Symbol:
Ngly1
Name:
N-glycanase 1
RGD ID:
1308518
Description:
Predicted to enable peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity. Predicted to be involved in glycoprotein catabolic process and positive regulation of BMP signaling pathway. Predicted to be located in cytoplasm. Predicted to be active in cytosol and nucleus. Used to study congenital disorder of deglycosylation 1. Human ortholog(s) of this gene implicated in congenital disorder of deglycosylation 1. Orthologous to human NGLY1 (N-glycanase 1); PARTICIPATES IN Endoplasmic Reticulum-associated degradation pathway; INTERACTS WITH 2,6-dinitrotoluene; bisphenol A; endosulfan.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC100909559; LOC289935; LOC361014; N-glycanase 1 (predicted); Ngly1_predicted; peptide-N(4)-(N-acetyl-beta-glucosaminyl)asparagine amidase; peptide:N-glycanase; PNGase; similar to peptide N-glycanase; uncharacterized LOC100909559
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
NGLY1 (N-glycanase 1) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Ngly1 (N-glycanase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Ngly1 (N-glycanase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
NGLY1 (N-glycanase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
NGLY1 (N-glycanase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Ngly1 (N-glycanase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
NGLY1 (N-glycanase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
NGLY1 (N-glycanase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Ngly1 (N-glycanase 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
NGLY1 (N-glycanase 1)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Ngly1 (N-glycanase 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
ngly1 (N-glycanase 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
PNG1
Alliance
DIOPT (Ensembl Compara|Hieranoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Pngl
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
png-1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Allele / Splice:
Ngly1em1Ta
Genetic Models:
SD-Ngly1em1Ta-/-
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 15 11,584,475 - 11,640,977 (-) NCBI GRCr8 mRatBN7.2 15 9,153,738 - 9,210,228 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 15 9,153,738 - 9,204,630 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 15 11,296,510 - 11,347,084 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 15 12,209,299 - 12,259,873 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 15 10,509,774 - 10,560,348 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 15 10,405,453 - 10,455,973 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 15 10,405,164 - 10,455,956 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 15 14,450,836 - 14,501,356 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 15 10,704,196 - 10,750,564 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 15 10,715,806 - 10,723,084 (-) NCBI Celera 15 9,192,318 - 9,243,191 (-) NCBI Celera Cytogenetic Map 15 p16 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Ngly1 Rat congenital disorder of deglycosylation ISO RGD:1318334 8554872 ClinVar Annotator: match by term: Congenital disorder of deglycosylation ClinVar PMID:16199547|PMID:17576681|PMID:18414213|PMID:22581936|PMID:24088041|PMID:24651605|PMID:25220016|PMID:25356970|PMID:25640679|PMID:25741868|PMID:25900930|PMID:26350515|PMID:26633545|PMID:26795593|PMID:27388694|PMID:28252636|PMID:28330790|PMID:28492532|PMID:29419975|PMID:29550355|PMID:29997391|PMID:30740912|PMID:31311714|PMID:31440721|PMID:31497478|PMID:31957011|PMID:31965062|PMID:32071843|PMID:32123317|PMID:32422350|PMID:32576142|PMID:33098801|PMID:34582790|PMID:34712575|PMID:34939090|PMID:35243670|PMID:35565658|PMID:35753512|PMID:35779835|PMID:36102038|PMID:36528660|PMID:36875753|PMID:39825153|PMID:9536098 