MIR144 (microRNA mir-144) - Rat Genome Database

Name: MIR144
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer VCMap Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: MIR144 (microRNA mir-144) Canis lupus familiaris

Analyze

Symbol:

MIR144

Name:

microRNA mir-144

RGD ID:

12229029

Description:

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

Type:

ncrna

RefSeq Status:

PROVISIONAL

Previously known as:

cfa-mir-144; microRNA 144

RGD Orthologs

Human

Mouse

Rat

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

CanFam3.1 - Dog CanFam3.1 Assembly

Position:

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	9	43,031,035 - 43,031,094 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	9	43,031,035 - 43,031,094 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	9	42,186,177 - 42,186,236 (-)	NCBI
ROS_Cfam_1.0	9	43,848,755 - 43,848,814 (-)	NCBI
ROS_Cfam_1.0 Ensembl	9	43,848,755 - 43,848,814 (-)	Ensembl
UMICH_Zoey_3.1	9	42,632,295 - 42,632,354 (-)	NCBI
UNSW_CanFamBas_1.0	9	42,924,318 - 42,924,377 (-)	NCBI
UU_Cfam_GSD_1.0	9	43,002,958 - 43,003,017 (-)	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

adenoma (ISO)

Brain Injuries (ISO)

bronchiolo-alveolar adenocarcinoma (ISO)

type 2 diabetes mellitus (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cholesterol homeostasis (ISO)

erythrocyte differentiation (ISO)

gene expression (ISO)

male sex differentiation (ISO)

miRNA-mediated gene silencing (IEA)

miRNA-mediated gene silencing by inhibition of translation (ISO)

mRNA catabolic process (ISO)

mRNA destabilization (ISO)

negative regulation of amyloid precursor protein biosynthetic process (ISO)

negative regulation of cholesterol efflux (ISO)

negative regulation of DNA-binding transcription factor activity (ISO)

negative regulation of epithelial to mesenchymal transition (ISO)

negative regulation of gene expression (ISO)

negative regulation of glycoprotein biosynthetic process (ISO)

negative regulation of reverse cholesterol transport (ISO)

positive regulation of cell adhesion molecule production (ISO)

positive regulation of cholesterol storage (ISO)

positive regulation of gene expression (ISO)

positive regulation of inflammatory response (ISO)

positive regulation of interleukin-1 beta production (ISO)

positive regulation of interleukin-6 production (ISO)

positive regulation of mitochondrion organization (ISO)

positive regulation of tumor necrosis factor production (ISO)

regulation of high-density lipoprotein particle assembly (ISO)

response to bacterium (ISO)

Cellular Component

RISC complex (IEA)

RNAi effector complex (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

translation regulator activity (ISO)

References

Additional References at PubMed

PMID:16381832	PMID:18392026

Genomics

Comparative Map Data

MIR144
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	9	43,031,035 - 43,031,094 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	9	43,031,035 - 43,031,094 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	9	42,186,177 - 42,186,236 (-)	NCBI
ROS_Cfam_1.0	9	43,848,755 - 43,848,814 (-)	NCBI
ROS_Cfam_1.0 Ensembl	9	43,848,755 - 43,848,814 (-)	Ensembl
UMICH_Zoey_3.1	9	42,632,295 - 42,632,354 (-)	NCBI
UNSW_CanFamBas_1.0	9	42,924,318 - 42,924,377 (-)	NCBI
UU_Cfam_GSD_1.0	9	43,002,958 - 43,003,017 (-)	NCBI

MIR144
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	17	28,861,533 - 28,861,618 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p13 Ensembl	17	28,861,533 - 28,861,618 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	17	27,188,551 - 27,188,636 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	17	24,212,676 - 24,212,761 (-)	NCBI	NCBI36		hg18	NCBI36
Celera	17	24,047,975 - 24,048,060 (-)	NCBI
Cytogenetic Map	17	q11.2	NCBI
HuRef	17	23,396,841 - 23,396,926 (-)	NCBI		HuRef
CHM1_1	17	27,251,065 - 27,251,150 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	17	29,804,306 - 29,804,391 (-)	NCBI

Mir144
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	11	77,963,831 - 77,963,896 (+)	NCBI	GRCm39		mm39
GRCm39 Ensembl	11	77,963,831 - 77,963,896 (+)	Ensembl
GRCm38	11	78,073,005 - 78,073,070 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	11	78,073,005 - 78,073,070 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	11	77,886,507 - 77,886,572 (+)	NCBI	GRCm37		mm9	NCBIm37
Celera	11	85,572,607 - 85,572,672 (+)	NCBI		Celera
Cytogenetic Map	11	B5	NCBI

Mir144
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	10	62,961,348 - 62,961,430 (+)	NCBI	mRatBN7.2
mRatBN7.2 Ensembl	10	62,961,348 - 62,961,430 (+)	Ensembl
Rnor_6.0	10	65,291,365 - 65,291,447 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	10	65,291,365 - 65,291,447 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	10	66,340,681 - 66,340,763 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	10	61,939,438 - 61,939,520 (+)	NCBI		Celera
Cytogenetic Map	10	q25	NCBI

MIR144
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	12	45,088,959 - 45,089,035 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	12	45,088,958 - 45,089,033 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	12	47,176,953 - 47,177,028 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	endocrine system	hemolymphoid system
High
Medium
Low	1	3
Below cutoff

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_049384	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AAEX04000009	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAHUQ010000094	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAQRD010000103	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAAUVH010000313	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	REHQ01000009	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSCAFT00000032684

RefSeq Status:

Type:

CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
CanFam3.1 Ensembl	9	43,031,035 - 43,031,094 (-)	Ensembl

RefSeq Acc Id:

ENSCAFT00845016048

RefSeq Status:

Type:

CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
ROS_Cfam_1.0 Ensembl	9	43,848,755 - 43,848,814 (-)	Ensembl

RefSeq Acc Id:

NR_049384

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Dog Assembly	Chr	Position (strand)	Source
CanFam3.1	9	43,031,035 - 43,031,094 (-)	NCBI
Dog10K_Boxer_Tasha	9	42,186,177 - 42,186,236 (-)	NCBI
ROS_Cfam_1.0	9	43,848,755 - 43,848,814 (-)	NCBI
UMICH_Zoey_3.1	9	42,632,295 - 42,632,354 (-)	NCBI
UNSW_CanFamBas_1.0	9	42,924,318 - 42,924,377 (-)	NCBI
UU_Cfam_GSD_1.0	9	43,002,958 - 43,003,017 (-)	NCBI

Sequence:

show sequence

AGGATATCATCATATACTGTAAGTTTGCGACAAGATACTACAGTATAGATGATGTACTAG

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSCAFG00000020577	Ensembl
	ENSCAFG00845009106	Ensembl, ENTREZGENE
Ensembl Transcript	ENSCAFT00845016048	ENTREZGENE
miRBase	MI0008158	ENTREZGENE
NCBI Gene	MIR144	ENTREZGENE
RNAcentral	URS000041D05E	RNACentral
	URS00007E4E3C	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2019-04-02	MIR144	microRNA mir-144		microRNA 144	Symbol and/or name change	5135510	APPROVED

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD