Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   
Gene: Abcc6em4Qlju (ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 4, Qiaoli Li) Rattus norvegicus
Analyze
Symbol: Abcc6em4Qlju
Name: ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 4, Qiaoli Li
Description: This mutation was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG).
ASSOCIATED WITH pseudoxanthoma elasticum
Type: allele  of Abcc6  
Also known as: Abcc6em4Qlju
Is Marker For: Strains:   SD-Abcc6em4Qlju-/-  
Latest Assembly: Rnor_6.0 - RGSC Genome Assembly v6.0
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map1 RGD


Disease Annotations
References - curated

Genomics

Related Rat Strains

Expression


Sequence

Nucleotide Sequences

Additional Information

 
More on Abcc6em4Qlju
Alliance Gene
Ensembl Gene
NCBI Genome Data Viewer

RGD Object Information
RGD ID: 10413848
Created: 2015-11-25
Species: Rattus norvegicus
Last Modified: 2016-12-08
Status: ACTIVE



NHLBI Logo

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.