This strain was established by targeting Il2rg gene and Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation.This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on X chromosome and 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. The sexual maturation is a bit late.