Fmr1<sup>em1Sage</sup> (FMRP translational regulator 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Fmr1em1Sage (FMRP translational regulator 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs) Rattus norvegicus
Analyze
Symbol: Fmr1em1Sage
Name: FMRP translational regulator 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs
RGD ID: 11568041
Description: The ZFN mutant allele was produced by injecting zinc finger nuclease targeting rat Fmr1 into Sprague Dawley embryos. The resulting mutation was a 122bp deletion of the intron 7/exon8 junction occurred at 18533bp-18654bp and caused knockout of Fmr1 demonstrated by western blot.
ASSOCIATED WITH abnormal afterhyperpolarization; abnormal auditory behavior; abnormal habituation to a new environment; ASSOCIATED WITH autism spectrum disorder; fragile X syndrome
Type: allele  of Fmr1  
Previously known as: Fmr1^[em1Sage]; Fmr1em1Sage; fragile X mental retardation 1;zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs
Is Marker For: Strains:   SD-Fmr1em1Sage  
Latest Assembly: GRCr8 - GRCr8 Assembly
Position: No map positions available.


References

References - curated
# Reference Title Reference Citation
1. Experience-dependent changes in hippocampal spatial activity and hippocampal circuit function are disrupted in a rat model of Fragile X Syndrome. Asiminas A, etal., Mol Autism. 2022 Dec 20;13(1):49. doi: 10.1186/s13229-022-00528-z.
2. Auditory hypersensitivity and processing deficits in a rat model of fragile X syndrome. Auerbach BD, etal., Neurobiol Dis. 2021 Dec;161:105541. doi: 10.1016/j.nbd.2021.105541. Epub 2021 Oct 29.
3. Sensory hypo-excitability in a rat model of fetal development in Fragile X Syndrome. Berzhanskaya J, etal., Sci Rep. 2016 Jul 28;6:30769. doi: 10.1038/srep30769.
4. FMR1 deletion in rats induces hyperactivity with no changes in striatal dopamine transporter availability. D'Elia A, etal., Sci Rep. 2022 Dec 29;12(1):22535. doi: 10.1038/s41598-022-26986-2.
5. Deletion of the KH1 Domain of Fmr1 Leads to Transcriptional Alterations and Attentional Deficits in Rats. Golden CEM, etal., Cereb Cortex. 2019 May 1;29(5):2228-2244. doi: 10.1093/cercor/bhz029.
6. Fmr1 and Nlgn3 knockout rats: novel tools for investigating autism spectrum disorders. Hamilton SM, etal., Behav Neurosci. 2014 Apr;128(2):103-9. doi: 10.1037/a0035988.
7. Brain Cholesterol Biosynthetic Pathway Is Altered in a Preclinical Model of Fragile X Syndrome. Parente M, etal., Int J Mol Sci. 2022 Mar 21;23(6):3408. doi: 10.3390/ijms23063408.
8. Abnormal neuronal morphology and neurochemistry in the auditory brainstem of Fmr1 knockout rats. Ruby K, etal., Neuroscience. 2015 Sep 10;303:285-98. doi: 10.1016/j.neuroscience.2015.06.061. Epub 2015 Jul 9.

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Fmr1em1Sage-var1 chrX 147258833 147258954 CATGGCTGGCCTAAATGAAATTGACTTAATAATTGGTAAAACAAGTTAATCACTTGTGCATTTCTCTTCAGAGTTCAAGGCAGCTTGCCTCAAGATTTCATGAACAGTTTATCGTACGAGAA - deletion mRatBN7.2
Fmr1em1Sage-var1 chrX 154703661 154703782 CATGGCTGGCCTAAATGAAATTGACTTAATAATTGGTAAAACAAGTTAATCACTTGTGCATTTCTCTTCAGAGTTCAAGGCAGCTTGCCTCAAGATTTCATGAACAGTTTATCGTACGAGAA - deletion Rnor_6.0

Related Rat Strains
The following Strains have been annotated to Fmr1em1Sage


Expression

RNA-SEQ Expression


Sequence

Nucleotide Sequences


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2021-03-26 Fmr1em1Sage  FMRP translational regulator 1; zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs  Fmr1em1Sage  fragile X mental retardation 1;zinc finger nuclease induced mutant 1, Sigma Advanced Genetic Engineering Labs  Name changed 629549 APPROVED