MIR128-1 (microRNA mir-128-1) - Rat Genome Database

Name: MIR128-1
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer VCMap Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: MIR128-1 (microRNA mir-128-1) Canis lupus familiaris

Analyze

Symbol:

MIR128-1

Name:

microRNA mir-128-1

RGD ID:

12400561

Description:

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

Type:

ncrna

RefSeq Status:

PROVISIONAL

Previously known as:

cfa-mir-128-1; microRNA 128-1

RGD Orthologs

Human

Mouse

Rat

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

CanFam3.1 - Dog CanFam3.1 Assembly

Position:

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	19	38,435,956 - 38,436,011 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog10K_Boxer_Tasha	19	38,679,708 - 38,679,763 (+)	NCBI
ROS_Cfam_1.0	19	39,881,919 - 39,881,974 (+)	NCBI
UMICH_Zoey_3.1	19	38,524,004 - 38,524,059 (+)	NCBI
UNSW_CanFamBas_1.0	19	38,687,099 - 38,687,154 (+)	NCBI
UU_Cfam_GSD_1.0	19	39,920,158 - 39,920,213 (+)	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Hirschsprung's disease (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to lipopolysaccharide (ISO)

cellular senescence (ISO)

long-term synaptic potentiation (ISO)

miRNA-mediated gene silencing (ISO)

miRNA-mediated gene silencing by inhibition of translation (ISO)

negative regulation of cell migration (ISO)

negative regulation of cholesterol efflux (ISO)

negative regulation of DNA-binding transcription factor activity (ISO)

negative regulation of gene expression (ISO)

negative regulation of lipoprotein transport (ISO)

negative regulation of macrophage colony-stimulating factor production (ISO)

negative regulation of macrophage migration (ISO)

negative regulation of transporter activity (ISO)

positive regulation of cell adhesion (ISO)

Cellular Component

RISC complex (IEA)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

protein binding (ISO)

References

Additional References at PubMed

PMID:16381832	PMID:18392026

Genomics

Comparative Map Data

MIR128-1
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	19	38,435,956 - 38,436,011 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog10K_Boxer_Tasha	19	38,679,708 - 38,679,763 (+)	NCBI
ROS_Cfam_1.0	19	39,881,919 - 39,881,974 (+)	NCBI
UMICH_Zoey_3.1	19	38,524,004 - 38,524,059 (+)	NCBI
UNSW_CanFamBas_1.0	19	38,687,099 - 38,687,154 (+)	NCBI
UU_Cfam_GSD_1.0	19	39,920,158 - 39,920,213 (+)	NCBI

MIR128-1
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	2	135,665,397 - 135,665,478 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p13 Ensembl	2	135,665,397 - 135,665,478 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	2	136,422,967 - 136,423,048 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	2	136,139,436 - 136,139,517 (+)	NCBI	NCBI36		hg18	NCBI36
Celera	2	130,133,728 - 130,133,809 (+)	NCBI
Cytogenetic Map	2	q21.3	NCBI
HuRef	2	128,415,938 - 128,416,019 (+)	NCBI		HuRef
CHM1_1	2	136,427,877 - 136,427,958 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	2	136,105,929 - 136,106,010 (+)	NCBI

Mir128-1
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	1	128,130,098 - 128,130,167 (+)	NCBI	GRCm39		mm39
GRCm39 Ensembl	1	128,130,098 - 128,130,167 (+)	Ensembl
GRCm38	1	128,202,361 - 128,202,430 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	1	128,202,361 - 128,202,430 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	1	130,098,938 - 130,099,007 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	1	130,829,788 - 130,829,857 (+)	NCBI		Celera
Cytogenetic Map	1	E3	NCBI

Mir128-1
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	13	39,699,449 - 39,699,530 (+)	NCBI	mRatBN7.2
mRatBN7.2 Ensembl	13	39,699,449 - 39,699,530 (+)	Ensembl
Rnor_6.0	13	44,916,534 - 44,916,615 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	13	44,916,534 - 44,916,615 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	13	50,001,706 - 50,001,787 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	13	40,073,464 - 40,073,545 (+)	NCBI		Celera
Cytogenetic Map	13	q13	NCBI

MIR128-1
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	15	16,273,551 - 16,273,659 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	15	16,273,557 - 16,273,638 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	15	18,661,614 - 18,661,695 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_049262	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AAEX04000019	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAHUQ010000225	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAQRD010000042	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAUVH010000115	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	REHQ01000019	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_049262

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
CanFam3.1	19	38,435,956 - 38,436,011 (+)	NCBI
Dog10K_Boxer_Tasha	19	38,679,708 - 38,679,763 (+)	NCBI
ROS_Cfam_1.0	19	39,881,919 - 39,881,974 (+)	NCBI
UMICH_Zoey_3.1	19	38,524,004 - 38,524,059 (+)	NCBI
UNSW_CanFamBas_1.0	19	38,687,099 - 38,687,154 (+)	NCBI
UU_Cfam_GSD_1.0	19	39,920,158 - 39,920,213 (+)	NCBI

Sequence:

show sequence

CGGGGCCGTAGCACTGTCTGAGAGGTTTACATTTCTCACAGTGAACCGGTCTCTTT

hide sequence

Damaging Variants

Assembly: CanFam3.1

Chromosome	Start Pos	End Pos	Reference Nucleotide	Variant Nucleotide	Variant Type	Strain
19	38485149	38485150	T	A	snv	Great Lakes Wolf (SRS661486)

Additional Information

External Database Links

Database	Acc Id	Source(s)
miRBase	MI0008032	ENTREZGENE
NCBI Gene	MIR128-1	ENTREZGENE
RNAcentral	URS000024A59E	RNACentral
	URS00007E36DB	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2019-04-02	MIR128-1	microRNA mir-128-1		microRNA 128-1	Symbol and/or name change	5135510	APPROVED

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD