Strain Report - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Strain Registration

Strain: SHR-C3em1Kyo

Symbol: SHR-C3em1Kyo
Strain: SHR-C3em1
RGD ID: 149735371
Citation ID: RRID:RGD_149735371
Ontology ID: RS:0004986
Alleles: C3em1Kyo
Also Known As: SHR-C3^[em1Kyo]
Type: advanced_intercross_line
Available Source: National BioResource Project for the Rat in Japan
Origination: National BioResource Project for the Rat in Japan
Description: ZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cagggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZFN systems were injected into the pronucleus of SHR/Izm embryos. The DNA of 10 day old pups was extracted and screened for ZFN-induced mutations. Briefly, DNA extracted from ear tissue was amplified using primers flanking the target sequence (forward primer: 5'-ACTCTTCCCTGTCTTGCGTC-3'; reverse primer: 5'-AATAGAGGCCACCAATGCAC-3'). This mutant revealed a 9-base frameshift deletion of bases 1815-1824 (ggctagtgg).
Coat Color: white
Inbred Generations: F4
Last Known Status: Cryopreserved Embryo (as of 2021-07-20)






References

References - curated
# Reference Title Reference Citation
1. Strains registered by the National Bio Resource Project for the Rat in Japan Personal Communication with NBRP

Region


Additional Information