Lep<sup>em1Sage</sup> (leptin; zinc finger nuclease induced mutant1, Sage) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Lepem1Sage (leptin; zinc finger nuclease induced mutant1, Sage) Rattus norvegicus
Analyze
Symbol: Lepem1Sage
Name: leptin; zinc finger nuclease induced mutant1, Sage
RGD ID: 12904927
Description: This allele possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene.
ASSOCIATED WITH abnormal interferon level; decreased T cell number; increased body weight; ASSOCIATED WITH glucose intolerance; Hypercholesterolemia; hyperinsulinism
Type: allele  of Lep  
Previously known as: Lep tm1sage; Lepem1Sage
Is Marker For: Strains:   SD-Lepem1Sage-/-   SD-Lepem1Sage+/-  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position: No map positions available.


Disease Annotations     Click to see Annotation Detail View

References

References - curated
# Reference Title Reference Citation
1. Creation and preliminary characterization of a leptin knockout rat. Vaira S, etal., Endocrinology. 2012 Nov;153(11):5622-8. doi: 10.1210/en.2012-1462. Epub 2012 Sep 4.

Genomics


Related Rat Strains
The following Strains have been annotated to Lepem1Sage


Expression


Sequence

Nucleotide Sequences

Rat Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type
Lepem1Sage-var1 chr4 57670525 57670675 ATCCACAAAGTCCAGGATGACACCAAAACCCTCATCAAGACCATTGTCACCAGGATCAATGACATTTCACACACGGTAGGGAGTCTCTTGTGGGGAAGCAAAGGAGAAGTAGGGCTAGAACCAGAGTCTGAGAATCACAGTGAGCGCCTTC - deletion
Lepem1Sage-var1 chr4 56347081 56347231 ATCCACAAAGTCCAGGATGACACCAAAACCCTCATCAAGACCATTGTCACCAGGATCAATGACATTTCACACACGGTAGGGAGTCTCTTGTGGGGAAGCAAAGGAGAAGTAGGGCTAGAACCAGAGTCTGAGAATCACAGTGAGCGCCTTC - deletion

Additional Information