Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 175,093 (bp)   Positions: 621
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
0
.187
.135
.077
.854
.001
0
.004
.3
.99
.99
.996
0
.002
.003
.012
.034
.362
.016
.025
.004
.097
.003
.004
.023
.001
.001
0
.005
0
--
--
--
--
--
.002
.28
0
.003
.002
0
.003
.029
.011
.002
0
.018
.004
.011
.002
.043
.192
.242
0
.002
.001
0
0
0
.001
.001
.013
.003
.037
.002
.029
.011
.018
.001
.006
.03
0
.024
0
.037
.003
.002
.008
.268
.234
.07
.749
.012
.001
0
.009
.003
.113
.005
.023
.047
.025
.48
.023
--
.001
.012
.002
.004
.018
.008
.157
.014
--
.051
0
.004
.009
.996
.103
.001
0
.001
0
.019
.659
0
.012
.006
.004
.057
.039
.007
.002
.006
.026
.073
.083
.016
.291
.001
.001
.001
.99
.002
.975
.758
.003
0
.005
.021
.035
.001
.05
.003
.003
.149
.01
.102
.014
.002
.001
.437
--
.003
.056
.014
.003
.001
0
.221
.009
.003
.005
.001
.992
.008
0
.012
.001
.003
.004
.009
.026
--
--
.003
.008
.237
.011
.013
.012
.012
--
--
--
--
--
--
.044
.006
.004
.001
.001
.001
.099
0
.387
.021
.008
0
0
.001
.169
.237
.033
.001
.001
.003
--
--
--
--
--
--
.003
.039
--
.002
.007
0
.001
0
0
0
.01
--
--
--
--
--
0
.002
.001
.004
.002
.002
0
.233
.997
0
.009
.007
.005
.106
.057
.095
.031
.064
.01
.009
.096
.059
0
.006
0
0
.073
.004
0
.001
.081
.002
0
.002
.003
.467
.081
.008
.005
.006
.008
0
.008
.008
.001
.001
.106
.019
.01
0
.001
.007
.023
.005
.163
.051
.003
0
.006
.012
.01
.003
.69
.817
.002
.007
.015
.005
.073
0
--
--
--
--
--
--
--
--
--
--
--
--
--
.217
.2
.002
.001
.001
0
.004
0
0
.04
.008
.011
.008
.012
.256
.18
.021
.35
.088
.01
.22
0
0
0
.102
0
.122
.137
.003
.003
.001
.01
.004
0
.002
.037
.001
.004
.005
0
0
.086
.264
.016
.031
.003
.001
.001
.001
--
.003
.004
.013
.026
0
.001
.024
.021
.024
.005
.013
.579
.819
.804
.01
.033
.034
.082
0
.102
.002
.023
.006
.731
.002
.708
.002
.104
.193
.47
.13
.101
.001
.001
.001
--
--
.003
.019
.002
.001
0
.003
.002
.006
.004
.008
.001
.846
.008
.049
--
.002
.009
.002
--
.337
.002
.006
.001
0
.642
.213
.002
.022
.002
0
.018
.004
.095
.056
.053
.279
.002
.569
.006
.01
.014
.014
.025
.002
.309
.003
.013
.004
.103
.88
.001
.111
0
.002
0
.021
.057
.003
.124
.746
.729
.019
.015
.008
.005
.002
.004
.008
.028
.075
.021
.001
.022
.017
.008
.006
.001
.029
.005
.002
.71
.001
.003
--
--
--
--
--
--
.22
.002
.157
.001
.01
.001
.003
.009
.059
.001
.006
.001
.057
.011
.001
.011
.229
.002
.019
.002
.002
.006
.004
.001
.001
.041
.003
.001
.257
.006
.003
.001
.001
.008
.005
0
.006
.021
.476
.001
.022
.037
.006
.019
.004
.487
.007
.174
.114
.009
.016
.23
.006
.039
.003
0
.012
.301
.001
.002
.16
.211
--
.001
.005
.271
.182
.041
.199
.001
.001
.003
.009
.005
.443
.843
.01
