Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 14,709 (bp)   Positions: 80
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
0
.032
.021
.001
.191
.078
.002
.001
0
0
.113
.042
.173
.032
.002
.042
.01
.206
.032
.011
.001
.004
.001
.055
.001
0
.001
0
0
.002
.276
0
.001
.061
.025
.033
.078
.066
.003
.411
.763
.801
.005
--
.007
.01
.094
.109
.002
.001
0
.648
.005
.997
.977
.002
.003
.001
.008
.002
.068
.023
.05
.165
.207
--
.007
.006
.025
.004
.001
0
.001
.001
0
.011
.231
.002
.01
.001
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
C
T
A
G
A
G
T
C
T
A
15
G
G
A
T
G
A
C
A
A
C
C
6
A
A
A
G
T
C
C
A
T
A
G
A
C
T
G
7
A
T
2
C
C
T
A
C
G
T
C
T
C
G
A
G
A
G
G
A
C
G
G
4
2
8
T
2
A
A
A
T
C
A
G
A
C
2
T
C
A
  194,105,970
  194,105,996
  194,106,000
  194,106,129
  194,106,954
  194,106,977
  194,107,450
  194,107,551
  194,107,619
  194,107,910
  194,107,985
  194,108,084
  194,108,207
  194,108,353
  194,108,534
  194,108,592
  194,108,604
  194,108,654
  194,108,664
  194,108,682
  194,108,724
  194,108,737
  194,108,884
  194,109,450
  194,109,625
  194,109,708
  194,110,372
  194,110,502
  194,110,504
  194,110,524
  194,110,544
  194,110,733
  194,110,799
  194,110,809
  194,110,859
  194,110,913
  194,110,976
  194,110,992
  194,111,021
  194,111,391
  194,111,603
  194,111,622
  194,111,860
  194,112,120
  194,112,532
  194,113,146
  194,113,257
  194,113,431
  194,113,588
  194,113,667
  194,114,019
  194,114,800
  194,115,004
  194,115,241
  194,115,415
  194,115,985
  194,116,024
  194,116,189
  194,116,438
  194,116,449
  194,116,670
  194,116,760
  194,116,827
  194,117,193
  194,117,593
  194,117,884
  194,118,004
  194,118,005
  194,118,091
  194,118,093
  194,118,097
  194,118,182
  194,118,319
  194,118,510
  194,118,602
  194,118,819
  194,118,910
  194,120,020
  194,120,285
  194,120,393
T
C
G
A
-
A
A
G
C
T
-
A
C
C
C
A
-
T
G
G
T
T
-
4
G
G
T
C
T
27/C
5
G
C
A
G
2
C
A
-
G
7
-/2
T
17
2
G
T
A
C
T
A
T
T
G
A
4
A
A
3
CACACACACACACACACACAG/CACACACACACACACACACACACACAG
A
A
-
-
-
C
-/2
-/A
2
2
-
T
G
A
G
T
-/2
A
T
G