659] Chr19:855627..855628 [GRCh38]
Chr19:855627..855628 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.41G>A (p.Cys14Tyr) single nucleotide variant Cyclical neutropenia [RCV001870867] Chr19:852369 [GRCh38]
Chr19:852369 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.237G>T (p.Ala79=) single nucleotide variant Cyclical neutropenia [RCV001875711] Chr19:853274 [GRCh38]
Chr19:853274 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.772C>T (p.Arg258Trp) single nucleotide variant Cyclical neutropenia [RCV001874163] Chr19:856132 [GRCh38]
Chr19:856132 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.452G>C (p.Cys151Ser) single nucleotide variant Neutropenia, severe congenital, 1, autosomal dominant [RCV001824261] Chr19:855649 [GRCh38]
Chr19:855649 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.574_583del (p.Gly192fs) deletion Neutropenia, severe congenital, 1, autosomal dominant [RCV001824553] Chr19:855768..855777 [GRCh38]
Chr19:855768..855777 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.461T>G (p.Met154Arg) single nucleotide variant Cyclical neutropenia [RCV001874769] Chr19:855658 [GRCh38]
Chr19:855658 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.443G>A (p.Gly148Glu) single nucleotide variant Cyclical neutropenia [RCV002026916] Chr19:855640 [GRCh38]
Chr19:855640 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.664G>A (p.Gly222Ser) single nucleotide variant Cyclical neutropenia [RCV002030285] Chr19:856024 [GRCh38]
Chr19:856024 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.254G>A (p.Gly85Glu) single nucleotide variant not provided [RCV001843990] Chr19:853291 [GRCh38]
Chr19:853291 [GRCh37]
Chr19:19p13.3
likely pathogenic
NC_000019.9:g.(?_855544)_(863238_?)del deletion Cyclical neutropenia [RCV002002146] Chr19:855544..863238 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.104G>A (p.Arg35Gln) single nucleotide variant Cyclical neutropenia [RCV002009232] Chr19:852912 [GRCh38]
Chr19:852912 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.664G>T (p.Gly222Cys) single nucleotide variant Cyclical neutropenia [RCV002030981] Chr19:856024 [GRCh38]
Chr19:856024 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.244G>A (p.Val82Met) single nucleotide variant Cyclical neutropenia [RCV002031718] Chr19:853281 [GRCh38]
Chr19:853281 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.520G>A (p.Val174Met) single nucleotide variant Cyclical neutropenia [RCV002034016] Chr19:855717 [GRCh38]
Chr19:855717 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.773G>A (p.Arg258Gln) single nucleotide variant Autoinflammatory syndrome [RCV002264397]|Cyclical neutropenia [RCV002037192] Chr19:856133 [GRCh38]
Chr19:856133 [GRCh37]
Chr19:19p13.3
likely benign|uncertain significance
NM_001972.4(ELANE):c.518A>G (p.Asn173Ser) single nucleotide variant Cyclical neutropenia [RCV002045710] Chr19:855715 [GRCh38]
Chr19:855715 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.586G>A (p.Gly196Ser) single nucleotide variant Cyclical neutropenia [RCV002047441] Chr19:855783 [GRCh38]
Chr19:855783 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.622T>G (p.Cys208Gly) single nucleotide variant Cyclical neutropenia [RCV001991511] Chr19:855982 [GRCh38]
Chr19:855982 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.1A>G (p.Met1Val) single nucleotide variant Cyclical neutropenia [RCV001885394]|not provided [RCV001843988] Chr19:852329 [GRCh38]
Chr19:852329 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.169G>A (p.Ala57Thr) single nucleotide variant Cyclical neutropenia [RCV002028317]|Cyclical neutropenia [RCV002246645] Chr19:852977 [GRCh38]
Chr19:852977 [GRCh37]
Chr19:19p13.3
pathogenic|likely pathogenic
NM_001972.4(ELANE):c.242G>C (p.Arg81Pro) single nucleotide variant Cyclical neutropenia [RCV001845041] Chr19:853279 [GRCh38]
