Ifnar1<sup>em1</sup> (interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 1) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Ifnar1em1 (interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 1) Rattus norvegicus
Analyze
Symbol: Ifnar1em1
Name: interferon alpha and beta receptor subunit 1; CRISPR/Cas9 induced mutant 1
RGD ID: 12910495
Description: An Ifnar1 target region in exon 4, encoding the IFN-binding domain, was disrupted in the genome of the LEW.1WR1 rat using the CRISPR-Cas9 method. The resulting mutant carries a 81-bp deletion in the exon 4 of Ifnar1 gene.
ASSOCIATED WITH decreased susceptibility to autoimmune diabetes; increased susceptibility to viral infection induced morbidity/mortality; insulitis; ASSOCIATED WITH Cardiovirus Infections; Experimental Diabetes Mellitus
Type: allele  of Ifnar1  
Previously known as: Ifnar1^[em1]; Ifnar1em1
Is Marker For: Strains:   LEW.1WR1-Ifnar1em1  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype
References

References - curated
# Reference Title Reference Citation
1. A Critical Role for the Type I Interferon Receptor in Virus-Induced Autoimmune Diabetes in Rats. Qaisar N, etal., Diabetes. 2017 Jan;66(1):145-157. doi: 10.2337/db16-0462. Epub 2016 Oct 7.

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Ifnar1em1-var1 chr11 30738535 30738615 ATACTAGTCTACATCTCTCCTCCCGGAGAAGACGGAACCATGTGGGCACAGGAGAAACGCTGCTTCAATTACACGATACGG - deletion mRatBN7.2
Ifnar1em1-var1 chr11 31653152 31653232 ATACTAGTCTACATCTCTCCTCCCGGAGAAGACGGAACCATGTGGGCACAGGAGAAACGCTGCTTCAATTACACGATACGG - deletion Rnor_6.0

Related Rat Strains
The following Strains have been annotated to Ifnar1em1


Expression


Sequence

Nucleotide Sequences


Additional Information