Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   
Gene: Abcc6em2Qlju (ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 2, Qiaoli Li) Rattus norvegicus
Analyze
Symbol: Abcc6em2Qlju
Name: ATP-binding cassette, subfamily C (CFTR/MRP), member 6; zinc finger nuclease induced mutant 2, Qiaoli Li
Description: This allele was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene.
ASSOCIATED WITH increased circulating phosphate level; ASSOCIATED WITH pseudoxanthoma elasticum
Type: allele  of Abcc6  
Also known as: Abcc6em2Qlju
Is Marker For: Strains:   SD-Abcc6em2Qlju-/-   SD-Abcc6em2Qlju+/-  
Latest Assembly: Rnor_6.0 - RGSC Genome Assembly v6.0
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map1 RGD


Disease Annotations
Phenotype Annotations
References - curated

Genomics

Related Rat Strains

Expression


Sequence

Nucleotide Sequences

Additional Information

RGD Curation Notes
 
More on Abcc6em2Qlju
Alliance Gene
Ensembl Gene
NCBI Genome Data Viewer

RGD Object Information
RGD ID: 10413846
Created: 2015-11-25
Species: Rattus norvegicus
Last Modified: 2016-12-08
Status: ACTIVE



NHLBI Logo

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.