Chr19:853279 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.619G>C (p.Val207Leu) single nucleotide variant Cyclical neutropenia [RCV002022534] Chr19:855979 [GRCh38]
Chr19:855979 [GRCh37]
Chr19:19p13.3
uncertain significance
NC_000019.9:g.(?_589946)_(1650247_?)dup duplication not provided [RCV001940167] Chr19:589946..1650247 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.74C>A (p.Ala25Glu) single nucleotide variant Cyclical neutropenia [RCV001912557] Chr19:852882 [GRCh38]
Chr19:852882 [GRCh37]
Chr19:19p13.3
uncertain significance
NC_000019.9:g.(?_852329)_(859764_?)del deletion not provided [RCV001942937] Chr19:852329..859764 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.189C>A (p.Asn63Lys) single nucleotide variant Cyclical neutropenia [RCV001895174] Chr19:852997 [GRCh38]
Chr19:852997 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.146T>C (p.Leu49Pro) single nucleotide variant Cyclical neutropenia [RCV001986038] Chr19:852954 [GRCh38]
Chr19:852954 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.91G>A (p.Val31Met) single nucleotide variant Cyclical neutropenia [RCV001954944] Chr19:852899 [GRCh38]
Chr19:852899 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.550A>C (p.Ser184Arg) single nucleotide variant Cyclical neutropenia [RCV001878702] Chr19:855747 [GRCh38]
Chr19:855747 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.789C>T (p.Ala263=) single nucleotide variant Cyclical neutropenia [RCV001972560] Chr19:856149 [GRCh38]
Chr19:856149 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.392C>T (p.Ala131Val) single nucleotide variant Cyclical neutropenia [RCV001913578] Chr19:855589 [GRCh38]
Chr19:855589 [GRCh37]
Chr19:19p13.3
uncertain significance
NC_000019.9:g.(?_589946)_(1106571_?)del deletion Cyclical neutropenia [RCV001916881]|not provided [RCV001923747] Chr19:589946..1106571 [GRCh37]
Chr19:19p13.3
pathogenic|uncertain significance
NM_001972.4(ELANE):c.367-19T>C single nucleotide variant Cyclical neutropenia [RCV001916436] Chr19:855545 [GRCh38]
Chr19:855545 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.385A>G (p.Ile129Val) single nucleotide variant Cyclical neutropenia [RCV001891899] Chr19:855582 [GRCh38]
Chr19:855582 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.367-8C>A single nucleotide variant Cyclical neutropenia [RCV001896973] Chr19:855556 [GRCh38]
Chr19:855556 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.239T>C (p.Val80Ala) single nucleotide variant Cyclical neutropenia [RCV001941484] Chr19:853276 [GRCh38]
Chr19:853276 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.676G>A (p.Gly226Arg) single nucleotide variant Autoinflammatory syndrome [RCV002264407]|Cyclical neutropenia [RCV001937506] Chr19:856036 [GRCh38]
Chr19:856036 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.472C>T (p.Leu158Phe) single nucleotide variant Cyclical neutropenia [RCV001977774] Chr19:855669 [GRCh38]
Chr19:855669 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.453C>T (p.Cys151=) single nucleotide variant Cyclical neutropenia [RCV001931339] Chr19:855650 [GRCh38]
Chr19:855650 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.598-19A>G single nucleotide variant Cyclical neutropenia [RCV002191593] Chr19:855939 [GRCh38]
Chr19:855939 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.498C>T (p.Ala166=) single nucleotide variant Autoinflammatory syndrome [RCV002264451]|Cyclical neutropenia [RCV002166950] Chr19:855695 [GRCh38]
Chr19:855695 [GRCh37]
Chr19:19p13.3
likely benign|uncertain significance
NM_001972.4(ELANE):c.367-11C>T single nucleotide variant Cyclical neutropenia [RCV002191676] Chr19:855553 [GRCh38]
