Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 539,891 (bp)   Positions: 108
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
.001
--
.008
--
--
.731
.439
.001
.255
.04
.096
--
.002
--
--
.009
.001
.001
.092
.006
.173
.141
.021
.009
.009
.011
.033
.001
.021
.002
.005
.003
.003
.006
.01
.008
.003
--
--
--
.009
.003
.001
0
.091
.08
.087
0
.012
.002
.01
.021
.091
.001
.125
.374
.426
.098
.427
--
--
.002
.031
.003
.025
.049
.036
.014
.204
.019
.019
.002
--
--
--
0
.006
0
.027
.001
--
.104
.185
.003
.003
--
--
.003
.001
.018
.027
.016
.069
.015
--
.178
.007
.006
--
--
--
--
0
.072
.004
.002
0
.001
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
T
C
2
G
A
A
A
A
T
4
T
2
68
C
G
2
G
2
T
G
G
T
T
A
2
C
C
T
G
A
A
A
A
A
A
A
T
C
T
C
A
C
44
A
14
4
2
A
T
A
T
A
A
2
10
4
2
4
G
2
C
G
2
A
A
4
2
2
2
C
A
C
12
A
G
G
C
C
22
2
A
6
A
A
T
2
C
6
4
A
G
G
G
A
6
A
G
A
12
G
G
C
C
C
C
G
T
G
  110,728,323
  110,739,545
  110,746,809
  110,773,108
  110,773,790
  110,781,925
  110,796,882
  110,798,079
  110,803,986
  110,806,622
  110,809,756
  110,810,630
  110,812,221
  110,814,320
  110,816,163
  110,818,890
  110,825,237
  110,826,429
  110,833,622
  110,835,130
  110,837,181
  110,837,194
  110,837,241
  110,837,550
  110,846,628
  110,846,629
  110,853,511
  110,853,723
  110,867,808
  110,869,026
  110,869,043
  110,869,054
  110,869,058
  110,869,078
  110,869,081
  110,869,084
  110,869,087
  110,892,127
  110,892,333
  110,892,554
  110,895,808
  110,896,030
  110,898,441
  110,900,480
  110,903,855
  110,903,865
  110,903,867
  110,909,050
  110,920,548
  110,933,067
  110,933,071
  110,933,075
  110,933,863
  110,935,315
  110,944,166
  110,944,172
  110,944,174
  110,945,302
  110,953,357
  110,967,715
  110,968,088
  110,977,891
  110,984,454
  110,984,492
  110,985,538
  110,986,856
  110,986,901
  111,000,672
  111,023,306
  111,039,144
  111,056,747
  111,066,797
  111,081,938
  111,083,244
  111,084,099
  111,088,662
  111,098,938
  111,100,178
  111,109,089
  111,109,109
  111,112,116
  111,120,600
  111,121,214
  111,143,780
  111,147,010
  111,148,877
  111,154,748
  111,166,301
  111,166,303
  111,178,895
  111,182,298
  111,182,304
  111,182,311
  111,184,065
  111,201,250
  111,207,733
  111,207,766
  111,207,767
  111,210,423
  111,210,585
  111,210,607
  111,210,611
  111,219,334
  111,221,090
  111,221,262
  111,221,284
  111,223,500
  111,223,504
2/T
57
-/2
2
-/A
2
G/A
G/A
5
-/4
TTATC/TTATCTATCTATCTATC
-/2
-
3
A/G
-/2
T
-/2
5/T
T/G
3/G
-/T
-
T/A
-/2
8/C
3/C
6
2
2
-
3
2
3
C
C
C
T/C
-/T
-/C
G/A
-
-/44
G/A
-/14
-/4
-/2
75/A
2
C
C
C
AGTGT/AGTGTGTGTGTGT
-/2
-/10
-/4
-/2
-
3
-/2
2
A/G
-/2
AGTGT/AGTGTGTGT
9/A
-/4
-/2
-/2
-/2
A
AAC/AACAC
T/C
-/12
G/A
A/G
-/G
CAGGCCTGAATGGTACAAGCTGTTCGAGATTAGTTCTAATGCCTTATCTTAATTTGGCTCCCAGAAACTA/CAGGCCTGAATGGTACAAGCTGTTGGAGATTAGTTCTAATGCCTTATCTTAATTTGGCTCCCAGAAACTA
2/C
-/22
-/2
2/A
-/6
G/A
3
2
-/2
A/C
-/6
-/4
T/A
-
-
-
G/A
-/6
53
A
G
-/12
T
A
A
T/C
11/C
A/C
A/G
C/T
A/G