Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Strain: LE-Gad1em15Yyan

Symbol: LE-Gad1em15Yyan
Strain: LE-Gad1em15
Substrain: Yyan
RGD ID: 149735560
Citation ID: RRID:RGD_149735560
Ontology ID: RS:0004999
Alleles: Gad1em15Yyan
Variant(s): Gad1em15Yyan-var1
Also Known As: NBRP Rat No: 0906; LE-Gad1^[em15Yyan]
Type: mutant
Available Source: National BioResource Project for the Rat in Japan
Origination: Gunma University Graduate School of Medicine
Description: Knockout rats carry a 291 bp deletion, including exon-6 of Gad1 gene using the CRISPR/Cas9. Glutamate decarboxylase (GAD; there are two isoforms, GAD65 and GAD67) is an enzyme that synthesizes the neurotransmitter GABA. In this strain, the Gad1 gene encoding GAD67 was knocked out. In homozygous rats, low body weight at 3 weeks and impaired spatial learning memory were observed. Some homozygous rats die as juveniles. This strain is maintained in heterozygotes.
Coat Color: Black hood
Inbred Generations: F2 -F3
Last Known Status: Cryopreserved Sperm (as of 2021-07-22)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8375,777,260 - 75,818,099RGD_MAPPER_PIPELINE
mRatBN7.2355,386,152 - 55,386,442RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0356,861,440 - 56,902,139RGD_MAPPER_PIPELINERnor_6.0
Rnor_5.0363,479,963 - 63,519,879RGD_MAPPER_PIPELINERnor_5.0
RGSC_v3.4352,789,370 - 52,830,038RGD_MAPPER_PIPELINERGSC_v3.4





References

References - curated
# Reference Title Reference Citation
1. CRISPR/Cas9-engineered Gad1 elimination in rats leads to complex behavioral changes: implications for schizophrenia. Fujihara K, etal., Transl Psychiatry. 2020 Dec 8;10(1):426. doi: 10.1038/s41398-020-01108-6.
2. Impact of GAD65 and/or GAD67 deficiency on perinatal development in rats. Jiang W, etal., FASEB J. 2022 Feb;36(2):e22123. doi: 10.1096/fj.202101389R.
3. Gad1 knock-out rats exhibit abundant spike-wave discharges in EEG, exacerbated with valproate treatment. Liu D, etal., Front Neurol. 2023 Sep 26;14:1243301. doi: 10.3389/fneur.2023.1243301. eCollection 2023.
4. Strains registered by the National Bio Resource Project for the Rat in Japan Personal Communication with NBRP

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Gad1em15Yyan-var1 chr3 55386152 55386442 TAATGGTTGGCCATCTTCTTCCCCCTTCTCCAGCTCGGAGAGCTCCATCAGACCATGGGACAGATCAAGTCACGTGCTCCAGCCCTTTGCTCTGAAGATAGCTTGGAAAATCCAGCTTTGCCTTAATGCTTGCCTGTTATCTCTCTAGGTCACCCTCGGTTTTTCAACCAGCTCTCTACTGGTTTGGATATCATTGGTTTAGCTGGCGAATGGCTGACATCAACTGCCAATACCAATATGTAAGTCTCACGTGTTCCTTTCCTATATGCACACATGATGTATATGGCTTGT - deletion mRatBN7.2

Additional Information