Chr19:855553 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.598-8C>T single nucleotide variant Cyclical neutropenia [RCV002087240]|not provided [RCV002097081] Chr19:855950 [GRCh38]
Chr19:855950 [GRCh37]
Chr19:19p13.3
likely benign|uncertain significance
NM_001972.4(ELANE):c.261T>C (p.His87=) single nucleotide variant Cyclical neutropenia [RCV002146229] Chr19:853298 [GRCh38]
Chr19:853298 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.345C>T (p.Leu115=) single nucleotide variant Cyclical neutropenia [RCV002167611] Chr19:853382 [GRCh38]
Chr19:853382 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.435G>C (p.Leu145=) single nucleotide variant Cyclical neutropenia [RCV002111598] Chr19:855632 [GRCh38]
Chr19:855632 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.321C>T (p.Asn107=) single nucleotide variant Cyclical neutropenia [RCV002111229] Chr19:853358 [GRCh38]
Chr19:853358 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.225-8C>T single nucleotide variant Cyclical neutropenia [RCV002192754] Chr19:853254 [GRCh38]
Chr19:853254 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.366+19G>T single nucleotide variant Cyclical neutropenia [RCV002212583] Chr19:853422 [GRCh38]
Chr19:853422 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.366+8C>T single nucleotide variant Cyclical neutropenia [RCV002133412] Chr19:853411 [GRCh38]
Chr19:853411 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.243G>T (p.Arg81=) single nucleotide variant Cyclical neutropenia [RCV002079923] Chr19:853280 [GRCh38]
Chr19:853280 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.585C>T (p.Ala195=) single nucleotide variant Cyclical neutropenia [RCV002134891] Chr19:855782 [GRCh38]
Chr19:855782 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.366+17_366+21del microsatellite Cyclical neutropenia [RCV002115303] Chr19:853412..853416 [GRCh38]
Chr19:853412..853416 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.597+10C>A single nucleotide variant Cyclical neutropenia [RCV002195692] Chr19:855804 [GRCh38]
Chr19:855804 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.501C>T (p.Ser167=) single nucleotide variant Cyclical neutropenia [RCV002133400] Chr19:855698 [GRCh38]
Chr19:855698 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.228C>A (p.Asn76Lys) single nucleotide variant not provided [RCV002248274] Chr19:853265 [GRCh38]
Chr19:853265 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.219G>A (p.Ala73=) single nucleotide variant Cyclical neutropenia [RCV002139687] Chr19:853027 [GRCh38]
Chr19:853027 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.81C>T (p.Ala27=) single nucleotide variant Cyclical neutropenia [RCV002217774] Chr19:852889 [GRCh38]
Chr19:852889 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.67+20C>T single nucleotide variant Cyclical neutropenia [RCV002118283] Chr19:852415 [GRCh38]
Chr19:852415 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.441C>T (p.Asn147=) single nucleotide variant Cyclical neutropenia [RCV002118326] Chr19:855638 [GRCh38]
Chr19:855638 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.24G>A (p.Ala8=) single nucleotide variant Cyclical neutropenia [RCV002081672] Chr19:852352 [GRCh38]
Chr19:852352 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.210C>T (p.His70=) single nucleotide variant Cyclical neutropenia [RCV002203833] Chr19:853018 [GRCh38]
Chr19:853018 [GRCh37]
Chr19:19p13.3
likely benign
NM_001972.4(ELANE):c.113C>T (p.Pro38Leu) single nucleotide variant Cyclical neutropenia [RCV002289075] Chr19:852921 [GRCh38]
Chr19:852921 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.13C>T (p.Arg5Cys) single nucleotide variant Autoinflammatory syndrome [RCV002264611] Chr19:852341 [GRCh38]
Chr19:852341 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.151G>A (p.Gly51Arg) single nucleotide variant Autoinflammatory syndrome [RCV002264612] Chr19:852959 [GRCh38]
