Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 14,949 (bp)   Positions: 3
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
.001
.001
--
--
--
--
A
T
G
  82,403,899
  82,403,901
  82,408,691
G
TTGCGTGTGTGTGTGTGTGTGTGTGTGAGTGTGTGCAC/TTGCGTGTGTGTGTGTGTGTGTGTGTGTGAGTGTGTGCAC
32