.001
.482
0
.003
.002
.021
.011
.1
.023
.015
--
--
--
.001
.013
--
--
--
.854
0
--
--
.005
0
.009
0
--
.122
.023
.023
.096
.001
.004
.001
0
--
.104
.107
.002
--
--
--
.022
.106
.002
0
.348
.002
0
.003
.071
0
.001
0
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
G
G
G
A
G
C
G
6
T
5
4
A
C
G
G
T
A
G
A
G
G
G
C
C
G
T
C
C
A
A
3
37
4
4
C
C
T
C
T
T
A
C
8
A
C
T
A
A
C
T
T
T
T
C
T
C
T
C
C
C
3
A
C
G
C
G
T
C
T
C
C
C
C
T
G
3
G
A
A
6
T
18
3
T
A
G
C
G
G
C
A
8
A
C
5
A
C
G
T
G
G
A
G
3
G
T
C
27
T
T
G
A
T
C
27
A
C
C
C
C
C
T
A
A
C
T
2
10
T
C
T
T
G
G
C
G
C
A
C
G
4
C
2
G
A
C
C
G
C
A
A
C
G
9
T
A
A
T
24
T
T
T
G
A
C
T
A
A
A
G
C
A
C
T
G
8
3
G
C
G
C
C
C
12
G
G
A
C
C
C
C
3
T
A
T
A
3
T
C
A
C
A
C
C
A
C
G
C
C
A
14
G
C
T
T
C
T
A
G
C
C
C
C
C
A
G
G
A
2
G
2
A
G
C
A
A
A
T
A
T
C
G
C
T
T
T
A
T
G
G
A
G
A
A
A
T
T
C
A
G
T
A
C
G
C
3
C
C
T
C
C
T
2
C
A
C
T
A
A
2
G
A
T
T
C
T
A
T
C
C
G
G
T
A
G
C
C
A
T
G
C
G
2
2
G
C
A
C
T
C
T
C
C
T
4
23
G
5
C
C
T
A
G
C
2
C
2
2
C
C
T
A
3
T
5
C
A
A
G
A
9
T
G
T
G
C
C
C
T
G
T
G
C
G
A
8
A
T
A
T
T
A
T
C
T
G
G
C
C
C
C
A
A
C
G
G
T
A
A
T
A
C
T
T
G
6
G
T
T
A
A
C
A
C
A
8
3
C
G
C
C
3
G
C
A
A
C
T
A
G
T
G
T
A
C
21
C
A
C
G
C
C
G
G
A
C
C
C
A
C
6
T
A
C
A
T
G
G
A
A
T
3
2
C
T
A
C
C
T
G
T
T
G
A
A
T
C
T
T
T
A
C
T
T
T
T
A
C
G
C
G
C
A
A
A
G
T
T
G
G
G
C
G
A
C
G
G
T
C
T
4
G
G
C
T
G
A
G
A
A
A
G
C
T
G
C
A
2
A
C
G
G
T
G
T
G
T
T
G
A
G
T
C
G
T
T
C
A
2
C
4
T
G
G
C
A
T
T
A
C
C
T
A
C
T
C
A
T
C
T
T
T
C
2
C
2
A
T
4
C
G
A
C
G
4
G
A
A
2
C
T
T
G
G
A
T
T
45
T
A
A
T
C
T
T
6
T
A
C
2
C
2
T
G
C
C
G
A
C
G
C
3
C
22
20
15
T
A
A
T
C
G
G
10
T
G
G
A
T
A
C
  144,697,953
  144,698,746
  144,698,996
  144,699,000
  144,699,566
  144,699,771
  144,699,949
  144,699,952
  144,700,163
  144,700,197
  144,700,198
  144,700,545
  144,700,805
  144,700,869
  144,701,162
  144,701,383
  144,701,630
  144,701,980
  144,702,057
  144,702,059
  144,702,150
  144,702,380
  144,702,575
  144,702,640
  144,702,672
  144,702,728
  144,702,912
  144,702,949
  144,702,986
  144,703,003
  144,703,074
  144,703,078
  144,703,130
  144,703,148
  144,703,165
  144,703,286
  144,703,324
  144,703,416
  144,703,511
  144,703,654
  144,703,830
  144,703,884
  144,703,924
  144,703,950
  144,704,145
  144,704,539
  144,704,554
  144,704,574
  144,704,587
  144,704,607
  144,704,878
  144,704,926
  144,704,984
  144,705,432
  144,705,849
  144,705,953
  144,705,992
  144,706,017
  144,706,019
  144,706,073
  144,706,150
  144,706,320
  144,706,360
  144,706,500
  144,706,617
  144,706,880
  144,707,754
  144,708,262
  144,708,400
  144,708,530
  144,708,568
  144,708,576
  144,708,777
  144,709,198
  144,709,509
  144,709,560
  144,709,985
  144,710,066
  144,710,563
  144,710,612
  144,710,684
  144,711,024
  144,712,853
  144,713,129
  144,713,490
  144,713,594
  144,713,976
  144,714,238
  144,714,400
  144,714,796
  144,714,889
  144,715,721
  144,716,165
  144,716,686
  144,716,954
  144,717,679
  144,717,888
  144,717,918
  144,718,440
  144,718,685
  144,718,809
  144,719,114
  144,719,460
  144,719,595
  144,720,702
  144,720,831
  144,720,881
  144,720,886
  144,721,659
  144,722,165
  144,722,408
  144,722,514
  144,722,801
  144,723,081
  144,723,122
  144,723,655
  144,723,865
  144,723,999
  144,724,010
  144,724,018
  144,724,045
  144,724,049
  144,724,098
  144,724,137
  144,724,934
  144,725,099
  144,725,113
  144,725,116
  144,725,167
  144,725,269
  144,725,641
  144,725,896
  144,725,942
  144,726,360
  144,726,677
  144,726,797
  144,726,839
  144,727,526
  144,727,567
  144,727,708
  144,727,739
  144,728,248
  144,728,337
  144,728,366
  144,728,962
  144,728,965
  144,729,019
  144,729,088
  144,730,027
  144,730,238
  144,730,300
  144,730,311
  144,730,396
  144,730,678
  144,730,724
  144,730,839
  144,730,947
  144,731,025
  144,731,224
  144,731,305
  144,731,567
  144,731,599
  144,731,672
  144,732,227
  144,732,512
  144,732,653
  144,732,985
  144,733,393
  144,733,419
  144,733,596
  144,733,632
  144,733,700
  144,733,718
  144,733,791
  144,734,006
  144,734,098
  144,734,811
  144,734,843
  144,734,877
  144,734,965
  144,734,978
  144,734,983
  144,735,037
  144,735,188
  144,735,203
  144,735,230
  144,735,235
  144,735,373
  144,735,402
  144,735,454
  144,735,556
  144,735,592
  144,735,625
  144,735,664
  144,735,702
  144,735,936
  144,736,383
  144,736,624
  144,736,915
  144,737,443
  144,737,500
  144,737,501
  144,737,502
  144,737,524
  144,737,646
  144,737,686
  144,737,928
  144,737,951
  144,738,149
  144,738,188
  144,738,199
  144,738,248
  144,738,318
  144,738,525
  144,738,549
  144,738,780
  144,738,890
  144,738,927
  144,738,935
  144,739,144
  144,739,175
  144,739,308
  144,739,712
  144,739,742
  144,740,290
  144,740,530
  144,740,676
  144,740,678
  144,740,717
  144,740,738
  144,740,812
  144,740,951
  144,740,977
  144,741,663
  144,741,826
  144,741,861
  144,742,072
  144,742,089
  144,742,618
  144,742,838
  144,743,021
  144,743,415
  144,743,493
  144,744,169
  144,744,443
  144,744,928
  144,744,951
  144,745,343
  144,745,555
  144,746,560
  144,746,717
  144,747,057
  144,747,076
  144,747,526
  144,747,707
  144,747,717
  144,747,830
  144,747,924
  144,747,955
  144,748,264
  144,748,347
  144,748,425
  144,748,443
  144,748,736
  144,748,760
  144,748,771
  144,748,815
  144,748,823
  144,749,254
  144,749,256
  144,749,272
  144,749,277
  144,749,358
  144,749,522
  144,749,535
  144,749,555
  144,749,557
  144,749,566
  144,749,586
  144,749,704
  144,750,101
  144,750,374
  144,750,524
  144,750,740
  144,750,748
  144,751,476
  144,751,532
  144,751,647
  144,751,683
  144,751,797
  144,751,849
  144,751,970
  144,752,088
  144,752,382
  144,752,679
  144,752,885
  144,752,979
  144,753,038
  144,753,114
  144,753,231
  144,753,267
  144,753,575
  144,753,642
  144,753,692
  144,753,721
  144,754,173
  144,754,250
  144,754,346
  144,754,395
  144,754,491
  144,754,618
  144,754,635
  144,754,748
  144,754,892
  144,755,047
  144,755,057
  144,755,343
  144,755,380
  144,755,389
  144,755,737
  144,755,972
  144,756,160
  144,756,404
  144,756,581
  144,756,886
  144,757,193
  144,757,582
  144,757,882
  144,758,101
  144,758,111
  144,758,349
  144,758,381
  144,758,429
  144,758,759
  144,759,029
  144,759,053
  144,760,091
  144,760,450
  144,761,023
  144,761,207
  144,761,228
  144,761,258
  144,761,862
  144,762,572
  144,762,573
  144,763,563
  144,763,618
  144,763,702
  144,763,705
  144,764,385
  144,764,553
  144,765,201
  144,765,206
  144,765,226
  144,765,265
  144,765,714
  144,765,922
  144,766,247
  144,766,344
  144,766,521
  144,766,761
  144,766,780
  144,768,388
  144,769,698
  144,770,868
  144,773,341
  144,773,359
  144,774,938
  144,775,018
  144,775,258
  144,776,193
  144,776,944
  144,777,184
  144,777,457
  144,777,625
  144,777,665
  144,777,923
  144,777,927
  144,778,005
  144,778,036
  144,778,037
  144,778,086
  144,778,297
  144,778,337
  144,778,357
  144,779,249
  144,779,373
  144,779,755
  144,779,781
  144,780,426
  144,780,596
  144,780,635
  144,780,686
  144,780,818
  144,781,122
  144,781,424
  144,781,865
  144,782,153
  144,782,976
  144,784,198
  144,784,200
  144,785,866
  144,786,357
  144,786,736
  144,786,944
  144,787,022
  144,787,346
  144,787,415
  144,787,635
  144,788,196
  144,788,213
  144,788,639
  144,790,137
  144,790,333
  144,792,803
  144,794,549
  144,795,884
  144,795,959
  144,796,102
  144,797,300
  144,801,383
  144,802,942
  144,802,943
  144,803,012
  144,803,189
  144,803,412
  144,803,441
  144,803,870
  144,804,171
  144,805,032
  144,805,302
  144,805,342
  144,805,473
  144,806,328
  144,806,391
  144,806,954
  144,808,437
  144,808,461
  144,809,046
  144,809,065
  144,809,173
  144,810,098
  144,810,099
  144,810,165
  144,811,482
  144,811,894
  144,812,396
  144,814,357
  144,814,586
  144,814,809
  144,815,193
  144,815,647
  144,815,811
  144,817,659
  144,819,443
  144,819,854
  144,820,913
  144,821,514
  144,821,625
