Advanced Search (OLGA)

Gene: Mt4 (metallothionein 4) Rattus norvegicus

Analyze

Symbol:

Mt4

Name:

metallothionein 4

RGD ID:

1565500

Description:

Predicted to enable metal ion binding activity. Predicted to be involved in several processes, including cellular response to zinc ion; detoxification of copper ion; and intracellular zinc ion homeostasis. Predicted to act upstream of or within intracellular monoatomic cation homeostasis. Predicted to be active in cytoplasm and nucleus. Orthologous to human MT4 (metallothionein 4); INTERACTS WITH 17beta-estradiol; 17beta-estradiol 3-benzoate; 6-propyl-2-thiouracil.

Type:

protein-coding

RefSeq Status:

PROVISIONAL

Previously known as:

LOC498911; metallothionein-4; RGD1565500

RGD Orthologs

Alliance Orthologs

More Info

more info ...

More Info

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	MT4 (metallothionein 4)	HGNC	EggNOG, Ensembl, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):	Mt4 (metallothionein 4)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):	MT4 (metallothionein 4)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Canis lupus familiaris (dog):	MT4 (metallothionein 4)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):	Mt4 (metallothionein 4)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Sus scrofa (pig):	MT4 (metallothionein 4)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):	MT4 (metallothionein 4)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Alliance orthologs ³
Homo sapiens (human):	MT4 (metallothionein 4)	Alliance	DIOPT (Ensembl Compara\|HGNC\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Mus musculus (house mouse):	Mt4 (metallothionein 4)	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Danio rerio (zebrafish):	mtbl (metallothionein-B-like)	Alliance	DIOPT (OMA\|OrthoFinder\|PhylomeDB\|SonicParanoid)
Danio rerio (zebrafish):	mt2 (metallothionein 2)	Alliance	DIOPT (Ensembl Compara\|OMA\|OrthoFinder\|PANTHER\|PhylomeDB\|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):	LOC100488960	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OrthoFinder\|PhylomeDB\|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):	mt3	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|OrthoFinder\|OrthoInspector\|PhylomeDB\|SonicParanoid)

Latest Assembly:

GRCr8 - GRCr8 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	19	10,869,735 - 10,871,831 (-)	NCBI	GRCr8	GRCr8		GRCr8
GRCr8 Ensembl	19	10,869,735 - 10,871,831 (-)	Ensembl				GRCr8
mRatBN7.2	19	10,863,813 - 10,865,909 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	19	10,863,813 - 10,865,909 (-)	Ensembl				mRatBN7.2
UTH_Rnor_SHR_Utx	19	10,831,713 - 10,833,804 (-)	NCBI	UTH_Rnor_SHR_Utx	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	19	11,598,567 - 11,600,658 (-)	NCBI	UTH_Rnor_SHRSP_BbbUtx_1.0	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	19	10,885,565 - 10,887,656 (-)	NCBI	UTH_Rnor_WKY_Bbb_1.0	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	19	11,339,767 - 11,341,863 (-)	NCBI	Rnor_6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	19	11,339,767 - 11,341,863 (-)	Ensembl			rn6	Rnor6.0
Rnor_5.0	19	11,315,073 - 11,317,169 (-)	NCBI	Rnor_5.0	Rnor_5.0	rn5
RGSC_v3.4	19	11,300,057 - 11,302,153 (-)	NCBI	RGSC_v3.4	RGSC_v3.4	rn4
Celera	19	10,749,778 - 10,751,874 (-)	NCBI		Celera
Cytogenetic Map	19	p12	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

kidney disease (ISO)

Lead Poisoning (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

(2,4,5-trichlorophenoxy)acetic acid (ISO)

1,2-dimethylhydrazine (ISO)

17beta-estradiol (EXP)

17beta-estradiol 3-benzoate (EXP)

2,2',4,4'-Tetrabromodiphenyl ether (ISO)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

6-propyl-2-thiouracil (EXP)

aflatoxin B1 (ISO)

aldrin (ISO)

alpha-Zearalanol (EXP)

antirheumatic drug (ISO)

benzo[a]pyrene (ISO)

bisphenol A (EXP)

bromobenzene (EXP)

cadmium atom (ISO)

cadmium dichloride (ISO)

chloroethene (ISO)

cobalt atom (ISO)

Cuprizon (EXP)

cyclosporin A (ISO)

dimethylarsinic acid (ISO)

furan (EXP)