Ngly1 Rat congenital disorder of deglycosylation 1 ISO RGD:1318334 8554872 ClinVar Annotator: match by term: Congenital disorder of deglycosylation 1 | ClinVar Annotator: match by more ... ClinVar PMID:16199547|PMID:22581936|PMID:24651605|PMID:25220016|PMID:25741868|PMID:25900930|PMID:26350515|PMID:26795593|PMID:27388694|PMID:28330790|PMID:28492532|PMID:29419975|PMID:29550355|PMID:30740912|PMID:31311714|PMID:31497478|PMID:31957011|PMID:31965062|PMID:32071843|PMID:32123317|PMID:32422350|PMID:33098801|PMID:34582790|PMID:34939090|PMID:35243670|PMID:36102038|PMID:36528660|PMID:39825153 Ngly1 Rat Developmental Disabilities ISO RGD:1318334 8554872 ClinVar Annotator: match by term: Global developmental delay ClinVar PMID:32581362 Ngly1 Rat genetic disease ISO RGD:1318334 8554872 ClinVar Annotator: match by term: Inborn genetic diseases ClinVar PMID:24651605|PMID:25356970|PMID:25741868|PMID:25900930|PMID:26795593|PMID:28330790|PMID:28492532|PMID:30740912|PMID:31311714|PMID:31497478|PMID:31965062|PMID:35243670 Ngly1 Rat intellectual disability ISO RGD:1318334 8554872 ClinVar Annotator: match by term: Intellectual disability ClinVar PMID:24651605|PMID:25220016|PMID:28492532|PMID:33098801|PMID:34582790|PMID:35243670 Ngly1 Rat intellectual disability ISO RGD:1318334 8554872 ClinVar Annotator: match by term: Intellectual disability ClinVar PMID:24651605|PMID:25220016|PMID:28492532|PMID:33098801|PMID:34582790|PMID:35243670|PMID:39825153 Ngly1 Rat Neurodevelopmental Disorders ISO RGD:1318334 8554872 ClinVar Annotator: match by term: Neurodevelopmental abnormality ClinVar PMID:25741868|PMID:29550355|PMID:31965062 Ngly1 Rat syndromic microphthalmia 12 ISO RGD:1318334 8554872 ClinVar Annotator: match by term: Microphthalmia, syndromic 12 ClinVar PMID:24651605|PMID:28492532
Only show annotations with direct experimental evidence (0 objects hidden)
Ngly1 Rat (-)-epigallocatechin 3-gallate multiple interactions ISO RGD:1318334 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of NGLY1 mRNA CTD PMID:22079256 Ngly1 Rat 1,2-dimethylhydrazine decreases expression ISO RGD:1318335 6480464 1,2-Dimethylhydrazine results in decreased expression of NGLY1 mRNA CTD PMID:22206623 Ngly1 Rat 17beta-estradiol multiple interactions ISO RGD:1318334 6480464 [Estradiol co-treated with Progesterone] results in decreased expression of NGLY1 mRNA CTD PMID:20660070 Ngly1 Rat 17beta-estradiol increases expression ISO RGD:1318335 6480464 Estradiol results in increased expression of NGLY1 mRNA CTD PMID:39298647 Ngly1 Rat 17beta-hydroxy-17-methylestra-4,9,11-trien-3-one increases expression ISO RGD:1318334 6480464 Metribolone results in increased expression of NGLY1 mRNA CTD PMID:16751804 Ngly1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO RGD:1318335 6480464 Tetrachlorodibenzodioxin results in increased expression of NGLY1 mRNA CTD PMID:19465110 Ngly1 Rat 2,6-dinitrotoluene affects expression EXP 6480464 2,6-dinitrotoluene affects the expression of NGLY1 mRNA CTD PMID:21346803 Ngly1 Rat 2-methylcholine affects expression ISO RGD:1318334 6480464 beta-methylcholine affects the expression of NGLY1 mRNA CTD PMID:21179406 Ngly1 Rat 3,4-methylenedioxymethamphetamine decreases expression ISO RGD:1318335 6480464 N-Methyl-3,4-methylenedioxyamphetamine results in decreased expression of NGLY1 mRNA CTD PMID:26251327 Ngly1 Rat 3,4-methylenedioxymethamphetamine increases methylation ISO RGD:1318335 6480464 N-Methyl-3,4-methylenedioxyamphetamine results in increased methylation of NGLY1 promoter CTD PMID:26251327 Ngly1 Rat 4,4'-sulfonyldiphenol increases expression ISO RGD:1318335 6480464 bisphenol S results in increased expression of NGLY1 mRNA CTD PMID:39298647 Ngly1 Rat