Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 152,055 (bp)   Positions: 276
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
.156
.001
.004
.007
.137
.14
.003
.001
.001
.003
.013
.001
.526
.004
.012
.043
.049
.005
0
0
.001
.998
.455
.006
.021
.516
.004
.001
.288
.102
.001
.001
.873
.877
.97
.927
.015
.019
.001
.003
0
.28
.001
.069
.2
.046
.186
.132
.004
0
.005
.1
.098
.004
.764
.007
.003
.002
.013
.996
.005
.001
.005
.146
.179
.004
.006
.286
.297
.062
.005
.038
.012
.002
.295
.002
.401
.116
.003
0
.028
.517
.022
.003
.007
.004
.024
.002
0
.655
.003
.002
.009
.1
.009
.009
.002
.002
.086
.003
.002
.182
.841
.008
.313
.003
.001
.261
.228
.459
.879
.939
.05
.007
0
.002
.009
0
.011
.002
.003
0
.001
.008
.007
.002
.007
.002
.016
.017
.169
.058
.066
.884
.107
.013
.128
.006
.201
.005
.006
.194
.149
.215
.005
--
.094
0
.002
.063
.058
.009
.825
--
.243
.058
.001
.763
.792
.072
0
0
0
0
.031
0
.005
0
.987
.002
.004
--
--
.016
.196
.005
.065
.934
.169
.092
.002
.069
.082
.006
.002
.044
.002
.01
.925
.014
.003
.223
.129
.046
.023
.046
.05
--
.058
.402
.001
.01
.001
.002
.042
.034
0
.213
.002
.105
.084
.636
.205
.021
.009
.149
.001
.001
--
--
--
.369
.055
.047
.826
0
.17
.123
.054
.133
.215
.045
.005
1
.069
.002
.099
.006
.396
.001
.168
.295
.001
.032
.008
.002
.005
.766
.004
.014
.978
.994
.782
0
1
.003
1
.001
0
.954
.003
.004
.02
.048
.003
.106
.009
.046
.305
.002
.024
.039
.62
.229
0
.003
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
C
2
T
C
C
T
T
4
2
2
A
C
A
84
C
G
T
A
A
T
G
A
11
C
C
A
C
G
T
C
C
A
G
T
5
T
A
A
C
A
G
2
T
G
4
T
C
T
G
T
C
6
4
A
A
T
A
A
C
A
C
C
A
A
C
A
A
G
C
A
G
G
T
G
T
T
A
C
A
A
A
T
G
T
A
A
C
C
G
T
C
T
T
T
C
G
C
G
C
A
G
A
10
G
T
A
T
C
A
A
G
A
T
T
G
C
C
A
T
T
A
A
C
C
T
C
A
G
T
C
A
C
G
G
T
C
G
A
T
C
G
G
T
A
C
A
A
C
G
T
T
A
G
G
A
G
G
14
12
G
A
A
G
C
C
T
2
G
3
T
G
C
G
T
C
C
G
A
T
C
T
A
20
G
G
A
A
A
T
A
C
T
T
G
G
T
C
6
C
A
A
C
A
C
C
A
A
C
G
A
C
T
A
A
T
A
G
G
T
A
A
C
T
A
C
4
T
G
C
C
C
T
G
A
C
A
C
A
C
T
C
73
A
T
A
C
G
A
A
A
T
T
T
G
C
C
4
2
C
G
T
C
A
3
C
A
C
C
T
T
T
C
G
G
3
C
  146,485,300
  146,489,114
  146,490,135
  146,491,632
  146,491,669
  146,491,670
  146,492,872
  146,494,433
  146,494,435
  146,494,968
  146,495,033
  146,496,003
  146,496,182
  146,496,458
  146,496,940
  146,496,953
  146,496,959
  146,497,698
  146,499,017
  146,499,434
  146,500,184
  146,501,037
  146,501,596
  146,501,914
  146,502,054
  146,502,350
  146,502,720
  146,502,863
  146,503,368
  146,503,633
  146,503,776
  146,503,821
  146,503,988
  146,503,989
  146,504,020
  146,504,232
  146,505,050
  146,506,132
  146,506,296
  146,506,804
  146,507,642
  146,508,817
  146,509,502
  146,509,516
  146,509,624
  146,510,612
  146,511,378
  146,512,039
  146,512,245
  146,512,601
  146,513,044
  146,513,369
  146,513,371
  146,514,297
  146,514,465
  146,515,165
  146,515,990
  146,516,487
  146,517,379
  146,517,794
  146,518,447
  146,518,467
  146,519,731
  146,519,815
  146,519,830
  146,519,917
  146,519,924
  146,520,212
  146,520,297
  146,520,425
  146,520,537
  146,520,541
  146,521,504
  146,522,327
  146,523,124
  146,523,490
  146,523,745
  146,523,958
  146,524,381
  146,524,469
  146,524,539
  146,524,824
  146,525,924
  146,525,943
  146,525,945
  146,526,125
  146,526,143
  146,526,152
  146,526,180
