Btg2<sup>em7Mcwi</sup> (BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Btg2em7Mcwi (BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin) Rattus norvegicus
Analyze
Symbol: Btg2em7Mcwi
Name: BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin
RGD ID: 10054305
Description: The Btg2 mutation was generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos.
Type: allele  of Btg2  
Also known as: BTG family, member 2; CRISPR/Cas9 system induced mutant 7, Medical College of Wisconsin; Btg2em7Mcwi
Is Marker For: Strains:   SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi  
Latest Assembly: Rnor_6.0 - RGSC Genome Assembly v6.0
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map13 RGD


References

References - curated
1. Personal communication between Dr. Melinda Dwinell’s group and the RGD curators

Genomics


Related Rat Strains
The following Strains have been annotated to Btg2em7Mcwi


Expression


Sequence

Nucleotide Sequences


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2020-01-23 Btg2em7Mcwi  BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin  Btg2em7Mcwi  BTG family, member 2; CRISPR/Cas9 system induced mutant 7, Medical College of Wisconsin  Name changed 629549 APPROVED