Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 49,298 (bp)   Positions: 111
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
.007
.002
.006
.317
.086
.328
.617
.003
.025
.029
.667
.147
--
--
.003
.006
.311
.014
0
.007
0
.001
.02
.002
.003
--
--
--
--
--
.484
.052
.094
0
.051
.006
.019
.012
--
--
.018
.003
.438
.001
.208
.003
.002
.013
.001
.177
.332
.027
.747
.01
.003
.001
--
--
.036
.004
.001
.021
.02
--
--
.053
.008
.002
--
--
.044
0
.011
.023
0
0
.001
.006
.001
.505
.031
.003
.004
.011
.003
0
.082
.008
.023
.026
.112
0
0
.003
.002
0
0
.073
.027
0
.018
.005
.001
.037
.028
.006
.001
0
0
0
.011
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
C
G
T
T
T
T
G
G
T
C
C
G
2
G
C
C
G
A
C
G
C
A
G
G
A
C
G
4
2
T
C
A
G
T
G
C
G
G
G
12
A
C
T
G
C
A
4
G
T
T
G
G
T
T
G
A
A
T
G
A
G
A
T
C
4
T
C
C
T
T
A
T
G
A
A
G
G
C
T
G
T
G
T
G
C
T
G
G
C
T
T
A
C
C
C
T
A
A
A
T
T
G
T
C
C
G
C
T
T
G
T
  17,258,343
  17,259,075
  17,261,187
  17,262,506
  17,262,514
  17,262,615
  17,262,663
  17,263,346
  17,263,988
  17,264,939
  17,265,209
  17,265,252
  17,265,535
  17,265,844
  17,266,000
  17,266,176
  17,266,586
  17,266,607
  17,266,662
  17,266,825
  17,267,127
  17,267,204
  17,267,618
  17,268,349
  17,268,574
  17,268,713
  17,268,780
  17,268,998
  17,269,000
  17,269,128
  17,269,279
  17,269,344
  17,269,638
  17,270,033
  17,270,278
  17,270,501
  17,271,099
  17,271,195
  17,271,213
  17,271,274
  17,272,541
  17,272,628
  17,272,776
  17,273,097
  17,274,136
  17,274,184
  17,274,337
  17,274,564
  17,274,699
  17,275,136
  17,275,261
  17,275,455
  17,275,751
  17,275,769
  17,275,792
  17,275,799
  17,275,957
  17,276,224
  17,276,818
  17,277,781
  17,278,045
  17,278,600
  17,278,798
  17,279,029
  17,279,030
  17,279,078
  17,279,436
  17,279,657
  17,280,285
  17,280,457
  17,281,353
  17,281,473
  17,281,508
  17,281,537
  17,281,653
  17,281,684
  17,282,239
  17,283,709
  17,283,960
  17,283,983
  17,284,291
  17,285,111
  17,286,404
  17,286,665
  17,287,137
  17,287,302
  17,287,470
  17,287,639
  17,288,911
  17,289,427
  17,290,436
  17,290,762
  17,292,855
  17,293,238
  17,293,649
  17,296,391
  17,296,757
  17,298,289
  17,298,394
  17,299,423
  17,300,365
  17,300,775
  17,302,180
  17,303,331
  17,303,682
  17,303,953
  17,304,460
  17,304,482
  17,305,306
  17,305,375
  17,306,876
G
7
C
2
2
G
-
A
C
T
T
C
-
-
T
T
C
G
-
A
T
T
GGTGTGTGTGTGAGTGTGT/GGTGTGTGTGTGAGTGTGTGT
A
G
T
A
-/4
-
5
T
G
A
C
2
T
A
T
C
-
2
T
C
A
T
C
-
A
C
-
A
A
2
2
7
C
G
C
A
T
A
G
G
6/C
-
2
T
G
C
G
G
A
A
C
T
T
A
T
-
2
49
A
2
T
T
C
2
3
T
C
2
G
T
T
T
C
G
T
C
C
C
A
G
5
T
T
T
G
C
-
C