GSK-J4 (ISO)

lead(0) (ISO)

mercury atom (ISO)

mercury(0) (ISO)

methylarsonic acid (ISO)

perfluorooctanoic acid (EXP)

phenobarbital (ISO)

pinosylvin (ISO)

pirinixic acid (ISO)

silicon dioxide (ISO)

silver(1+) nitrate (ISO)

sodium arsenate (ISO)

sodium arsenite (ISO)

testosterone (EXP)

thiram (ISO)

titanium dioxide (ISO)

trans-pinosylvin (ISO)

tunicamycin (ISO)

zinc atom (ISO)

zinc(0) (ISO)

ziram (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to cadmium ion (IBA)

cellular response to copper ion (IBA)

cellular response to zinc ion (IBA)

detoxification of copper ion (IBA)

intracellular monoatomic cation homeostasis (ISO)

intracellular zinc ion homeostasis (IBA)

Cellular Component

cytoplasm (IBA)

nucleus (IBA)

Molecular Function

metal ion binding (IBA,IEA,ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.	Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:15033980

Genomics

Comparative Map Data

Mt4
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	19	10,869,735 - 10,871,831 (-)	NCBI	GRCr8	GRCr8		GRCr8
GRCr8 Ensembl	19	10,869,735 - 10,871,831 (-)	Ensembl				GRCr8
mRatBN7.2	19	10,863,813 - 10,865,909 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	19	10,863,813 - 10,865,909 (-)	Ensembl				mRatBN7.2
UTH_Rnor_SHR_Utx	19	10,831,713 - 10,833,804 (-)	NCBI	UTH_Rnor_SHR_Utx	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	19	11,598,567 - 11,600,658 (-)	NCBI	UTH_Rnor_SHRSP_BbbUtx_1.0	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	19	10,885,565 - 10,887,656 (-)	NCBI	UTH_Rnor_WKY_Bbb_1.0	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	19	11,339,767 - 11,341,863 (-)	NCBI	Rnor_6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	19	11,339,767 - 11,341,863 (-)	Ensembl			rn6	Rnor6.0
Rnor_5.0	19	11,315,073 - 11,317,169 (-)	NCBI	Rnor_5.0	Rnor_5.0	rn5
RGSC_v3.4	19	11,300,057 - 11,302,153 (-)	NCBI	RGSC_v3.4	RGSC_v3.4	rn4
Celera	19	10,749,778 - 10,751,874 (-)	NCBI		Celera
Cytogenetic Map	19	p12	NCBI

MT4
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	16	56,565,073 - 56,568,957 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	16	56,565,073 - 56,568,957 (+)	Ensembl			hg38	GRCh38
GRCh37	16	56,598,985 - 56,602,869 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	16	55,156,462 - 55,160,370 (+)	NCBI	Build 36	Build 36	hg18	NCBI36
Build 34	16	55,156,541 - 55,160,345	NCBI
Celera	16	41,096,796 - 41,100,689 (+)	NCBI		Celera
Cytogenetic Map	16	q13	NCBI
HuRef	16	42,469,024 - 42,472,836 (+)	NCBI		HuRef
CHM1_1	16	58,005,846 - 58,009,677 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	16	62,359,992 - 62,363,895 (+)	NCBI		T2T-CHM13v2.0

Mt4
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	8	94,863,832 - 94,865,659 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	8	94,863,825 - 94,865,659 (+)	Ensembl		GRCm39 Ensembl		GRCm39
GRCm38	8	94,137,204 - 94,139,031 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	8	94,137,197 - 94,139,031 (+)	Ensembl			mm10	GRCm38
MGSCv37	8	96,661,104 - 96,662,931 (+)	NCBI	MGSCv37	MGSCv37	mm9	NCBIm37
MGSCv36	8	97,026,371 - 97,027,996 (+)	NCBI		MGSCv36	mm8
Celera	8	98,468,827 - 98,470,654 (+)	NCBI		Celera
Cytogenetic Map	8	C5	NCBI
cM Map	8	46.26	NCBI

MT4
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	18	66,042,237 - 66,051,433 (+)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	16	71,961,794 - 71,970,293 (+)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	16	36,848,200 - 36,855,987 (+)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	16	55,984,536 - 55,988,258 (+)	NCBI	PanPan1.1	PanPan1.1	panPan2