Chr19:852959 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.159C>G (p.His53Gln) single nucleotide variant Autoinflammatory syndrome [RCV002264613] Chr19:852967 [GRCh38]
Chr19:852967 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.228C>G (p.Asn76Lys) single nucleotide variant Autoinflammatory syndrome [RCV002264614] Chr19:853265 [GRCh38]
Chr19:853265 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.756C>T (p.Asn252_Pro253=) single nucleotide variant Autoinflammatory syndrome [RCV002264619] Chr19:856116 [GRCh38]
Chr19:856116 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.786G>A (p.Pro262_Ala263=) single nucleotide variant Autoinflammatory syndrome [RCV002264620] Chr19:856146 [GRCh38]
Chr19:856146 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.91del (p.Val31fs) deletion Autoinflammatory syndrome [RCV002264621] Chr19:852899 [GRCh38]
Chr19:852899 [GRCh37]
Chr19:19p13.3
likely pathogenic
NM_001972.4(ELANE):c.289_300dup (p.Ala100_Val101insGlnValPheAla) duplication Neutropenia, severe congenital, 1, autosomal dominant [RCV002260543] Chr19:853325..853326 [GRCh38]
Chr19:853325..853326 [GRCh37]
Chr19:19p13.3
pathogenic
NM_001972.4(ELANE):c.327C>T (p.Tyr109_Asp110=) single nucleotide variant Autoinflammatory syndrome [RCV002264615] Chr19:853364 [GRCh38]
Chr19:853364 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.555C>T (p.Asn185_Val186=) single nucleotide variant Autoinflammatory syndrome [RCV002264616] Chr19:855752 [GRCh38]
Chr19:855752 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.68G>A (p.Gly23Asp) single nucleotide variant Autoinflammatory syndrome [RCV002264617] Chr19:852876 [GRCh38]
Chr19:852876 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.744C>T (p.Arg248_Ser249=) single nucleotide variant Autoinflammatory syndrome [RCV002264618] Chr19:856104 [GRCh38]
Chr19:856104 [GRCh37]
Chr19:19p13.3
uncertain significance
NM_001972.4(ELANE):c.93G>T (p.Val31_Gly32=) single nucleotide variant Autoinflammatory syndrome [RCV002264622] Chr19:852901 [GRCh38]
Chr19:852901 [GRCh37]
Chr19:19p13.3
uncertain significance

Additional Information

Database Acc Id Source(s)
AGR Gene HGNC:3309 AgrOrtholog
COSMIC ELANE COSMIC
Ensembl Genes ENSG00000197561 Ensembl, ENTREZGENE, UniProtKB/Swiss-Prot
  ENSG00000277571 UniProtKB/Swiss-Prot
Ensembl Protein ENSP00000263621 ENTREZGENE
  ENSP00000263621.1 UniProtKB/Swiss-Prot
  ENSP00000466090.1 UniProtKB/Swiss-Prot
  ENSP00000480128.1 UniProtKB/Swiss-Prot
  ENSP00000488075.1 UniProtKB/Swiss-Prot
Ensembl Transcript ENST00000263621 ENTREZGENE
  ENST00000263621.2 UniProtKB/Swiss-Prot
  ENST00000590230.5 UniProtKB/Swiss-Prot
  ENST00000615489.1 UniProtKB/Swiss-Prot
  ENST00000632488.1 UniProtKB/Swiss-Prot
Gene3D-CATH 2.40.10.10 UniProtKB/Swiss-Prot
GTEx ENSG00000197561 GTEx
  ENSG00000277571 GTEx
HGNC ID HGNC:3309 ENTREZGENE
Human Proteome Map ELANE Human Proteome Map
InterPro Peptidase_S1_PA UniProtKB/Swiss-Prot
  Peptidase_S1_PA_chymotrypsin UniProtKB/Swiss-Prot
  Peptidase_S1A UniProtKB/Swiss-Prot
  Trypsin_dom UniProtKB/Swiss-Prot
  TRYPSIN_HIS UniProtKB/Swiss-Prot
  TRYPSIN_SER UniProtKB/Swiss-Prot
KEGG Report hsa:1991 UniProtKB/Swiss-Prot
NCBI Gene 1991 ENTREZGENE
OMIM 130130 OMIM
  162800 OMIM
  202700 OMIM
Pfam Trypsin UniProtKB/Swiss-Prot
PharmGKB ELA2 RGD, PharmGKB
PRINTS CHYMOTRYPSIN UniProtKB/Swiss-Prot
PROSITE TRYPSIN_DOM UniProtKB/Swiss-Prot
  TRYPSIN_HIS UniProtKB/Swiss-Prot
  TRYPSIN_SER UniProtKB/Swiss-Prot
SMART Tryp_SPc UniProtKB/Swiss-Prot
Superfamily-SCOP SSF50494 UniProtKB/Swiss-Prot
UniProt ELNE_HUMAN UniProtKB/Swiss-Prot, ENTREZGENE
  Q6LDP5 ENTREZGENE
UniProt Secondary P09649 UniProtKB/Swiss-Prot
  Q6B0D9 UniProtKB/Swiss-Prot
  Q6LDP5 UniProtKB/Swiss-Prot