Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Strain: F344-Il2rgem1IexasRag2em1Iexas

Symbol: F344-Il2rgem1IexasRag2em1Iexas
Strain: F344-Il2rgem1Rag2em1
Substrain: Iexas
RGD ID: 38599190
Citation ID: RRID:RGD_38599190
Ontology ID: RS:0004825
Alleles: Rag2em1Iexas;   Il2rgem1Iexas
Also Known As: NBRP Rat No: 0895; Duble KO; F344-Il2rg^[em1Iexas]Rag2^[em1Iexas]
Type: mutant
Available Source: National BioResource Project for the Rat in Japan
Origination: National BioResource Project for the Rat in Japan
Description: This strain was established by targeting Il2rg gene and Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation.This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on X chromosome and 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. The sexual maturation is a bit late.
Coat Color: albio
Last Known Status: Cryopreserved Embryo (as of 2020-09-14)
Research Usage severe combined immunodeficiency
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr83108,357,399 - 108,367,186RGD_MAPPER_PIPELINE
GRCr8X70,435,340 - 70,439,052RGD_MAPPER_PIPELINE
mRatBN7.2387,902,373 - 87,910,227RGD_MAPPER_PIPELINEmRatBN7.2
mRatBN7.2X66,395,330 - 66,399,026RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0391,191,837 - 91,200,134RGD_MAPPER_PIPELINERnor_6.0
Rnor_6.0X71,165,378 - 71,169,078RGD_MAPPER_PIPELINERnor_6.0
Rnor_5.0X72,017,856 - 72,021,516RGD_MAPPER_PIPELINERnor_5.0
Rnor_5.0397,851,318 - 97,859,615RGD_MAPPER_PIPELINERnor_5.0
RGSC_v3.4X89,342,055 - 89,345,715RGD_MAPPER_PIPELINERGSC_v3.4
RGSC_v3.4386,764,810 - 86,773,438RGD_MAPPER_PIPELINERGSC_v3.4






References

References - curated
# Reference Title Reference Citation
1. A high-quality severe combined immunodeficiency (SCID) rat bioresource. Miyasaka Y, etal., PLoS One. 2022 Aug 12;17(8):e0272950. doi: 10.1371/journal.pone.0272950. eCollection 2022.
2. Strains registered by the National Bio Resource Project for the Rat in Japan Personal Communication with NBRP

Region


Additional Information