Gene: Gm40394 (predicted gene, 40394) Mus musculus |
|
Analyze |
|
Symbol: |
Gm40394 |
Name: |
predicted gene, 40394 |
RGD ID: |
10023225 |
MGI Page |
MGI |
Description: |
|
Type: |
ncrna (Ensembl: lncRNA)
|
RefSeq Status: |
MODEL |
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 12 | 36,932,970 - 36,953,013 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 12 | 36,927,964 - 36,953,032 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 12 | 36,882,971 - 36,903,014 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 12 | 36,877,965 - 36,903,033 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Celera | 12 | 38,326,822 - 38,348,735 (+) | NCBI | | Celera | | | Cytogenetic Map | 12 | A3 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
References
Genomics
QTLs in Region (GRCm39)
4142234 | Tmc1m3_m | Tmc1 modifier 3 (mouse) | | | Not determined | | 12 | 5418440 | 77031203 | Mouse | 1301163 | Eae16_m | susceptibility to experimental allergic encephalomyelitis 16 (mouse) | | | Not determined | | 12 | 7723158 | 41723301 | Mouse | 13208568 | Bmiq11_m | body mass index QTL 11 (mouse) | | | | | 12 | 8050000 | 40049999 | Mouse | 1301037 | Cd4ts5_m | CD4 T cell subset 5 (mouse) | | | Not determined | | 12 | 8352444 | 42352581 | Mouse | 1301723 | Fcsa7_m | femoral cross-sectional area 7 (mouse) | | | Not determined | | 12 | 9491004 | 43491112 | Mouse | 27226753 | Femd7_m | femur midshaft diameter 7, 10 week (mouse) | | | | | 12 | 9550000 | 84146774 | Mouse | 14746972 | Manh72_m | mandible shape 72 (mouse) | | | | | 12 | 10615281 | 44615281 | Mouse | 10401249 | Bglu15_m | blood glucose level 15 (mouse) | | | Not determined | | 12 | 10620642 | 44620809 | Mouse | 13524843 | Ppiq8_m | prepulse inhibition QTL 8 (mouse) | | | | | 12 | 11043194 | 50945796 | Mouse | 13207568 | Tcq14_m | total cholesterol QTL 14 (mouse) | | | | | 12 | 11660001 | 97176774 | Mouse | 4141516 | slwr_m | slowlearner (mouse) | | | Not determined | | | 12392475 | 46392614 | Mouse | 13524839 | Ppiq10_m | prepulse inhibition QTL 10 (mouse) | | | | | 12 | 13043195 | 54945798 | Mouse | 10043977 | Obq34_m | obesity QTL 34 (mouse) | | | Not determined | | 12 | 15147331 | 49147331 | Mouse | 1558978 | Cplaq10_m | circadian period of locomotor activity 10 (mouse) | | | Not determined | | 12 | 15341026 | 79040364 | Mouse | 26884413 | Bzwq9_m | bi-zygomatic width QTL 9, 10 week (mouse) | | | | | 12 | 16150001 | 47746783 | Mouse | 1301574 | Lmblgq5_m | limb length QTL 5 (mouse) | | | Not determined | | 12 | 17596447 | 80956883 | Mouse | 15039339 | Nmrs29_m | NAFLD-associated magnetic resonance shift 29 (mouse) | | | | | 12 | 17825852 | 51825852 | Mouse | 10043848 | Hdlq90_m | HDL QTL 90 (mouse) | | | Not determined | | 12 | 17839939 | 51840081 | Mouse | 1300870 | Ath18_m | atherosclerosis 18 (mouse) | | | Not determined | | 12 | 18259966 | 52260067 | Mouse | 12904956 | Edlmmq10_m | extensor digitorum longus muscle mass QTL 10 (mouse) | | | | | 12 | 19739833 | 53739833 | Mouse | 1302172 | Skts5_m | skin tumor susceptibility 5 (mouse) | | | Not determined | | 12 | 22148866 | 56149016 | Mouse | 1301989 | Hdlq18_m | HDL QTL 18 (mouse) | | | Not determined | | 12 | 29160685 | 63160884 | Mouse | 1300636 | Gct2_m | granulosa cell tumorigenesis 2 (mouse) | | | Not determined | | 12 | 29160685 | 63160884 | Mouse | 4141843 | Moen3_m | modifier of engrailed QTL 3 (mouse) | | | Not determined | | 12 | 29801584 | 63801733 | Mouse | 14747008 | Mancz10_m | mandible centroid size 10 (mouse) | | | | | 12 | 29863522 | 63863522 | Mouse | 10402492 | Dipa8_m | drug induced psychomotor activation 8 (mouse) | | | Not determined | | 12 | 34933872 | 68934019 | Mouse | 1300818 | Bbaa10_m | B.burgdorferi-associated arthritis 10 (mouse) | | | Not determined | | 12 | 35091004 | 65511019 | Mouse | 12879483 | Asp1_m | audiogenic seizure prone 1 (mouse) | | | | | 12 | 35285496 | 46801733 | Mouse | 4142002 | Tbqt3_m | tibia bone quality traits 3 (mouse) | | | Not determined | | 12 | 35285496 | 109936243 | Mouse | 14696690 | Rfq1_m | rearing frequency QTL 1, males (mouse) | | | | | 12 | 36049999 | 37049999 | Mouse | |
Expression
Sequence
RefSeq Acc Id: |
ENSMUST00000221321 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 12 | 36,927,964 - 36,953,032 (+) | Ensembl | GRCm38.p6 Ensembl | 12 | 36,877,965 - 36,903,033 (+) | Ensembl |
|
RefSeq Acc Id: |
XR_872686 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 12 | 36,932,970 - 36,953,013 (+) | NCBI | GRCm38 | 12 | 36,882,971 - 36,903,014 (+) | NCBI |
|
Sequence: |
ACATTATGGCTAATATCTACTTAATGGAATCTTTAAGCACTAACGGGAGAGATTTGATGGTGAC ATTCAATTTTGGAGCAAGTATCTGAAGATGTCTTCCTCTCTGCACATTTTTCAGGGTCCCTGCT TGAGAACAGTGCTTCCCACAGTGAATGTGTTTTCTCACTTGAATTAACAGACTCAAGAGGATTC TACACACACGTACCTAAAGGCAAACCTAATCTAGACCTTTTTTCATTAACACTCACATCCCAGG TGATTCTCAATTGTATCATTCAACAACAACAACAACAACACCTGACCATGAAACCATGTAATAT ACACGCCAGACACTGAAAAGAATTTGTGAGGTATTCTTCCTGCTTTGAATTGTTTGCTCAATTT TGATTGGCTGACATATATATGCAAATA
hide sequence
|
Additional Information
|
|