Strain Report - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Strain Registration

Strain: SD-Ahrem1Soar

Symbol: SD-Ahrem1Soar
Strain: SD-Ahrem1
Substrain: Soar
RGD ID: 13702080
Citation ID: RRID:RRRC_00831
Ontology ID: RS:0004598
Alleles: Ahrem1Soar
Also Known As: Ahr null; SD-Ahr^[em1Soar]
Type: mutant
Available Source: Rat Resource and Research Center
Origination: University of Kansas Medical Center
Description: CRISPR/Cas9 targeted deletion of the Ahr basic helix loop helix DNA binding domain of the rat Ahr was injected into the embyos of outbred HsdHot:SD. The gRNA was targeted to Exon 2 of the Ahr gene, which encodes the bHLH DNA binding domain (target sequence: CTTCTAAACGACACAGAGACCGG; corresponding to NM_001308254). The established Ahr null strain lacks responsiveness to Ahr ligands.
Genetic Status: Homozygous
Last Known Status: Cryopreserved Sperm; Cryorecovery (as of 2019-01-21)
Research Usage Toxicology, reproduction, cancer
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8657,961,423 - 57,998,901RGD_MAPPER_PIPELINE
mRatBN7.2652,234,089 - 52,271,568RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.0654,963,990 - 55,001,806RGD_MAPPER_PIPELINERnor_6.0
Rnor_5.0664,589,066 - 64,624,078RGD_MAPPER_PIPELINERnor_5.0
RGSC_v3.4654,205,104 - 54,240,268RGD_MAPPER_PIPELINERGSC_v3.4





References

References - curated
# Reference Title Reference Citation
1. Evaluation of Placentation and the Role of the Aryl Hydrocarbon Receptor Pathway in a Rat Model of Dioxin Exposure. Iqbal K, etal., Environ Health Perspect. 2021 Nov;129(11):117001. doi: 10.1289/EHP9256. Epub 2021 Nov 8.
2. The Aryl hydrocarbon receptor mediates reproductive toxicity of polychlorinated biphenyl congener 126 in rats. Klenov V, etal., Toxicol Appl Pharmacol. 2021 Sep 1;426:115639. doi: 10.1016/j.taap.2021.115639. Epub 2021 Jul 10.

Region


Additional Information

Database Acc Id Source(s)
RRRC RRRC:00831 RGD