aflatoxin B1 decreases methylation ISO RGD:1318334 6480464 Aflatoxin B1 results in decreased methylation of NGLY1 gene CTD PMID:27153756 Ngly1 Rat aristolochic acid A increases expression ISO RGD:1318334 6480464 aristolochic acid I results in increased expression of NGLY1 protein CTD PMID:33212167 Ngly1 Rat Aroclor 1254 decreases expression ISO RGD:1318335 6480464 Chlorodiphenyl (54% Chlorine) results in decreased expression of NGLY1 mRNA CTD PMID:23650126 Ngly1 Rat benzo[a]pyrene affects methylation ISO RGD:1318334 6480464 Benzo(a)pyrene affects the methylation of NGLY1 promoter CTD PMID:27901495 Ngly1 Rat beta-lapachone increases expression ISO RGD:1318334 6480464 beta-lapachone results in increased expression of NGLY1 mRNA CTD PMID:38218311 Ngly1 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of NGLY1 mRNA CTD PMID:25181051 Ngly1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of NGLY1 mRNA CTD PMID:34947998 Ngly1 Rat bisphenol F increases expression ISO RGD:1318335 6480464 bisphenol F results in increased expression of NGLY1 mRNA CTD PMID:38685157 Ngly1 Rat carbamazepine affects expression ISO RGD:1318334 6480464 Carbamazepine affects the expression of NGLY1 mRNA CTD PMID:25979313 Ngly1 Rat CGP 52608 multiple interactions ISO RGD:1318334 6480464 CGP 52608 promotes the reaction [RORA protein binds to NGLY1 gene] CTD PMID:28238834 Ngly1 Rat cobalt dichloride increases expression ISO RGD:1318334 6480464 cobaltous chloride results in increased expression of NGLY1 mRNA CTD PMID:19320972 Ngly1 Rat colforsin daropate hydrochloride increases expression ISO RGD:1318334 6480464 Colforsin results in increased expression of NGLY1 mRNA CTD PMID:16751804 Ngly1 Rat cyclosporin A increases expression ISO RGD:1318334 6480464 Cyclosporine results in increased expression of NGLY1 mRNA CTD PMID:20106945|PMID:27989131 Ngly1 Rat Dibutyl phosphate affects expression ISO RGD:1318334 6480464 di-n-butylphosphoric acid affects the expression of NGLY1 mRNA CTD PMID:37042841 Ngly1 Rat dicrotophos decreases expression ISO RGD:1318334 6480464 dicrotophos results in decreased expression of NGLY1 mRNA CTD PMID:28302478 Ngly1 Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of NGLY1 mRNA CTD PMID:29391264 Ngly1 Rat endosulfan affects expression EXP 6480464 Endosulfan affects the expression of NGLY1 mRNA CTD PMID:31464424 Ngly1 Rat ethanol affects expression ISO RGD:1318335 6480464 Ethanol affects the expression of NGLY1 mRNA CTD PMID:30319688 Ngly1 Rat glafenine decreases expression EXP 6480464 Glafenine results in decreased expression of NGLY1 mRNA CTD PMID:24136188 Ngly1 Rat levetiracetam increases expression EXP 6480464 Levetiracetam results in increased expression of NGLY1 mRNA CTD PMID:20345932 Ngly1 Rat methapyrilene decreases expression EXP 6480464 Methapyrilene results in decreased expression of NGLY1 mRNA CTD PMID:30467583 Ngly1 Rat methylmercury chloride increases expression ISO RGD:1318334 6480464 methylmercuric chloride results in increased expression of NGLY1 mRNA CTD PMID:28001369 Ngly1 Rat N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal multiple interactions ISO RGD:1318334 6480464 benzyloxycarbonylleucyl-leucyl-leucine aldehyde promotes the reaction [NGLY1 protein binds to UBXN1 protein] CTD PMID:15362974 Ngly1 Rat paracetamol affects expression ISO RGD:1318335 6480464 Acetaminophen affects the expression of NGLY1 mRNA CTD PMID:17562736 Ngly1 Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of NGLY1 mRNA CTD PMID:33387578 Ngly1 Rat paracetamol increases expression ISO RGD:1318334 6480464 Acetaminophen results in increased expression of NGLY1 mRNA CTD PMID:21420995 Ngly1 Rat pentachlorophenol increases expression ISO RGD:1318335 6480464 Pentachlorophenol results in increased expression of NGLY1 mRNA CTD PMID:23892564 Ngly1 Rat phenytoin increases expression EXP 6480464 Phenytoin results in increased expression of NGLY1 mRNA CTD PMID:20345932 Ngly1 Rat potassium chromate decreases expression ISO RGD:1318334 6480464 potassium chromate(VI) results in decreased expression of NGLY1 mRNA CTD PMID:22079256 Ngly1 Rat potassium chromate multiple interactions ISO RGD:1318334 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of NGLY1 mRNA CTD PMID:22079256 Ngly1 Rat progesterone multiple interactions ISO RGD:1318334 6480464 [Estradiol co-treated with Progesterone] results in decreased expression of NGLY1 mRNA CTD PMID:20660070 Ngly1 Rat quercetin decreases expression ISO RGD:1318334 6480464 Quercetin results in decreased expression of NGLY1 mRNA CTD PMID:21632981 Ngly1 Rat resveratrol multiple interactions ISO RGD:1318334 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of NGLY1 mRNA CTD PMID:23557933 Ngly1 Rat sodium arsenite multiple interactions ISO RGD:1318334 6480464 sodium arsenite promotes the reaction [NGLY1 protein binds to UBXN1 protein] CTD PMID:15362974 Ngly1 Rat sodium arsenite increases expression ISO RGD:1318334 6480464 sodium arsenite results in increased expression of NGLY1 mRNA CTD PMID:38568856 Ngly1 Rat Soman decreases expression EXP 6480464 Soman results in decreased expression of NGLY1 mRNA CTD PMID:19281266 Ngly1 Rat testosterone increases expression ISO RGD:1318334 6480464 Testosterone results in increased expression of NGLY1 mRNA CTD PMID:33359661 Ngly1 Rat titanium dioxide increases methylation ISO RGD:1318335 6480464 titanium dioxide results in increased methylation of NGLY1 promoter CTD PMID:35295148 Ngly1 Rat titanium dioxide decreases methylation ISO RGD:1318335 6480464 titanium dioxide results in decreased methylation of NGLY1 promoter CTD PMID:35295148 Ngly1 Rat valproic acid decreases expression ISO RGD:1318334 6480464 Valproic Acid results in decreased expression of NGLY1 mRNA CTD PMID:23179753|PMID:24383497 Ngly1 Rat valproic acid affects expression ISO RGD:1318334 6480464 Valproic Acid affects the expression of NGLY1 mRNA CTD PMID:25979313
Imported Annotations - KEGG (archival)
(-)-epigallocatechin 3-gallate (ISO) 1,2-dimethylhydrazine (ISO) 17beta-estradiol (ISO) 17beta-hydroxy-17-methylestra-4,9,11-trien-3-one (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,6-dinitrotoluene (EXP) 2-methylcholine (ISO) 3,4-methylenedioxymethamphetamine (ISO) 4,4'-sulfonyldiphenol (ISO) aflatoxin B1 (ISO) aristolochic acid A (ISO) Aroclor 1254 (ISO) benzo[a]pyrene (ISO) beta-lapachone (ISO) bisphenol A (EXP) bisphenol F (ISO) carbamazepine (ISO) CGP 52608 (ISO) cobalt dichloride (ISO) colforsin daropate hydrochloride (ISO) cyclosporin A (ISO) Dibutyl phosphate (ISO) dicrotophos (ISO) endosulfan (EXP) ethanol (ISO) glafenine (EXP) levetiracetam (EXP) methapyrilene (EXP) methylmercury chloride (ISO) N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal (ISO) paracetamol (EXP,ISO) pentachlorophenol (ISO) phenytoin (EXP) potassium chromate (ISO) progesterone (ISO) quercetin (ISO) resveratrol (ISO) sodium arsenite (ISO) Soman (EXP) testosterone (ISO) titanium dioxide (ISO) valproic acid (ISO)
Ngly1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 15 11,584,475 - 11,640,977 (-) NCBI GRCr8 mRatBN7.2 15 9,153,738 - 9,210,228 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 15 9,153,738 - 9,204,630 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 15 11,296,510 - 11,347,084 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 15 12,209,299 - 12,259,873 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 15 10,509,774 - 10,560,348 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 15 10,405,453 - 10,455,973 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 15 10,405,164 - 10,455,956 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 15 14,450,836 - 14,501,356 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 15 10,704,196 - 10,750,564 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 15 10,715,806 - 10,723,084 (-) NCBI Celera 15 9,192,318 - 9,243,191 (-) NCBI Celera Cytogenetic Map 15 p16 NCBI
NGLY1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 3 25,718,944 - 25,790,039 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 3 25,718,944 - 25,790,039 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 3 25,760,435 - 25,831,530 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 3 25,735,779 - 25,799,926 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 3 25,735,778 - 25,799,926 NCBI Celera 3 25,697,316 - 25,768,403 (-) NCBI Celera Cytogenetic Map 3 p24.2 NCBI HuRef 3 25,705,518 - 25,776,520 (-) NCBI HuRef CHM1_1 3 25,710,469 - 25,781,508 (-) NCBI CHM1_1 T2T-CHM13v2.0 3 25,721,799 - 25,792,805 (-) NCBI T2T-CHM13v2.0
Ngly1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 14 6,157,837 - 6,220,449 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 14 6,157,837 - 6,220,483 (-) Ensembl GRCm39 Ensembl GRCm38 14 16,249,314 - 16,311,926 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 14 16,249,280 - 16,311,926 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 14 17,081,828 - 17,144,440 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 14 15,042,581 - 15,105,193 (+) NCBI MGSCv36 mm8 Celera 14 11,944,272 - 12,005,168 (+) NCBI Celera Cytogenetic Map 14 A1 NCBI cM Map 14 7.08 NCBI
Ngly1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955430 17,564,319 - 17,645,564 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955430 17,564,319 - 17,645,564 (-) NCBI ChiLan1.0 ChiLan1.0
NGLY1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 2 25,678,406 - 25,742,623 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 3 25,683,169 - 25,747,391 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 3 25,618,768 - 25,683,293 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 3 25,950,189 - 26,014,998 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 3 25,950,701 - 26,021,504 (-) Ensembl panpan1.1 panPan2
NGLY1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 23 18,044,479 - 18,101,937 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 23 18,039,456 - 18,099,660 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 23 18,042,146 - 18,099,607 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 23 18,347,625 - 18,405,157 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 23 18,342,554 - 18,405,154 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 23 18,166,197 - 18,223,888 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 23 18,269,312 - 18,326,783 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 23 18,383,003 - 18,440,512 (+) NCBI UU_Cfam_GSD_1.0
Ngly1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405118 184,105,190 - 184,155,991 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936473 17,239,966 - 17,294,791 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936473 17,243,763 - 17,294,609 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
NGLY1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 13 12,616,567 - 12,685,823 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 13 12,616,564 - 12,683,637 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 13 14,229,512 - 14,291,711 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
NGLY1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 15 70,381,992 - 70,449,373 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 15 70,382,004 - 70,449,341 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666041 43,521,267 - 43,588,968 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Ngly1
.
Predicted Target Of
Count of predictions: 45 Count of miRNA genes: 38 Interacting mature miRNAs: 45 Transcripts: ENSRNOT00000008289 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1641913 Colcr2 Colorectal carcinoma resistance QTL 2 6.57 0.0197 intestine integrity trait (VT:0010554) poorly differentiated malignant colorectal tumor number (CMO:0002076) 15 2266368 22711984 Rat 10401805 Kidm51 Kidney mass QTL 51 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 15 306329 45306329 Rat 1582251 Gluco24 Glucose level QTL 24 3.2 0.0008 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 15 5530756 50530756 Rat 5684946 Bss98 Bone structure and strength QTL 98 3.9 0.0026 tibia strength trait (VT:1000284) tibia ultimate force (CMO:0001734) 15 1058250 14481294 Rat 1354657 Despr13 Despair related QTL 13 0.0022 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 15 1 29912054 Rat 1641887 Alcrsp14 Alcohol response QTL 14 response to alcohol trait (VT:0010489) brain neurotensin receptor 1 density (CMO:0002068) 15 1 42356671 Rat 2298549 Neuinf12 Neuroinflammation QTL 12 3.5 nervous system integrity trait (VT:0010566) spinal cord beta-2 microglobulin mRNA level (CMO:0002125) 15 1 55302115 Rat 731170 Pur3 Proteinuria QTL 3 2.3 0.0005 urine protein amount (VT:0005160) urine protein excretion rate (CMO:0000759) 15 1 41686771 Rat 8552920 Pigfal8 Plasma insulin-like growth factor 1 level QTL 8 3 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 15 1 34723002 Rat 738017 Hcas7 Hepatocarcinoma susceptibility QTL 7 2.91 liver integrity trait (VT:0010547) liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464) 15 2266368 46921453 Rat 8694361 Abfw6 Abdominal fat weight QTL 6 10.2 0.001 visceral adipose mass (VT:0010063) abdominal fat pad weight to body weight ratio (CMO:0000095) 15 1 34723002 Rat 9589149 Insul29 Insulin level QTL 29 9.06 0.001 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 15 1 34723002 Rat
BF402481
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 15 9,179,073 - 9,179,264 (+) MAPPER mRatBN7.2 Rnor_6.0 15 10,430,471 - 10,430,661 NCBI Rnor6.0 Rnor_5.0 15 14,475,854 - 14,476,044 UniSTS Rnor5.0 RGSC_v3.4 15 10,729,979 - 10,730,169 UniSTS RGSC3.4 Celera 15 9,217,340 - 9,217,530 UniSTS RH 3.4 Map 15 92.5 UniSTS Cytogenetic Map 15 p16 UniSTS
This gene Ngly1 is modified in the following models/strains:
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000008289 ⟹ ENSRNOP00000008289
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 15 9,153,738 - 9,204,594 (-) Ensembl Rnor_6.0 Ensembl 15 10,405,164 - 10,455,956 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000104278 ⟹ ENSRNOP00000083143
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 15 9,153,745 - 9,204,630 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000116474 ⟹ ENSRNOP00000086683
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 15 9,153,738 - 9,204,573 (-) Ensembl
RefSeq Acc Id:
NM_001014136 ⟹ NP_001014158
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 11,584,475 - 11,635,328 (-) NCBI mRatBN7.2 15 9,153,738 - 9,204,591 (-) NCBI Rnor_6.0 15 10,405,453 - 10,455,973 (-) NCBI Rnor_5.0 15 14,450,836 - 14,501,356 (-) NCBI RGSC_v3.4 15 10,704,196 - 10,750,564 (-) RGD Celera 15 9,192,318 - 9,243,191 (-) RGD
Sequence:
GGCCTAGGCGCTCCTCAGCGCCTGCTCAGTGCGGGCCGCGGAGCGCGAGGTGGCGAAGGCCGCGGCTCAGCCATGGCGTCGGCCACACTGGGCAGCTCGTCGAGCTCTGCGTCTCCGGCCGTGGCCGA
hide sequence
RefSeq Acc Id:
NM_001414987 ⟹ NP_001401916
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 11,584,475 - 11,635,328 (-) NCBI mRatBN7.2 15 9,153,738 - 9,204,591 (-) NCBI
RefSeq Acc Id:
XM_039093450 ⟹ XP_038949378
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 11,584,475 - 11,635,409 (-) NCBI mRatBN7.2 15 9,153,738 - 9,204,658 (-) NCBI
RefSeq Acc Id:
XM_039093451 ⟹ XP_038949379
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 11,584,475 - 11,640,977 (-) NCBI mRatBN7.2 15 9,153,738 - 9,210,228 (-) NCBI
RefSeq Acc Id:
XM_039093452 ⟹ XP_038949380
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 11,584,475 - 11,635,391 (-) NCBI mRatBN7.2 15 9,153,738 - 9,204,657 (-) NCBI
RefSeq Acc Id:
XM_039093453 ⟹ XP_038949381
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 15 11,584,475 - 11,630,375 (-) NCBI mRatBN7.2 15 9,153,738 - 9,204,601 (-) NCBI
RefSeq Acc Id:
NP_001014158 ⟸ NM_001014136
- Peptide Label:
isoform 1
- UniProtKB:
A0A8I5ZUV9 (UniProtKB/TrEMBL)
- Sequence:
MASATLGSSSSSASPAVAELCQNTPETFLEASKLLLTYADNILRNPSDEKYRSIRIGNTAFSTRLLPVRGAVECLFEMGFEEGETHLIFPKKASVEQLQKIRDLIAVERRSRLDGSSQKVEFSQHPAA
hide sequence
Ensembl Acc Id:
ENSRNOP00000008289 ⟸ ENSRNOT00000008289
RefSeq Acc Id:
XP_038949379 ⟸ XM_039093451
- Peptide Label:
isoform X2
- UniProtKB:
A0A8I5ZUV9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038949378 ⟸ XM_039093450
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I5ZUV9 (UniProtKB/TrEMBL), A0A8I6A5T0 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038949380 ⟸ XM_039093452
- Peptide Label:
isoform X3
- UniProtKB:
A0A8I5ZUV9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038949381 ⟸ XM_039093453
- Peptide Label:
isoform X4
Ensembl Acc Id:
ENSRNOP00000086683 ⟸ ENSRNOT00000116474
Ensembl Acc Id:
ENSRNOP00000083143 ⟸ ENSRNOT00000104278
RefSeq Acc Id:
NP_001401916 ⟸ NM_001414987
- Peptide Label:
isoform 2
- UniProtKB:
Q5XI55 (UniProtKB/Swiss-Prot), A6K047 (UniProtKB/TrEMBL), A0A8I5ZUV9 (UniProtKB/TrEMBL)
RGD ID: 13699580 Promoter ID: EPDNEW_R10103 Type: multiple initiation site Name: Ngly1_1 Description: N-glycanase 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 15 10,455,960 - 10,456,020 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2021-03-09
Ngly1
N-glycanase 1
LOC100909559
uncharacterized LOC100909559
Data merged from RGD:6502992
737654 PROVISIONAL
2012-07-05
LOC100909559
uncharacterized LOC100909559
Symbol and Name status set to provisional
70820 PROVISIONAL
2007-02-07
Ngly1
N-glycanase 1
Ngly1_predicted
N-glycanase 1 (predicted)
Symbol and Name updated
1299863 APPROVED
2007-02-07
Ngly1_predicted
N-glycanase 1 (predicted)
LOC361014
similar to peptide N-glycanase
Data merged from RGD:1587331
737654 APPROVED
2006-11-19
LOC361014
similar to peptide N-glycanase
Symbol and Name status set to provisional
70820 PROVISIONAL
2005-01-12
Ngly1_predicted
N-glycanase 1 (predicted)
Symbol and Name status set to approved
70820 APPROVED
