Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 49,298 (bp)   Positions: 104
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
.018
0
.013
.002
.019
.013
.007
.014
.006
.317
.086
.309
.328
.449
.554
.785
.041
.003
0
.025
.031
.029
.147
--
--
--
.003
.006
.311
.014
0
0
.001
.018
.02
.003
--
--
--
--
.484
.052
0
.051
.136
.014
--
--
.029
.001
--
.018
.003
.02
.026
.177
.747
.01
.002
.001
--
.001
.001
--
0
0
.909
.006
.001
.031
0
.082
.026
.112
0
.001
.022
.001
.696
.004
.001
.027
.002
.043
.011
.012
.002
0
0
.073
.027
.018
.005
0
.001
.011
.037
.028
.006
.001
0
0
0
.011
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
C
C
C
T
T
T
2
C
T
T
T
A
T
C
2
2
A
G
G
T
G
C
G
G
4
G
C
C
G
A
C
C
A
C
G
A
G
2
T
T
C
A
T
G
T
G
G
G
A
T
G
A
C
6
4
T
T
T
C
A
2
A
G
C
A
G
C
C
T
T
T
G
T
T
A
T
C
A
27
A
G
C
G
C
T
G
G
T
A
A
A
T
G
C
C
G
C
C
G
C
T
T
G
T
  17,258,093
  17,258,527
  17,259,002
  17,259,077
  17,259,086
  17,259,093
  17,260,234
  17,260,700
  17,261,187
  17,262,506
  17,262,514
  17,262,613
  17,262,615
  17,262,643
  17,262,662
  17,262,887
  17,262,959
  17,263,346
  17,263,520
  17,263,988
  17,264,148
  17,264,939
  17,265,252
  17,265,534
  17,265,798
  17,265,844
  17,266,000
  17,266,176
  17,266,586
  17,266,607
  17,266,662
  17,267,127
  17,267,204
  17,267,455
  17,267,618
  17,268,574
  17,268,780
  17,269,000
  17,269,128
  17,269,190
  17,269,279
  17,269,344
  17,270,033
  17,270,278
  17,270,634
  17,271,193
  17,271,211
  17,271,241
  17,271,830
  17,272,016
  17,272,404
  17,272,541
  17,272,628
  17,274,321
  17,274,323
  17,275,136
  17,275,751
  17,275,769
  17,275,795
  17,275,799
  17,276,075
  17,278,016
  17,278,045
  17,279,029
  17,281,653
  17,282,186
  17,283,080
  17,283,709
  17,283,960
  17,284,291
  17,287,302
  17,287,470
  17,289,427
  17,290,436
  17,290,762
  17,291,542
  17,291,568
  17,291,824
  17,291,983
  17,292,482
  17,293,909
  17,294,170
  17,294,499
  17,295,292
  17,295,340
  17,295,395
  17,296,154
  17,296,391
  17,296,757
  17,298,289
  17,298,394
  17,300,365
  17,300,775
  17,300,983
  17,302,245
  17,302,621
  17,303,331
  17,303,682
  17,303,953
  17,304,460
  17,304,482
  17,305,306
  17,305,375
  17,306,876
2
T
-
-
G
G
-
T
C
2
2
2
G
T
-
-
2
A
A
C
C
T
C
3/G
-
-
T
T
C
G
-
T
T
T
GGTGTGTGTGTGAGTGTGT/GGTGTGTGTGTGAGTGTGTGT
G
A
-/2
5
3
T
G
C
2
C
15
3
7
G
C
15
2
T
-/6
-
-
2
2
8
C
-
T
A
6
T
A
T
T
-
49
C
2
C
2
G
A
T/C
T
-
G
A
T
A
T
C
A
-
C
G
T
C
C
A
T
T
A
5
T
T
T
G
C
-
C