MT4
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	2	59,640,784 - 59,643,370 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	2	59,640,784 - 59,643,370 (-)	Ensembl			canFam3	CanFam3.1
Dog10K_Boxer_Tasha	2	56,274,439 - 56,277,025 (-)	NCBI	Dog10K_Boxer_Tasha	Dog10K_Boxer_Tasha
ROS_Cfam_1.0	2	60,185,523 - 60,194,231 (-)	NCBI	ROS_Cfam_1.0	ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	2	60,185,523 - 60,188,111 (-)	Ensembl				ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	2	57,016,133 - 57,018,721 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	2	58,025,028 - 58,027,614 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	2	58,917,965 - 58,920,560 (-)	NCBI	UU_Cfam_GSD_1.0	UU_Cfam_GSD_1.0

Mt4
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)

Squirrel Assembly	Chr	Position (strand)	Source	Genome Browsers
Squirrel Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HiC_Itri_2	NW_024409349	50,743,969 - 50,785,927 (-)	NCBI		HiC_Itri_2
SpeTri2.0 Ensembl	NW_004936475	8,809,813 - 8,845,137 (+)	Ensembl		SpeTri2.0 Ensembl
SpeTri2.0	NW_004936475	8,842,863 - 8,845,105 (+)	NCBI	SpeTri2.0	SpeTri2.0		SpeTri2.0

MT4
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	6	18,610,820 - 18,614,782 (+)	Ensembl			susScr11	Sscrofa11.1
Sscrofa11.1	6	18,611,245 - 18,613,956 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1

MT4
(Chlorocebus sabaeus - green monkey)

No map positions available.

Variants

Variants in Mt4
30 total Variants

miRNA Target Status (No longer updated)

Predicted Target Of

	Summary Value
Count of predictions:	116
Count of miRNA genes:	95
Interacting mature miRNAs:	107
Transcripts:	ENSRNOT00000025694
Prediction methods:	Microtar, Miranda, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1549847	Bss8	Bone structure and strength QTL 8	4		lumbar vertebra strength trait (VT:0010574)	vertebra ultimate force (CMO:0001678)	19	1	31969901	Rat
8552935	Pigfal10	Plasma insulin-like growth factor 1 level QTL 10	5.7		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	19	7997750	52997750	Rat
9590298	Uminl5	Urine mineral level QTL 5	3.59	0.001	urine mineral amount (VT:0015086)	urine electrolyte level (CMO:0000593)	19	7997750	52997750	Rat
631840	Niddm38	Non-insulin dependent diabetes mellitus QTL 38	3.86		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	19	10329076	74246245	Rat
1358200	Insglur2	Insulin/glucose ratio QTL 2	4.1		blood glucose amount (VT:0000188)	serum glucose level (CMO:0000543)	19	5748064	50748064	Rat
10054132	Srcrt9	Stress Responsive Cort QTL 9	2.87	0.0017	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	19	1	27361636	Rat
1331737	Uae29	Urinary albumin excretion QTL 29	5.5		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	19	36289	74246245	Rat
61423	Cia14	Collagen induced arthritis QTL 14	3		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	19	10833618	74246245	Rat
7411590	Foco7	Food consumption QTL 7	6.8	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	19	1	24694445	Rat
9590090	Insglur8	Insulin/glucose ratio QTL 8	10.81	0.001	blood insulin amount (VT:0001560)	calculated plasma insulin level (CMO:0002170)	19	7997750	52997750	Rat
9590250	Scort11	Serum corticosterone level QTL 11	23.45	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	19	7997750	52997750	Rat
7247442	Uae39	Urinary albumin excretion QTL 39			urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	19	2194317	74246245	Rat
724566	Uae12	Urinary albumin excretion QTL 12	5		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	19	2194317	74246245	Rat

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Download All Expressed Objects for this Gene

alimentary part of gastrointestinal system	appendage	ectoderm	endocrine system	endoderm	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	mesenchyme	mesoderm	nervous system	renal system	reproductive system	respiratory system
14	7	57	19	24	4	8	4	4	38	10	51	3	32	20

Sequence

Nucleotide Sequences


RefSeq Transcripts	NM_001126084	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC128848	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CH474006	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAXUCZ010000019	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSRNOT00000025694 ⟹ ENSRNOP00000025694

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8 Ensembl	19	10,869,735 - 10,871,831 (-)	Ensembl
mRatBN7.2 Ensembl	19	10,863,813 - 10,865,909 (-)	Ensembl
Rnor_6.0 Ensembl	19	11,339,767 - 11,341,863 (-)	Ensembl

RefSeq Acc Id:

NM_001126084 ⟹ NP_001119556

RefSeq Status:

