Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 23,708 (bp)   Positions: 35
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
.026
.003
.146
.032
.001
.036
.015
.016
.096
.001
.002
.023
.001
--
.163
.396
.003
.005
.061
.081
.045
.836
.185
--
.007
.308
.129
--
--
.002
.031
.205
--
--
.006
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
A
G
2
5
A
T
C
C
T
2
A
A
8
G
28
C
G
G
C
C
A
G
T
T
T
T
C
C
2
T
4
T
G
G
C
  65,878,377
  65,879,074
  65,879,528
  65,879,533
  65,879,540
  65,879,688
  65,879,698
  65,879,702
  65,880,189
  65,881,695
  65,881,696
  65,881,799
  65,882,122
  65,883,130
  65,883,172
  65,883,399
  65,887,272
  65,887,283
  65,887,398
  65,887,403
  65,889,109
  65,890,340
  65,892,154
  65,892,824
  65,893,193
  65,893,220
  65,893,273
  65,893,859
  65,894,006
  65,895,366
  65,896,135
  65,896,424
  65,898,526
  65,899,278
  65,899,379
G
-
-
-
4
15
A
A
C
-/2
-
G
-/8
-/G
-
T
2/G
T
5
T
6
GGT/GGTGTGT
5
-
TACACAC/TACACACAC
A
CAG/CAGAGAGAGAGAGAGAGAGAGAGAG
9
-
C
-/4
C
GGTGTGT/GGTGTGTGT
21
A