Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 61,451 (bp)   Positions: 115
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
.132
--
--
.281
--
--
.027
0
.189
.082
--
--
--
--
.069
.018
.025
.168
.001
.002
.129
--
--
.024
.004
.073
.003
.082
--
.034
.046
.023
--
--
--
--
--
.009
--
--
--
--
.041
.011
.003
0
.003
.392
.052
.023
.075
.038
.248
.001
.143
.602
.03
.003
.002
.008
.045
.062
.134
.024
.018
.047
--
.01
.008
.01
.012
--
--
--
.005
.04
.023
.021
--
.969
0
.206
.002
.006
.06
.891
.876
.011
.21
.191
.037
.091
.002
.01
.305
.006
.055
0
0
.118
.105
.015
.001
.025
--
--
.024
--
--
--
0
.158
.009
--
.061
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
A
3
2
A
G
T
C
4
C
C
A
6
T
G
A
G
G
T
12
C
G
A
T
G
T
A
G
C
G
A
C
G
C
T
7
G
T
A
18
A
5
C
A
T
A
C
G
G
T
A
C
G
G
4
C
A
G
G
C
A
C
C
T
G
G
T
T
2
A
T
20
2
A
G
T
T
6
G
T
T
A
T
C
C
A
C
A
A
2
C
T
4
A
T
C
G
C
G
G
16
A
A
G
A
T
40
A
G
T
G
T
119
C
4
C
  19,660,328
  19,661,614
  19,661,615
  19,661,870
  19,662,719
  19,663,000
  19,663,286
  19,663,483
  19,663,722
  19,663,992
  19,665,148
  19,665,149
  19,665,222
  19,665,227
  19,666,320
  19,666,326
  19,666,585
  19,666,744
  19,669,068
  19,669,329
  19,669,697
  19,670,342
  19,672,295
  19,672,444
  19,674,314
  19,674,462
  19,675,886
  19,678,696
  19,679,044
  19,680,394
  19,680,561
  19,680,648
  19,681,917
  19,683,292
  19,683,547
  19,684,171
  19,684,194
  19,684,451
  19,684,724
  19,685,441
  19,685,447
  19,685,858
  19,687,516
  19,688,794
  19,688,802
  19,688,894
  19,688,942
  19,689,412
  19,689,703
  19,691,534
  19,691,657
  19,692,242
  19,692,423
  19,692,476
  19,693,362
  19,693,669
  19,695,465
  19,695,467
  19,695,473
  19,695,484
  19,695,489
  19,695,492
  19,695,502
  19,695,513
  19,695,515
  19,695,710
  19,696,338
  19,697,479
  19,697,787
  19,697,922
  19,697,923
  19,697,991
  19,698,003
  19,698,026
  19,698,238
  19,698,751
  19,699,335
  19,701,275
  19,702,173
  19,702,306
  19,702,431
  19,703,739
  19,703,840
  19,703,846
  19,704,762
  19,706,581
  19,706,582
  19,706,668
  19,707,100
  19,707,101
  19,707,817
  19,708,163
  19,708,780
  19,708,999
  19,709,475
  19,710,179
  19,711,104
  19,712,090
  19,712,116
  19,712,508
  19,712,868
  19,712,913
  19,713,157
  19,713,279
  19,714,252
  19,714,496
  19,715,847
  19,716,559
  19,716,563
  19,716,564
  19,716,910
  19,717,005
  19,717,954
  19,718,108
  19,719,303
G
-
-/2
AT/ATT
A
25
G
-
T
A
2/A
-/6
C
A
G
C
A
-
-
T
A
G
-
C
C
2
A
G
2
C
A
A
G
C
-
T
C
T
-
T
-
-/C
G
A
T
A
A
3
C
4
2
A
C
-
16
AACACACAC/AACACACACACACACAC
7
37
2
G
2
A
2
T
T
A
-
-
T
5/T
-/20
-/2
15
C
A
C
-/6
A
TAGATAGATAGATAAAG/TAAATAAATAAAGAAAGAAAG
C
G
G
T
T
G
A
T
G
-/2
15/C
C
-
G
C
2
A
T
A
C
-
T
G
T
3
C
-/40
G
27
5
36
7
-
CTTTTTTT/CTTTTTTTTT
-
G