  144,822,002
  144,822,093
  144,822,135
  144,822,199
  144,822,208
  144,822,211
  144,822,214
  144,822,222
  144,822,224
  144,822,371
  144,822,409
  144,822,561
  144,822,581
  144,822,592
  144,822,602
  144,822,621
  144,822,625
  144,822,731
  144,822,855
  144,823,004
  144,823,383
  144,823,922
  144,825,952
  144,827,254
  144,829,874
  144,830,174
  144,830,901
  144,831,488
  144,831,612
  144,831,788
  144,831,978
  144,832,224
  144,832,336
  144,832,508
  144,832,836
  144,832,841
  144,832,930
  144,833,015
  144,833,037
  144,833,202
  144,833,244
  144,833,318
  144,833,419
  144,833,437
  144,833,643
  144,833,650
  144,834,208
  144,834,378
  144,834,655
  144,834,656
  144,834,705
  144,834,762
  144,834,873
  144,834,961
  144,835,004
  144,835,188
  144,835,259
  144,835,317
  144,835,336
  144,835,426
  144,835,682
  144,835,687
  144,835,691
  144,835,805
  144,835,980
  144,836,045
  144,836,302
  144,836,925
  144,837,180
  144,837,236
  144,837,459
  144,837,801
  144,838,067
  144,838,251
  144,838,500
  144,838,608
  144,838,789
  144,838,827
  144,838,986
  144,839,000
  144,839,174
  144,839,187
  144,839,535
  144,839,555
  144,839,673
  144,840,087
  144,841,033
  144,841,702
  144,841,963
  144,842,160
  144,842,286
  144,842,806
  144,842,844
  144,842,988
  144,843,215
  144,843,224
  144,843,274
  144,843,467
  144,843,720
  144,844,033
  144,844,525
  144,844,678
  144,844,829
  144,844,859
  144,845,038
  144,845,250
  144,845,789
  144,845,828
  144,845,856
  144,845,979
  144,846,159
  144,846,326
  144,846,351
  144,848,527
  144,848,683
  144,849,798
  144,849,803
  144,850,480
  144,850,905
  144,851,203
  144,851,243
  144,851,755
  144,852,148
  144,853,945
  144,854,722
  144,855,105
  144,855,403
  144,856,810
  144,857,420
  144,857,512
  144,857,772
  144,857,996
  144,858,495
  144,860,017
  144,860,497
  144,861,027
  144,861,537
  144,862,109
  144,862,182
  144,862,920
  144,863,353
  144,863,459
  144,863,461
  144,864,911
  144,865,304
  144,865,306
  144,866,445
  144,867,016
  144,867,018
  144,867,020
  144,867,403
  144,867,462
  144,867,981
  144,869,110
  144,869,633
  144,870,110
  144,870,463
  144,870,499
  144,870,743
  144,870,834
  144,871,081
  144,871,127
A
15
A
C
A
T
-
-
C
-
-/4
G
CGTGCGTGCGTGCGTGTGTGTGTGTGTGT/CGTGCGTGCGTGCGTGTGTGTGTGTGTGTGTGT
A
2
C
G
A
G
A
A
A
-
A
A
C
T
T
G
G
-
-
-
-
7
A
G
T
C
C
G
G
-
2
T
A
T
G
T
C
G
G
2
A
C
T
C
-
-/C
T
-
T
A
A
T
2
C
G
C
T
T
G
T
A
A
-
A
G
G
-
C
-/18
-
C
G
A
A
A
A
T
G
-
G
5
-
G
4/C
A
C
T
T
G
A
-
2
C
T
-
-
G
A
G
A
T
-
15
A
56
G
G
G
A
G
G
G
A
-
-
C
T
A
C
C
2
T
C
T
G
T
20
-
T
-
A
G
T
T
A
T
C
G
A
A
-
C
G
G
C