  146,526,296
  146,526,448
  146,526,519
  146,526,636
  146,526,667
  146,527,191
  146,527,478
  146,527,493
  146,527,617
  146,527,920
  146,527,973
  146,528,566
  146,528,752
  146,528,978
  146,529,153
  146,529,375
  146,529,635
  146,530,092
  146,530,110
  146,530,675
  146,531,458
  146,531,680
  146,531,724
  146,531,852
  146,532,035
  146,532,301
  146,532,894
  146,532,924
  146,532,965
  146,533,955
  146,535,533
  146,535,539
  146,535,543
  146,535,570
  146,535,615
  146,535,616
  146,535,620
  146,535,654
  146,535,730
  146,535,772
  146,535,773
  146,536,925
  146,537,060
  146,537,936
  146,538,525
  146,539,435
  146,539,849
  146,541,322
  146,541,535
  146,542,737
  146,543,605
  146,543,976
  146,544,313
  146,545,880
  146,546,032
  146,546,564
  146,547,130
  146,547,702
  146,548,814
  146,548,828
  146,551,135
  146,551,158
  146,551,702
  146,552,550
  146,553,231
  146,553,986
  146,554,230
  146,554,312
  146,555,394
  146,555,396
  146,556,078
  146,556,142
  146,556,145
  146,556,146
  146,556,147
  146,556,318
  146,557,543
  146,557,832
  146,558,980
  146,560,004
  146,560,452
  146,562,539
  146,562,869
  146,563,293
  146,563,661
  146,563,813
  146,563,959
  146,564,405
  146,564,879
  146,565,898
  146,565,946
  146,566,290
  146,568,453
  146,568,487
  146,568,538
  146,568,897
  146,569,316
  146,569,711
  146,570,079
  146,570,351
  146,571,458
  146,571,706
  146,571,870
  146,572,121
  146,572,538
  146,572,572
  146,573,677
  146,575,782
  146,576,461
  146,576,853
  146,578,927
  146,578,948
  146,578,949
  146,579,227
  146,579,294
  146,579,640
  146,580,266
  146,580,567
  146,580,777
  146,581,706
  146,581,980
  146,582,421
  146,583,422
  146,583,787
  146,585,043
  146,585,152
  146,586,806
  146,587,798
  146,589,378
  146,590,092
  146,590,427
  146,590,935
  146,591,095
  146,591,262
  146,592,896
  146,593,613
  146,593,718
  146,593,802
  146,594,478
  146,594,754
  146,594,772
  146,596,037
  146,597,343
  146,597,368
  146,599,737
  146,601,404
  146,601,747
  146,603,793
  146,604,946
  146,605,071
  146,606,332
  146,606,394
  146,606,672
  146,609,193
  146,610,184
  146,610,801
  146,610,871
  146,611,271
  146,612,352
  146,613,251
  146,613,261
  146,614,993
  146,615,866
  146,616,165
  146,617,024
  146,618,063
  146,618,881
  146,619,154
  146,620,352
  146,621,192
  146,621,855
  146,624,532
  146,624,578
  146,625,322
  146,625,809
  146,626,849
  146,627,075
  146,627,586
  146,628,218
  146,628,345
  146,630,523
  146,630,577
  146,630,734
  146,631,066
  146,631,368
  146,633,153
  146,634,031
T
-
C
2
T
C
C
-/4
-/2
-
G
2
-
-/84
3
T
-
C
G
-
A
C
-
T
7
G
T
A
C
-
A
G
A
C
-
C
G
G
G
G
A
-
C
C
-
C
T
C
T
C
2
-/6
-
G
G
A
2
C
T
G
T
T
ATGTG/ATGTGTG
C
2
C
2
A
A
G
-
A
C
A
-
C
T
T
-
G
G
G
A
C
T
C
A
T
A
5
T
C
3
C
A
A
3
A
A
2
2
G
-
3
13
G
3
T
G
C
A
C
G
C
A
A
T
G
C
5
C
C
G
A
A
T
G
A
C
T
T
CAAAAAA/CAAAAAAAAA
T
A
G
T
10
T
C
T
A
T
G
6
T
G
T
A
A
C
C
G
2
A
G
-
A
-/14
-/12
A
3
2
8
8
T
C
-
A
-
A
A
T
17
-
T
T
A
T
C
T
5
G
-
A
2
G
-
-
-
G
T
A
C
T
T
2
T
-
A
-
5
9
5
T
T
G
G
2
A
G
T
A
2
G
11
G
A
C
C
G
G
4
2
G
T
-
-
2
CATATATATATATATAT/CATATATATATATATATATATAT
T
T
C
3/G
C
T
C
G
G
A
C
6/C
-
G
G
G
T
A
G
T
G
C
-
4
-
T
A
-
-
T
A
C
G
T
-
T
G
T
T
C
27
-
G
A
A
-
T