Gm41301 (predicted gene, 41301) - Rat Genome Database

Name: Gm41301
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Gene: Gm41301 (predicted gene, 41301) Mus musculus

Analyze

Symbol:

Gm41301

Name:

predicted gene, 41301

RGD ID:

10008359

MGI Page

MGI

Description:

Type:

ncrna

RefSeq Status:

MODEL

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	15	37,133,467 - 37,135,826 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm38	15	37,133,223 - 37,135,741 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
Celera	15	37,753,197 - 37,755,348 (-)	NCBI		Celera
Cytogenetic Map	15	B3.1	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

References

Genomics

Variants

Variants in Gm41301
88 total Variants

QTLs in Region (GRCm39)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
4141358	Ath22_m	atherosclerosis 22 (mouse)			Not determined			3464652	37464652	Mouse
10401902	Sicd2_m	seizure-induced cell death 2 (mouse)			Not determined		15	3474389	71197538	Mouse
4141952	W3q7_m	weight 3 weeks QTL 7 (mouse)			Not determined			3489694	78601286	Mouse
4142252	Tailaq4_m	tail length adjusted QTL 4 (mouse)			Not determined			3489694	78601286	Mouse
4142448	Tailq6_m	tail length QTL 6 (mouse)			Not determined			3489694	78601286	Mouse
1357559	Scfq2_m	subcutaneous fat pad weight QTL 2 (mouse)			Not determined		15	3489694	78601286	Mouse
1357659	Epfpq4_m	epididymal fat percentage QTL 4 (mouse)			Not determined		15	3489694	78601286	Mouse
11252136	Modvl4_m	modifier of vacuolated lens (mouse)					15	5620494	39620614	Mouse
26884409	Bzwq16_m	bi-zygomatic width QTL 16, 16 week (mouse)					15	6129481	38000244	Mouse
26884384	Skwq12_m	skull length QTL 12, 16 week (mouse)					15	6129481	50763396	Mouse
26884387	Skwq8_m	skull length QTL 8, 10 week (mouse)					15	6129481	68271849	Mouse
26884412	Bzwq10_m	bi-zygomatic width QTL 10, 10 week (mouse)					15	6129481	71471849	Mouse
26884417	Bzwq4_m	bi-zygomatic width QTL 4, 5 week (mouse)					15	6129481	72471849	Mouse
27226786	Feml11_m	femur length 11, 5 week (mouse)					15	6129481	75871849	Mouse
27095932	Ulnl11_m	ulna length 11, 16 week (mouse)					15	6129481	76384200	Mouse
27226717	Tibw4_m	tibia width 4, proximal, 10 week (mouse)					15	6129481	78684200	Mouse
27226734	Tibmd5_m	tibia midshaft diameter 5, 10 week (mouse)					15	6129481	86684201	Mouse
26884442	Sklq6_m	skull length QTL 6, 5 week (mouse)					15	6129481	100797881	Mouse
26884429	Zlq6_m	zygomatic length QTL 6, 10 week (mouse)					15	6829481	44963396	Mouse
27226721	Tibw8_m	tibia width 8, proximal, 16 week (mouse)					15	6929481	75871849	Mouse
27226773	Tibl16_m	tibia length 16, 10 week (mouse)					15	6929481	75871849	Mouse
27226777	Tibl8_m	tibia length 8, 5 week (mouse)					15	6929481	84584201	Mouse
27095940	Ulnl8_m	ulna length 8, 10 week (mouse)					15	7229481	55263396	Mouse
27226759	Feml17_m	femur length 17, 10 week (mouse)					15	7629481	55263396	Mouse
27226755	Feml22_m	femur length 22, 16 week (mouse)					15	7629481	59271849	Mouse
27095922	Pglq11_m	pelvic girdle length QTL 11, 10 week (mouse)					15	8129484	38763395	Mouse
26884439	Sklq11_m	skull length QTL 11, 10 week (mouse)					15	8129484	47663396	Mouse
10412172	Habiir5_m	hyperoxic acute lung injury imprinted region 5 (mouse)			Not determined		15	9273022	43311880	Mouse
4140994	Shali3_m	survival time to hyperoxic acute lung injury 3 (mouse)			Not determined			9273022	43311880	Mouse
4141192	Ssrq2_m	stress response QTL 2 (mouse)			Not determined			9273022	56186850	Mouse
1301433	Rapop5_m	radiation-induced apoptosis 5 (mouse)			Not determined		15	9273022	79474762	Mouse
1357526	Hyplip2_m	hyperlipidemia 2 (mouse)			Not determined		15	12402203	102896555	Mouse
1301020	Pheo_m	pheomelanin (mouse)			Not determined		15	13847006	47847148	Mouse
1302165	Yv_m	yellow value (mouse)			Not determined		15	13847006	47847148	Mouse
4141423	Nstr2_m	nerve sheath tumor resistance QTL 2 (mouse)			Not determined			14927587	48927756	Mouse
1301951	Eila3_m	ethanol induced locomotor activity 3 (mouse)			Not determined		15	14927587	48927756	Mouse
1302007	Bbaa14_m	B.burgdorferi-associated arthritis 14 (mouse)			Not determined		15	14927587	48927756	Mouse
1301499	Bdln2_m	body length 2 (mouse)			Not determined		15	15645343	49645470	Mouse
12859288	Criq1_m	Citrobacter rodentium infection QTL 1 (mouse)					15	16033954	50033954	Mouse
26884423	Zlq10_m	zygomatic length QTL 10, 16 week (mouse)					15	20600086	50763396	Mouse
14928313	Manh78_m	mandible shape 78 (mouse)					15	21484641	55484641	Mouse
12859289	Criq3_m	Citrobacter rodentium infection QTL 3 (mouse)					15	22593765	56593765	Mouse
4142160	Femwf10_m	femur work to failure 10 (mouse)			Not determined			22893014	56893160	Mouse
1301557	Bbaa22_m	B.burgdorferi-associated arthritis 22 (mouse)			Not determined		15	24462572	58462805	Mouse
1300967	Bdt6_m	bone density traits 6 (mouse)			Not determined		15	25295806	59295928	Mouse
4141409	Radsvq1_m	radiation sensitivity QTL 1 (mouse)			Not determined			25484978	59484978	Mouse
1301760	Dob9_m	dietary obesity 9 (mouse)			Body fat amount	adiposity index	15	26035680	37781301	Mouse
1300772	Bglq16_m	body growth late QTL 16 (mouse)			Not determined		15	26311780	60311880	Mouse
1301345	Bgeq14_m	body growth early QTL 14 (mouse)			Not determined		15	26311780	60311880	Mouse
1357514	Mbis3_m	Mycobacterium bovis-induced systemic lupus erythematosus 3 (mouse)			Not determined		16	26311780	60311880	Mouse
1301406	Egrd2_m	early growth rate (mouse)			Not determined		15	26311780	60311880	Mouse
27226800	Scvln20_m	sacral vertebrae length 2, 16 week (mouse)					15	26600086	66371849	Mouse
1301450	Bpq6_m	blood pressure QTL 6 (mouse)			Not determined		15	28282646	62282739	Mouse
1357512	Bsbob5_m	BSB obesity 5 (mouse)			Not determined		15	28282646	62282739	Mouse
26884425	Cvht2_m	cranial vault height 2, 5 week (mouse)					15	28800146	102008435	Mouse
26884392	Humsd8_m	humerus midshaft diameter 8, 16 week (mouse)					15	29300146	76084200	Mouse
26884452	Sklq17_m	skull length QTL 17, 16 week (mouse)					15	30200146	57963396	Mouse
1558985	Eae32_m	experimental allergic encephalomyelitis susceptibility 32 (mouse)			Not determined		15	32578416	103425899	Mouse
1300578	Cd8ts3_m	CD8 T cell subset 3 (mouse)			Not determined		15	34004694	68004804	Mouse
12904003	Opfaq12_m	open field activity QTL 12 (mouse)					15	34358911	38447901	Mouse
1301324	Cdif_m	color difference (mouse)			Not determined		15	35975906	69976019	Mouse

