Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 119,159 (bp)   Positions: 281
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
.046
.005
.002
0
0
.001
.003
1
.01
0
0
.001
.011
0
.009
.004
.005
.021
.003
.002
.004
.002
.001
.006
0
.261
.002
0
--
--
.212
.007
.013
0
--
--
.206
.019
.037
.052
.358
.006
.006
.996
.02
.037
0
.003
0
0
.71
.012
.016
.003
0
.007
0
.002
0
.001
.001
.001
.492
.002
.143
.078
.144
.035
.097
.288
.016
--
.005
.01
0
0
0
0
.085
.003
.022
.202
.078
.075
.083
.006
.005
.056
.101
.014
.127
.033
.013
.002
.001
.009
.005
.002
0
.125
.054
.003
.004
.001
.511
.116
.222
.001
0
.001
0
.001
.154
.007
0
.001
0
.006
0
0
0
.001
.004
.01
.032
.026
.001
.002
.081
.009
.021
.011
.09
.01
.008
.044
.997
0
.001
.179
.003
.993
.986
0
0
.627
.028
.056
--
0
.04
.002
.024
.001
.003
.001
.002
0
.003
.001
.002
.01
.096
.012
.006
.183
.204
.001
.002
0
0
0
0
.008
.049
.001
.002
.554
.013
.019
0
.003
0
.039
.02
.06
.005
0
0
.078
.073
0
.004
.164
.038
.003
.003
0
0
.095
.006
.018
.002
.001
0
.011
0
.001
.016
.004
0
0
.001
.009
.437
.015
0
.029
.397
.45
.004
0
.001
0
.003
.023
0
.043
.197
.002
.001
.001
.03
0
.006
.216
.001
0
.081
--
.159
.036
.003
0
.001
.007
.005
.084
.004
.003
.002
.464
.003
.003
.008
.66
.003
.936
.662
.017
.835
.601
0
.001
.009
.048
.016
.019
.036
.07
.03
.127
.003
0
.004
.109
.019
.001
0
.003
.001
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
T
2
T
C
G
A
4
G
G
T
A
G
G
A
A
4
G
A
C
A
A
A
T
T
A
A
T
3
4
C
T
C
G
T
T
C
G
A
G
T
G
C
A
T
T
G
A
A
G
C
C
T
G
T
C
T
G
T
C
T
A
G
A
A
A
T
C
A
A
T
T
A
C
G
G
T
C
G
T
A
A
A
A
A
G
A
C
G
G
T
G
C
A
G
G
C
G
T
T
C
C
T
C
T
G
T
T
A
G
T
C
T
T
G
G
A
A
G
G
C
C
G
2
G
T
T
G
G
A
T
G
C
G
T
G
T
G
G
C
G
A
C
G
T
T
C
T
A
A
T
A
T
C
C
A
G
C
C
G
G
T
C
T
C
C
A
G
T
C
C
T
G
C
C
C
A
T
C
C
T
A
T
A
T
11
G
T
T
T
A
C
A
T
C
G
G
A
G
A
C
C
C
C
C
A
T
A
G
C
A
T
T
C
T
C
2
G
G
G
T
C
C
T
C
G
C
G
T
T
A
G
4
C
T
T
T
G
G
A
A
T
C
A
G
4
T
A
C
T
C
A
A
C
T
T
A
G
2
G
A
A
C
A
T
C
A
T
A
T
A
G
G
T
C
T
T
C
C
A
G
C
  124,491,790
  124,491,981
  124,491,990
  124,492,181
  124,492,268
  124,492,769
  124,492,796
  124,493,014
  124,493,219
  124,493,437
  124,493,606
  124,493,871
  124,494,002
  124,494,323
  124,495,067
  124,495,144
  124,495,148
  124,495,330
  124,495,680
  124,496,017
  124,496,680
  124,496,793
  124,496,804
  124,496,844
  124,496,957
  124,497,826
  124,498,577
  124,498,591
  124,499,684
  124,499,764
  124,499,839
  124,500,082
  124,501,205
  124,501,385
  124,502,240
  124,502,363
  124,502,483
  124,502,512
  124,502,532
  124,502,674
  124,502,993
  124,503,336
  124,503,337
  124,503,705
  124,504,289
  124,504,700
  124,504,899
  124,505,374
  124,505,418
  124,506,176
  124,508,120
  124,508,696
  124,508,809
  124,508,866
  124,509,243
  124,509,388
  124,509,397
  124,509,510
  124,509,605
  124,509,615
  124,509,622
  124,509,630
  124,509,785
  124,509,884
  124,510,292
  124,510,519
  124,511,277
  124,511,289
  124,511,368
  124,511,490
  124,512,097
  124,512,231
  124,512,322
  124,512,798
  124,513,045
  124,513,280
  124,513,311
  124,513,532
  124,514,622
  124,514,900
  124,515,255
  124,515,272
  124,515,485
  124,515,942
  124,516,043
  124,516,149
  124,516,532
  124,516,575
  124,516,834
  124,517,288
  124,517,357
  124,519,358
  124,519,420
  124,519,598
  124,519,871
  124,520,243
  124,520,408
  124,520,550
  124,521,113
  124,521,221
  124,521,226
  124,522,049
  124,522,356
  124,522,927
  124,523,140
  124,523,401
  124,523,736
  124,523,946
  124,524,129
  124,524,826
  124,525,044
  124,525,249
  124,526,586
  124,526,995
  124,527,046
  124,527,445
  124,527,501
  124,527,904
  124,528,842
  124,528,900
  124,528,908
  124,529,631
  124,529,733
  124,529,976
  124,530,846
  124,531,318
  124,531,990
  124,533,073
  124,533,116
  124,533,406
  124,533,431
  124,533,469
  124,533,693
  124,534,206
  124,535,114
  124,537,213
  124,537,396
  124,537,461
  124,537,462
  124,537,497
  124,537,502
  124,538,539
  124,538,542
  124,538,603
  124,538,836
  124,539,786
  124,539,990
  124,540,621
  124,542,474
  124,545,522
  124,545,789
  124,546,220
  124,546,493
  124,546,787
  124,548,698
  124,550,498
  124,550,587
  124,550,588
  124,551,017
  124,551,019
  124,551,764
  124,551,863
  124,553,349
  124,553,367
  124,553,553
  124,553,639
  124,553,689
  124,554,104
  124,555,108
  124,555,735
  124,556,000
  124,556,115
  124,556,296
  124,557,385
  124,557,443
  124,557,744
  124,557,755
  124,557,920
  124,558,671
  124,559,657
  124,560,474
  124,560,490
  124,560,742
  124,562,130
  124,562,455
  124,562,472
  124,562,589
  124,562,960
  124,563,129
  124,563,892
  124,563,893
  124,564,404
  124,564,957
  124,565,416
  124,565,428
  124,565,441
  124,565,491
  124,565,501
  124,565,502
  124,565,543
  124,566,137
  124,566,423
  124,566,603
  124,566,607
  124,566,675
  124,566,725
  124,566,749
  124,566,816
  124,566,837
  124,567,225
  124,567,433
  124,567,457
  124,567,503
  124,567,933
  124,568,421
  124,569,712
  124,569,956
  124,570,769
  124,571,004
  124,571,006
  124,571,199
  124,571,249
  124,572,444
  124,573,250
  124,573,868
  124,574,747
  124,575,294
  124,575,415
  124,576,166
  124,577,020
  124,577,154
  124,577,488
  124,577,499
  124,577,711
  124,578,851
  124,579,982
  124,583,618
  124,585,124
  124,585,947
  124,586,912
  124,588,392
  124,589,089
  124,589,898
  124,590,317
  124,591,842
  124,592,000
  124,592,052
  124,593,073
  124,593,169
  124,596,221
  124,597,049
  124,597,376
  124,598,111
  124,598,113
  124,598,124
  124,599,058
  124,599,178
  124,599,541
  124,599,987
  124,600,130
  124,600,924
  124,600,931
  124,601,096
  124,601,101
  124,601,307
  124,601,484
  124,602,407
  124,602,617
  124,602,942
  124,603,253
  124,603,257
  124,603,482
  124,603,915
  124,604,297
  124,604,840
  124,605,132
  124,605,140
  124,605,787
  124,606,609
  124,606,866
  124,606,966
C
-
C
T/C
T/G
C
-/4
A/G
A
C
C
A
A
G
G
-
T
2
T
G/A
G
G
C
C/T
2
G
-
-/3
-/4
2
-
T
C
C/T
C
5
A
T
A
C/T
-
T
G
A
C
A
G
G
A
T
2
C
A
C
T
C
A
C
2/C
C
G
A
3/A
G
G/A
C
G
G
G
C
C
G
T/C
A
C
C
T
T
C
G
G
C/A
G
G
C
G
T
A
A
C/T
T/G
T
C
A
A
T
A/G
G
C
-
T
A
A
C
A/G
-
3
C/A
A/G
C
T
2
A
T
C
G
G
A/G
A/G
G
T
A
-
A
C
C/T
T
A
G
C
A
T/C
A
C/T
A
-/T
A
A
A
-
T
2
2
-/T
C
-
G
C/A
5
C
G/A
A
T
T
G/A
4
G
T
2
2
C
T
C
T
T
C
A
-
T
T
C/T
A
A
2/C
T
G
C
G
-
-
G
C
G
C
-/11
-/G
C
C/T
C
3/A
5/C
G/A
C/T
-
-
C
-
-
C
T/C
T
T/C
-
-
C
-
-
-
-
G
C
C
T
2/T
3
-
A
C
A
2
A
T
C/T
G
A
T/C
T
C
C
G/A
C
-
G
A
C
C
C
T
C/T
-/A
-/T
A
T
A
-/4
3/T
3/A
A
2/T
T
T
2
4
TATCTACCCTCCCGCTAACTACCCTCCC/TAACTACCCTCCCGCTAACTACCCTCCCGCTAACTACCCTCCC
C
G
C/G
-
-
G/A
2
2
G/A
A
A
G
C
G
C
C
C
A
C
G/C
C
C
T
T
T
A
T