Gene: Gm41002 (predicted gene, 41002) Mus musculus |
|
Analyze |
|
Symbol: |
Gm41002 |
Name: |
predicted gene, 41002 |
RGD ID: |
10027390 |
MGI Page |
MGI |
Description: |
|
Type: |
ncrna (Ensembl: lncRNA)
|
RefSeq Status: |
MODEL |
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 13 | 74,107,073 - 74,111,918 (-) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 13 | 74,107,060 - 74,111,852 (-) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 13 | 73,958,954 - 73,963,776 (-) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 13 | 73,958,941 - 73,963,733 (-) | Ensembl | GRCm38 | | mm10 | GRCm38 | Celera | 13 | 76,288,495 - 76,293,325 (-) | NCBI | | Celera | | | Cytogenetic Map | 13 | C1 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
References
Genomics
QTLs in Region (GRCm39)
26884393 | Humsd7_m | humerus midshaft diameter 7, 16 week (mouse) | | | | | 13 | 3950000 | 76048119 | Mouse | 4142147 | Mvwf4_m | modifier of von Willebrand factor 4 (mouse) | | | Not determined | | | 20477612 | 112898424 | Mouse | 10412235 | Scgq5_m | spontaneous crescentic glomerulonephritis QTL 5 (mouse) | | | Not determined | | 13 | 36060908 | 96239162 | Mouse | 15039353 | Nmrs35_m | NAFLD-associated magnetic resonance shift 35 (mouse) | | | | | 13 | 40588253 | 74588253 | Mouse | 1300668 | Pas10_m | pulmonary adenoma susceptibility 10 (mouse) | | | Not determined | | 13 | 41489042 | 75489158 | Mouse | 4142331 | Bxs6_m | BXSB/MpJ autoimmune nephritis 6 (mouse) | | | Not determined | | | 45210442 | 83744746 | Mouse | 10412109 | Bxs7_m | BXSB/MpJ autoimmune nephritis 7 (mouse) | | | Not determined | | 13 | 45210442 | 83744746 | Mouse | 4142372 | Moo2_m | modifier of Odc2 (mouse) | | | Not determined | | X | 50318411 | 84318559 | Mouse | 1301666 | Eae13_m | susceptibility to experimental allergic encephalomyelitis 13 (mouse) | | | Not determined | | 13 | 50318411 | 84318559 | Mouse | 1300573 | Elsgp2_m | elevated serum gp70 2 (mouse) | | | Not determined | | 13 | 50616828 | 84617027 | Mouse | 14746975 | Manh74_m | mandible shape 74 (mouse) | | | | | 13 | 52477269 | 86477269 | Mouse | 1302073 | Pgct1_m | primordial germ cell tumor locus 1 (mouse) | | | Not determined | | 13 | 53820783 | 87820897 | Mouse | 1357563 | Bmch6_m | bone mechanical trait 6 (mouse) | | | Not determined | | 13 | 55384980 | 89385140 | Mouse | 4142314 | Tailaq3_m | tail length adjusted QTL 3 (mouse) | | | Not determined | | | 55720354 | 112431103 | Mouse | 4140959 | W10q17_m | weight 10 weeks QTL 17 (mouse) | | | Not determined | | | 55720354 | 112431103 | Mouse | 4141992 | W6q16_m | weight 6 weeks QTL 16 (mouse) | | | Not determined | | | 55720354 | 112431103 | Mouse | 4142241 | Tailq3_m | tail length QTL 3 (mouse) | | | Not determined | | | 55720354 | 112431103 | Mouse | 1558850 | Sgp3_m | serum gp70 production 3 (mouse) | | | Not determined | | 13 | 56470456 | 76971314 | Mouse | 10402414 | Sgp5_m | serum gp70 production 5 (mouse) | | | Not determined | | 13 | 56470456 | 105422186 | Mouse | 1357553 | Cia28_m | collagen induced arthritis 28 (mouse) | | | Not determined | | 13 | 56629249 | 96239162 | Mouse | 10412163 | Wra1_m | wheel running activity 1 (mouse) | | | Not determined | | 13 | 59132600 | 93132738 | Mouse | 1300941 | Skl6_m | skeletal size (tail length) 6 (mouse) | | | Not determined | | 13 | 64250821 | 98250945 | Mouse | 1301949 | Skull20_m | skull morphology 20 (mouse) | | | Not determined | | 13 | 64250821 | 98250945 | Mouse | 1301445 | Listr2_m | listeriosis resistance 2 (mouse) | | | Not determined | | 13 | 66744601 | 100744746 | Mouse | 1301593 | Heal8_m | wound healing/regeneration 8 (mouse) | | | Not determined | | 13 | 68053999 | 102054119 | Mouse | 14696726 | Kidrq3_m | kidney weight, right QTL 3 (mouse) | | | | | 13 | 68217066 | 102217066 | Mouse | 14747007 | Mancz11_m | mandible centroid size 11 (mouse) | | | | | 13 | 70111284 | 104111284 | Mouse | |
Expression
Sequence
RefSeq Acc Id: |
ENSMUST00000222479 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 13 | 74,107,060 - 74,111,852 (-) | Ensembl | GRCm38.p6 Ensembl | 13 | 73,958,941 - 73,963,733 (-) | Ensembl |
|
RefSeq Acc Id: |
XR_873671 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 13 | 74,107,073 - 74,111,918 (-) | NCBI | GRCm38 | 13 | 73,958,954 - 73,963,776 (-) | NCBI |
|
Sequence: |
CCCTGCAACCAAGGAGACGACCTACTGCAGGCTGTGAGACATAATAGAGGTGTATGGCTAGTGG TTAGCATAGATTGGATGGAAATGGAGCTAGCTGGTTCCCACAGAAGCTGAGATGCACATGCTTC ATAGAGAAACACCAAACTCTAAGCCTGACAAACTACCCTGAAGACTGCTCCTCTCTGGTGGCCA CCGTCTGGATGGCCCAATAACACTTCCTGGACTATCTGGACTATAGATGCTGAGTGCCTGCTGC CTGTGGGTGAAGTTCTTAGCTACTGATCCAGTGTCATGACTGTCTACCACCACCAGACTCCCTA CATGATGAGTGTAACCCTCTGAAACTGCAAGACCCCAATTAAATG
hide sequence
|
Promoters
RGD ID: | 15094312 |
Promoter ID: | EPDNEWNC_M2230 |
Type: | single initiation site |
Name: | Gm41002_1 |
Description: | predicted gene, 41002 [Source:MGI Symbol;Acc:MGI:5623887] |
SO ACC ID: | SO:0000170 |
Source: | EPDNEWNC (Eukaryotic Promoter Database, http://epd.vital-it.ch/) |
Experiment Methods: | Single-end sequencing. |
Position: | Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm38 | 13 | 73,963,733 - 73,963,793 | EPDNEWNC |
|
Additional Information
|
|