Abcc6<sup>em2Qlju</sup> (ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 2, Qiaoli Li) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Abcc6em2Qlju (ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 2, Qiaoli Li) Rattus norvegicus
Analyze
Symbol: Abcc6em2Qlju
Name: ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 2, Qiaoli Li
RGD ID: 10413846
Description: This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene.
ASSOCIATED WITH increased circulating phosphate level; ASSOCIATED WITH pseudoxanthoma elasticum
Type: allele  of Abcc6  
Previously known as: Abcc6em2Qlju
Is Marker For: Strains:   SD-Abcc6em2Qlju-/-   SD-Abcc6em2Qlju+/-  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map1 RGD


Disease Annotations     Click to see Annotation Detail View

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype
References

References - curated
# Reference Title Reference Citation
1. Abcc6 Knockout Rat Model Highlights the Role of Liver in PPi Homeostasis in Pseudoxanthoma Elasticum. Li Q, etal., J Invest Dermatol. 2017 May;137(5):1025-1032. doi: 10.1016/j.jid.2016.11.042. Epub 2017 Jan 19.
2. Data registered by Dr. Qiaoli Li's group Personal communication between Dr. Qiaoli Li's group and the RGD curators.

Genomics


Related Rat Strains
The following Strains have been annotated to Abcc6em2Qlju


Expression


Sequence

Nucleotide Sequences
RefSeq Transcripts NM_031013 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
null This allele was made by ZFN mutagenesis. The resulting mutation is deletion from genomic DNA position 102,013,133-102,013,111(TGCGCAGGCCTGAGGgtgagtcc; exon 1 sequence in upper case; intron 1 sequence in lower case)