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	XR_875169	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC114008	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

XR_875169

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	15	37,133,467 - 37,135,826 (-)	NCBI
GRCm38	15	37,133,223 - 37,135,741 (-)	NCBI

Sequence:

show sequence

CTCTCACACAGCGGGACTGGAGGTCTGTTATCTTGATGAAACAGGGCTGCGTGGAGAGCATAAG
GACGTTGGGGTGGGGCTCGTTAGCCGCAGTCACTTCGTGCGGGAAGGCAGCTTCTAAGGAAGTT
TTGCTGGGTCCAGCATGTTGGCTCATGCCTGAAATTCTAGCACTCGGGAGGCGGAGGCAGGAGT
ATGGCCATGAATTCAAGAGCTGTGTTGGGGAGCCCCCCAGTTTTTCCTCTTCGGTTGCTATGAC
ACCCACCTACTCCATCGATGTAGGTAGACCTACCAAGTATTCCTTTCGAAGGCTGAAGTGAAGA
CCCTGGTGTGAAGTCTCCACCTATCTGCAGTTACTGGAAGCACAAATCCTGATGGATGAGCCAT
TTTAACCCACATCACCAAACGATGGGAAAAATTCTTTAAGAATGGACAAGTGCCTGTGTTAGGT
CACAGTTTCTTAATCCTTCTGGCAATTACAACGCCCCAGGAGGCCTAACAGTTTGCAGTGCCTA
GGTTGGGACCCTAGACTTGTAAGAAGCACCTTTCCTGCTGACACCACCCATCAGTGTGTAAGTT
AATTTTCCCGAAGGGTGACAAACACACACAATGTGCACATGTCTCTAACAAGCCCACATCTGAG
TGTAGCCTCAACAGATCTGAAAGCAGAGTCTTGAAAATATCTGTACACCCATGCTCACAACAGT
CACAGTAGCTGAAAACACCATGCATCCATCAGTGTAGATACAAATGAACGGAATGTGGTGTAGA
CACAAAGATCAGCACTCAACTTCACAAAGCGAATTGCAATGCGTACTAAAACAGGCAAAGCATC
ATGTTAAGGAAAGTAAGCAGTGGTAAGGAGACAGTTAGAGCAAGCTTCCATTTCTAAGAGAAAC
CTAGTCCGATTCAGAGACGGAAAGAGCAAGAGCTGGGGATAGGTGGGGCTGATTAATTCATAAA
GTGTCGGCTTTGCATAATAGCTTAAGCTCATTCTCTATTCCTAAACCCCAACACTTAGAATGGT
GTGTTAATTTGTTTGTTTGTTTGTTTGGTCGCTTGCTTGCTTAAGACAGACTCTTACTATGTAG
CCCTGACTGGCCTACCTAGTAGATACAACTGTGTATACCAGGTTGGCTTCAAAATCACAGAAAT
CCACCTGCCTCTACTCCTAAATGATGGGATTAAAGGCATGCACCACCACA

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
MGD	MGI:5624186	ENTREZGENE
NCBI Gene	Gm41301	ENTREZGENE
PhenoGen	Gm41301	PhenoGen

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message