Btg2<sup>em7Mcwi</sup> (BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin) - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Gene: Btg2em7Mcwi (BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin) Rattus norvegicus
Analyze
Symbol: Btg2em7Mcwi
Name: BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin
RGD ID: 10054305
Description: The Btg2 mutation was generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos.
Type: allele  of Btg2  
Previously known as: BTG family, member 2; CRISPR/Cas9 system induced mutant 7, Medical College of Wisconsin; Btg2^[em7Mcwi]; Btg2em7Mcwi
Is Marker For: Strains:   SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map13 RGD


References

References - curated
# Reference Title Reference Citation
1. Data registered by Dr. Melinda Dwinell’s group Personal communication between Dr. Melinda Dwinell’s group and the RGD curators

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Btg2em7Mcwi-var1 chr13 45535467 45535510 AAACCTTGAGTCTCTGCTCGCTCACGCAGCCCCGAGTCCTCAGG - deletion mRatBN7.2

Related Rat Strains
The following Strains have been annotated to Btg2em7Mcwi
SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi    


Expression


Sequence

Nucleotide Sequences


Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2020-01-23 Btg2em7Mcwi  BTG family, member 2; TALEN ystem induced mutant 7, Medical College of Wisconsin  Btg2em7Mcwi  BTG family, member 2; CRISPR/Cas9 system induced mutant 7, Medical College of Wisconsin  Name changed 629549 APPROVED