PROVISIONAL

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	19	10,869,735 - 10,871,831 (-)	NCBI
mRatBN7.2	19	10,863,813 - 10,865,909 (-)	NCBI
Rnor_6.0	19	11,339,767 - 11,341,863 (-)	NCBI
Rnor_5.0	19	11,315,073 - 11,317,169 (-)	NCBI
RGSC_v3.4	19	11,300,057 - 11,302,153 (-)	RGD
Celera	19	10,749,778 - 10,751,874 (-)	RGD

Sequence:

show sequence

TCCCTTTCTTAGACGCTCACACACCTGGACCATGGACCCTGGGGAATGCACGTGTATGTCTGGA
GGGATCTGCATCTGCGGAGACAATTGCAAATGCACAACCTGCAGCTGTAAAACCTGTCGTAAAA
GCTGCTGCCCCTGCTGTCCCCCAGGCTGTGCCAAGTGCGCCCGAGGCTGCATCTGCAAAGGGGG
CTCAGACAAGTGCAGCTGCTGCCCCTGAAACCCACCCATGGCACTGGGAGAGATCCTGGGAAGG
GACCACGCTGTACCTGAGACAAGGGATTGGATTTGTATAATAGGTTGTGCTTTTTATATGTGTG
CCCAAATGTGGGGCGGGTGATGTTCATGTAAAGTTCTTGGAACAATAAAGTTTCCACTCATGAC

hide sequence

Protein Sequences


Protein RefSeqs	NP_001119556	(Get FASTA)	NCBI Sequence Viewer
GenBank Protein	EDL87353	(Get FASTA)	NCBI Sequence Viewer
Ensembl Protein	ENSRNOP00000025694
	ENSRNOP00000025694.3

RefSeq Acc Id:	NP_001119556 ⟸ NM_001126084
- UniProtKB:	D3ZTJ2 (UniProtKB/TrEMBL), A6JY75 (UniProtKB/TrEMBL)
- Sequence:	show sequence MDPGECTCMSGGICICGDNCKCTTCSCKTCRKSCCPCCPPGCAKCARGCICKGGSDKCSCCP hide sequence

Ensembl Acc Id:

ENSRNOP00000025694 ⟸ ENSRNOT00000025694

Protein Structures

Name	Modeler	Protein Id	AA Range	Protein Structure
AF-D3ZTJ2-F1-model_v2	AlphaFold	D3ZTJ2	1-62	view protein structure

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Promoters

RGD ID:

13700952

Promoter ID:

EPDNEW_R11476

Type:

single initiation site

Name:

Mt4_1

Description:

metallothionein 4

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0	19	11,341,867 - 11,341,927	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:1565500	AgrOrtholog
BioCyc Gene	G2FUF-6474	BioCyc
Ensembl Genes	ENSRNOG00000019004	Ensembl, ENTREZGENE, UniProtKB/TrEMBL
Ensembl Transcript	ENSRNOT00000025694	ENTREZGENE
	ENSRNOT00000025694.6	UniProtKB/TrEMBL
Gene3D-CATH	4.10.10.10	UniProtKB/TrEMBL
InterPro	Metallothionein_dom_vert	UniProtKB/TrEMBL
	Metallothionein_sfam	UniProtKB/TrEMBL
	Metallothionein_vert	UniProtKB/TrEMBL
	Metallothionein_vert_metal_BS	UniProtKB/TrEMBL
KEGG Report	rno:498911	UniProtKB/TrEMBL
NCBI Gene	498911	ENTREZGENE
PANTHER	METALLOTHIONEIN-4	UniProtKB/TrEMBL
	Metallothionein_vert	UniProtKB/TrEMBL
Pfam	Metallothio	UniProtKB/TrEMBL
PhenoGen	Mt4	PhenoGen
PRINTS	MTVERTEBRATE	UniProtKB/TrEMBL
PROSITE	METALLOTHIONEIN_VRT	UniProtKB/TrEMBL
RatGTEx	ENSRNOG00000019004	RatGTEx
Superfamily-SCOP	Metallothionein_sfam	UniProtKB/TrEMBL
UniProt	A6JY75	ENTREZGENE, UniProtKB/TrEMBL
	D3ZTJ2	ENTREZGENE, UniProtKB/TrEMBL

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2008-03-07	Mt4	metallothionein 4	RGD1565500_predicted	RGD1565500 (predicted)	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2006-03-07	RGD1565500_predicted	RGD1565500 (predicted)	LOC498911	LOC498911	Symbol and Name status set to approved	1299863	APPROVED
2006-02-09	LOC498911	LOC498911			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD