Symbol:
Crot
Name:
carnitine O-octanoyltransferase
RGD ID:
70908
Description:
Enables carnitine O-octanoyltransferase activity. Involved in response to xenobiotic stimulus. Located in peroxisome. Orthologous to human CROT (carnitine O-octanoyltransferase); PARTICIPATES IN adrenoleukodystrophy pathway; carnitine-acylcarnitine translocase deficiency; fatty acid beta degradation pathway; INTERACTS WITH (+)-schisandrin B; (R)-noradrenaline; 1-naphthyl isothiocyanate.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
COT; peroxisomal carnitine O-octanoyltransferase
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 26,031,729 - 26,088,057 (+) NCBI GRCr8 mRatBN7.2 4 25,068,270 - 25,133,111 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 25,080,587 - 25,133,109 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 30,097,079 - 30,131,595 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 26,023,348 - 26,057,839 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 24,409,862 - 24,444,651 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 22,079,837 - 22,116,265 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 22,081,604 - 22,116,265 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 22,018,106 - 22,053,087 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 22,023,913 - 22,067,029 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 22,023,912 - 22,067,029 (-) NCBI Celera 4 20,575,938 - 20,626,257 (+) NCBI Celera Cytogenetic Map 4 q12 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Crot Rat (+)-schisandrin B multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of CROT mRNA] CTD PMID:31150632 Crot Rat (-)-epigallocatechin 3-gallate multiple interactions ISO CROT (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of CROT mRNA CTD PMID:22079256 Crot Rat (R)-noradrenaline increases expression EXP 6480464 Norepinephrine results in increased expression of CROT mRNA CTD PMID:14618266 Crot Rat 1,1-dichloroethene decreases expression ISO Crot (Mus musculus) 6480464 vinylidene chloride results in decreased expression of CROT mRNA CTD PMID:26682919 Crot Rat 1,2-dimethylhydrazine decreases expression ISO Crot (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of CROT mRNA CTD PMID:22206623 Crot Rat 1-naphthyl isothiocyanate decreases expression EXP 6480464 1-Naphthylisothiocyanate results in decreased expression of CROT mRNA CTD PMID:25380136 and PMID:30723492 Crot Rat 17beta-estradiol multiple interactions ISO CROT (Homo sapiens) 6480464 [Estradiol co-treated with Tetrachlorodibenzodioxin] results in decreased expression of CROT mRNA CTD PMID:19619570 Crot Rat 17beta-estradiol increases expression ISO Crot (Mus musculus) 6480464 Estradiol results in increased expression of CROT mRNA CTD PMID:39298647 Crot Rat 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of CROT mRNA CTD PMID:32145629 Crot Rat 17beta-estradiol decreases expression ISO CROT (Homo sapiens) 6480464 Estradiol results in decreased expression of CROT mRNA CTD PMID:19619570 Crot Rat 17beta-hydroxy-5alpha-androstan-3-one increases expression ISO CROT (Homo sapiens) 6480464 Dihydrotestosterone results in increased expression of CROT mRNA CTD PMID:29581250 Crot Rat 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions ISO Crot (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with 2 more ... CTD PMID:28433925 Crot Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO CROT (Homo sapiens) 6480464 2 more ... CTD PMID:19095052 Crot Rat 2,2',4,4'-Tetrabromodiphenyl ether affects expression ISO Crot (Mus musculus) 6480464 2 more ... CTD PMID:30294300 Crot Rat 2,2',4,4'-Tetrabromodiphenyl ether increases expression EXP 6480464 2 more ... CTD PMID:20056577 Crot Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO CROT (Homo sapiens) 6480464 [Estradiol co-treated with Tetrachlorodibenzodioxin] results in decreased expression of CROT mRNA CTD PMID:19619570 Crot Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of CROT mRNA CTD PMID:33387578 Crot Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Crot (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with 2 more ... CTD PMID:28433925 Crot Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of CROT mRNA CTD PMID:19692669 and PMID:20959002 Crot Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Crot (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of CROT mRNA CTD PMID:19465110 Crot Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO CROT (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of CROT mRNA CTD PMID:19619570 Crot Rat 2,4,6-tribromophenol increases expression ISO CROT (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Crot Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Crot (Mus musculus) 6480464 2 more ... CTD PMID:38648751 Crot Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of CROT mRNA CTD PMID:21346803 Crot Rat 2-hydroxypropanoic acid decreases expression ISO CROT (Homo sapiens) 6480464 Lactic Acid results in decreased expression of CROT mRNA CTD PMID:30851411 Crot Rat 3,3',4,4',5-pentachlorobiphenyl increases expression EXP 6480464 3 more ... CTD PMID:19692669 Crot Rat 3,3',4,4',5-pentachlorobiphenyl decreases expression EXP 6480464 3 more ... CTD PMID:23196670 Crot Rat 3H-1,2-dithiole-3-thione decreases expression EXP 6480464 1 and 2-dithiol-3-thione results in decreased expression of CROT mRNA CTD PMID:19162173 Crot Rat 4,4'-diaminodiphenylmethane decreases expression EXP 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of CROT mRNA CTD PMID:25380136 Crot Rat 4,4'-sulfonyldiphenol increases expression ISO Crot (Mus musculus) 6480464 bisphenol S results in increased expression of CROT mRNA CTD PMID:39298647 Crot Rat 4-hydroxynon-2-enal increases expression ISO Crot (Mus musculus) 6480464 4-hydroxy-2-nonenal results in increased expression of CROT mRNA CTD PMID:19191707 Crot Rat 4-hydroxyphenyl retinamide decreases expression ISO Crot (Mus musculus) 6480464 Fenretinide results in decreased expression of CROT mRNA CTD PMID:28973697 Crot Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of CROT mRNA CTD PMID:24780913 Crot Rat 9-cis-retinoic acid increases expression EXP 6480464 Alitretinoin results in increased expression of CROT mRNA CTD PMID:16648578 Crot Rat aflatoxin B1 increases expression ISO CROT (Homo sapiens) 6480464 Aflatoxin B1 results in increased expression of CROT mRNA CTD PMID:22100608 Crot Rat aflatoxin B1 decreases methylation ISO CROT (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of CROT gene CTD PMID:27153756 Crot Rat amiodarone decreases expression ISO CROT (Homo sapiens) 6480464 Amiodarone results in decreased expression of CROT mRNA CTD PMID:27089845 Crot Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of CROT mRNA CTD PMID:16483693 Crot Rat arsane increases methylation ISO CROT (Homo sapiens) 6480464 Arsenic results in increased methylation of CROT promoter CTD PMID:21291286 Crot Rat arsane multiple interactions ISO CROT (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of CROT mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of CROT mRNA CTD PMID:39836092 Crot Rat arsenic atom increases methylation ISO CROT (Homo sapiens) 6480464 Arsenic results in increased methylation of CROT promoter CTD PMID:21291286 Crot Rat arsenic atom multiple interactions ISO CROT (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of CROT mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of CROT mRNA CTD PMID:39836092 Crot Rat atrazine decreases expression ISO CROT (Homo sapiens) 6480464 Atrazine results in decreased expression of CROT mRNA CTD PMID:22378314 Crot Rat benzo[a]pyrene decreases methylation ISO CROT (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of CROT 5' UTR CTD PMID:27901495 Crot Rat Benzo[k]fluoranthene decreases expression ISO Crot (Mus musculus) 6480464 benzo(k)fluoranthene results in decreased expression of CROT mRNA CTD PMID:26377693 Crot Rat beta-naphthoflavone multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in decreased expression of CROT mRNA CTD PMID:18164116 Crot Rat bexarotene increases expression EXP 6480464 bexarotene results in increased expression of CROT mRNA CTD PMID:16648578 Crot Rat bezafibrate increases expression EXP 6480464 Bezafibrate results in increased expression of CROT mRNA CTD PMID:17719200 Crot Rat bis(2-ethylhexyl) phthalate multiple interactions ISO Crot (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with 2 more ... CTD PMID:28433925 Crot Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of CROT mRNA CTD PMID:25181051 and PMID:30903817 Crot Rat bisphenol A increases methylation ISO CROT (Homo sapiens) 6480464 bisphenol A results in increased methylation of CROT gene CTD PMID:31601247 Crot Rat bisphenol A decreases expression ISO CROT (Homo sapiens) 6480464 bisphenol A results in decreased expression of CROT protein CTD PMID:31675489 Crot Rat bisphenol A increases expression ISO Crot (Mus musculus) 6480464 bisphenol A results in increased expression of CROT mRNA CTD PMID:36432690 Crot Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of CROT mRNA CTD PMID:32145629 Crot Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of CROT mRNA CTD PMID:30816183 more ... Crot Rat bisphenol A multiple interactions ISO Crot (Mus musculus) 6480464 [bisphenol A co-treated with Resveratrol co-treated with Corn Oil] results in increased expression of CROT mRNA more ... CTD PMID:28433925 and PMID:36432690 Crot Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of CROT gene CTD PMID:28505145 Crot Rat bromuconazole decreases expression EXP 6480464 bromuconazole results in decreased expression of CROT mRNA CTD PMID:33789219 Crot Rat cadmium atom increases oxidation ISO Crot (Mus musculus) 6480464 Cadmium results in increased oxidation of CROT protein CTD PMID:24496640 Crot Rat cadmium dichloride increases methylation EXP 6480464 Cadmium Chloride results in increased methylation of CROT promoter CTD PMID:22457795 Crot Rat cadmium dichloride decreases expression ISO CROT (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of CROT mRNA CTD PMID:38568856 Crot Rat cadmium dichloride decreases expression EXP 6480464 Cadmium Chloride results in decreased expression of CROT mRNA CTD PMID:25993096 Crot Rat cannabidiol decreases expression ISO CROT (Homo sapiens) 6480464 Cannabidiol results in decreased expression of CROT mRNA CTD PMID:33244087 Crot Rat CGP 52608 multiple interactions ISO CROT (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to CROT gene] CTD PMID:28238834 Crot Rat chlorpyrifos decreases expression ISO Crot (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of CROT mRNA CTD PMID:37019170 Crot Rat cisplatin multiple interactions ISO CROT (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in increased expression of CROT mRNA CTD PMID:27392435 Crot Rat cisplatin increases expression ISO CROT (Homo sapiens) 6480464 Cisplatin results in increased expression of CROT mRNA CTD PMID:27392435 Crot Rat clofibrate increases expression EXP 6480464 Clofibrate results in increased expression of CROT mRNA CTD PMID:12851107 and PMID:32741897 Crot Rat clofibrate increases expression ISO Crot (Mus musculus) 6480464 Clofibrate results in increased expression of CROT mRNA CTD PMID:23811191 Crot Rat clofibric acid multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of CROT mRNA CTD PMID:17602206 Crot Rat cobalt dichloride decreases expression EXP 6480464 cobaltous chloride results in decreased expression of CROT mRNA CTD PMID:24386269 Crot Rat copper atom decreases expression EXP 6480464 Copper deficiency results in decreased expression of CROT mRNA CTD PMID:19821111 Crot Rat copper(0) decreases expression EXP 6480464 Copper deficiency results in decreased expression of CROT mRNA CTD PMID:19821111 Crot Rat corn oil affects expression EXP 6480464 Corn Oil affects the expression of CROT mRNA CTD PMID:16360708 Crot Rat corn oil multiple interactions ISO Crot (Mus musculus) 6480464 [bisphenol A co-treated with Resveratrol co-treated with Corn Oil] results in increased expression of CROT mRNA CTD PMID:36432690 Crot Rat cyclosporin A decreases expression ISO Crot (Mus musculus) 6480464 Cyclosporine results in decreased expression of CROT mRNA CTD PMID:23830897 Crot Rat cyclosporin A decreases expression ISO CROT (Homo sapiens) 6480464 Cyclosporine results in decreased expression of CROT mRNA CTD PMID:20106945 more ... Crot Rat DDT decreases methylation EXP 6480464 DDT results in decreased methylation of CROT gene CTD PMID:31682807 Crot Rat decabromodiphenyl ether increases expression ISO CROT (Homo sapiens) 6480464 decabromobiphenyl ether results in increased expression of CROT protein CTD PMID:31675489 Crot Rat deoxycholic acid decreases expression ISO CROT (Homo sapiens) 6480464 Deoxycholic Acid results in decreased expression of CROT mRNA CTD PMID:27089845 Crot Rat dibenz[a,h]anthracene decreases expression ISO Crot (Mus musculus) 6480464 1 more ... CTD PMID:26377693 Crot Rat Dibutyl phosphate affects expression ISO CROT (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of CROT mRNA CTD PMID:37042841 Crot Rat dichloroacetic acid increases expression ISO Crot (Mus musculus) 6480464 Dichloroacetic Acid results in increased expression of CROT mRNA CTD PMID:28962523 Crot Rat dorsomorphin multiple interactions ISO CROT (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Crot Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of CROT mRNA CTD PMID:29391264 Crot Rat entinostat multiple interactions ISO CROT (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of CROT mRNA CTD PMID:27188386 Crot Rat entinostat decreases expression ISO CROT (Homo sapiens) 6480464 entinostat results in decreased expression of CROT mRNA CTD PMID:27188386 Crot Rat epoxiconazole increases expression ISO Crot (Mus musculus) 6480464 epoxiconazole results in increased expression of CROT mRNA CTD PMID:35436446 Crot Rat ethanol increases expression ISO Crot (Mus musculus) 6480464 Ethanol results in increased expression of CROT mRNA CTD PMID:30319688 Crot Rat ethanol affects expression ISO Crot (Mus musculus) 6480464 Ethanol affects the expression of CROT mRNA CTD PMID:30319688 Crot Rat ethyl methanesulfonate increases expression ISO CROT (Homo sapiens) 6480464 Ethyl Methanesulfonate results in increased expression of CROT mRNA CTD PMID:23649840 Crot Rat fenofibrate increases expression EXP 6480464 Fenofibrate results in increased expression of CROT mRNA CTD PMID:32741897 Crot Rat fentin chloride decreases expression EXP 6480464 triphenyltin chloride results in decreased expression of CROT mRNA CTD PMID:37156404 Crot Rat flutamide decreases expression EXP 6480464 Flutamide results in decreased expression of CROT mRNA CTD PMID:24136188 and PMID:24793618 Crot Rat formaldehyde increases expression ISO CROT (Homo sapiens) 6480464 Formaldehyde results in increased expression of CROT mRNA CTD PMID:23649840 Crot Rat furan decreases expression EXP 6480464 furan results in decreased expression of CROT mRNA CTD PMID:25539665 and PMID:26194646 Crot Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of CROT mRNA CTD PMID:22061828 and PMID:33387578 Crot Rat glafenine decreases expression EXP 6480464 Glafenine results in decreased expression of CROT mRNA CTD PMID:24136188 Crot Rat glycidyl methacrylate decreases expression ISO CROT (Homo sapiens) 6480464 glycidyl methacrylate results in decreased expression of CROT protein CTD PMID:36641056 Crot Rat glyphosate decreases expression ISO Crot (Mus musculus) 6480464 Glyphosate results in decreased expression of CROT protein CTD PMID:37208198 Crot Rat gold atom decreases expression ISO CROT (Homo sapiens) 6480464 Gold analog results in decreased expression of CROT mRNA CTD PMID:36057382 Crot Rat gold(0) decreases expression ISO CROT (Homo sapiens) 6480464 Gold analog results in decreased expression of CROT mRNA CTD PMID:36057382 Crot Rat indometacin increases expression EXP 6480464 Indomethacin results in increased expression of CROT mRNA CTD PMID:18299717 Crot Rat ivermectin decreases expression ISO CROT (Homo sapiens) 6480464 Ivermectin results in decreased expression of CROT protein CTD PMID:32959892 Crot Rat lipopolysaccharide multiple interactions ISO CROT (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine affects the susceptibility to Lipopolysaccharides] which results in increased expression of CROT mRNA CTD PMID:35811015 Crot Rat lipopolysaccharide decreases expression ISO CROT (Homo sapiens) 6480464 Lipopolysaccharides results in decreased expression of CROT mRNA CTD PMID:35811015 Crot Rat lithocholic acid multiple interactions ISO Crot (Mus musculus) 6480464 Pregnenolone Carbonitrile inhibits the reaction [Lithocholic Acid results in decreased expression of CROT mRNA] CTD PMID:20359477 Crot Rat lithocholic acid decreases expression ISO Crot (Mus musculus) 6480464 Lithocholic Acid results in decreased expression of CROT mRNA CTD PMID:20359477 Crot Rat maneb multiple interactions ISO Crot (Mus musculus) 6480464 [Paraquat co-treated with Maneb] results in decreased expression of CROT mRNA CTD PMID:18386188 Crot Rat manganese atom multiple interactions ISO CROT (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of CROT mRNA CTD PMID:39836092 Crot Rat manganese(0) multiple interactions ISO CROT (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of CROT mRNA CTD PMID:39836092 Crot Rat manganese(II) chloride multiple interactions ISO CROT (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of CROT mRNA CTD PMID:39836092 Crot Rat metformin increases expression EXP 6480464 Metformin results in increased expression of CROT mRNA CTD PMID:31324951 Crot Rat methapyrilene decreases expression EXP 6480464 Methapyrilene results in decreased expression of CROT mRNA CTD PMID:30467583 Crot Rat methyl methanesulfonate increases expression ISO CROT (Homo sapiens) 6480464 Methyl Methanesulfonate results in increased expression of CROT mRNA CTD PMID:23649840 Crot Rat methylmercury chloride decreases expression ISO CROT (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of CROT mRNA CTD PMID:28001369 Crot Rat Muraglitazar increases expression EXP 6480464 muraglitazar results in increased expression of CROT mRNA CTD PMID:21515302 Crot Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in decreased expression of CROT mRNA more ... CTD PMID:17602206 more ... Crot Rat nefazodone decreases expression EXP 6480464 nefazodone results in decreased expression of CROT mRNA CTD PMID:24136188 Crot Rat niclosamide decreases expression ISO CROT (Homo sapiens) 6480464 Niclosamide results in decreased expression of CROT mRNA CTD PMID:36318118 Crot Rat nimesulide decreases expression EXP 6480464 nimesulide results in decreased expression of CROT mRNA CTD PMID:24136188 Crot Rat O-octanoylcarnitine increases chemical synthesis ISO Crot (Mus musculus) 6480464 CROT protein results in increased chemical synthesis of octanoylcarnitine CTD PMID:6838215 Crot Rat p-toluidine decreases expression EXP 6480464 4-toluidine results in decreased expression of CROT mRNA CTD PMID:27638505 Crot Rat paracetamol affects expression ISO Crot (Mus musculus) 6480464 Acetaminophen affects the expression of CROT mRNA CTD PMID:17562736 Crot Rat paraquat multiple interactions ISO Crot (Mus musculus) 6480464 [Paraquat co-treated with Maneb] results in decreased expression of CROT mRNA CTD PMID:18386188 Crot Rat perfluorononanoic acid decreases expression ISO CROT (Homo sapiens) 6480464 perfluoro-n-nonanoic acid results in decreased expression of CROT mRNA CTD PMID:32588087 Crot Rat perfluorooctane-1-sulfonic acid increases expression EXP 6480464 perfluorooctane sulfonic acid results in increased expression of CROT mRNA CTD PMID:18692542 and PMID:19162173 Crot Rat perfluorooctanoic acid increases expression EXP 6480464 perfluorooctanoic acid results in increased expression of CROT mRNA CTD PMID:16221955 and PMID:28511854 Crot Rat perfluorooctanoic acid increases expression ISO CROT (Homo sapiens) 6480464 perfluorooctanoic acid results in increased expression of CROT mRNA CTD PMID:23978341 Crot Rat perfluorooctanoic acid increases expression ISO Crot (Mus musculus) 6480464 perfluorooctanoic acid results in increased expression of CROT mRNA CTD PMID:17681415 and PMID:23626681 Crot Rat perfluorooctanoic acid multiple interactions ISO Crot (Mus musculus) 6480464 Dietary Fats and Unsaturated inhibits the reaction [perfluorooctanoic acid results in increased expression of CROT mRNA] CTD PMID:23626681 Crot Rat permethrin increases expression ISO CROT (Homo sapiens) 6480464 Permethrin results in increased expression of CROT mRNA CTD PMID:37047231 Crot Rat phenformin increases expression EXP 6480464 Phenformin results in increased expression of CROT mRNA CTD PMID:31324951 Crot Rat phenobarbital increases expression EXP 6480464 Phenobarbital results in increased expression of CROT mRNA CTD PMID:19162173 Crot Rat phenobarbital affects expression ISO Crot (Mus musculus) 6480464 Phenobarbital affects the expression of CROT mRNA CTD PMID:23091169 Crot Rat phenylmercury acetate increases expression ISO CROT (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of CROT mRNA CTD PMID:26272509 Crot Rat phenylmercury acetate multiple interactions ISO CROT (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of CROT mRNA CTD PMID:27188386 Crot Rat pirinixic acid multiple interactions ISO Crot (Mus musculus) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in increased expression of CROT mRNA and [pirinixic acid co-treated with PPARA] results in increased expression of CROT mRNA CTD PMID:19710929 and PMID:20813756 Crot Rat pirinixic acid increases expression EXP 6480464 pirinixic acid results in increased expression of CROT mRNA CTD PMID:19162173 more ... Crot Rat pirinixic acid increases expression ISO Crot (Mus musculus) 6480464 pirinixic acid results in increased expression of CROT mRNA and pirinixic acid results in increased expression of CROT protein CTD PMID:15226431 more ... Crot Rat potassium chromate multiple interactions ISO CROT (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of CROT mRNA CTD PMID:22079256 Crot Rat potassium chromate decreases expression ISO CROT (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of CROT mRNA CTD PMID:22079256 Crot Rat potassium dichromate decreases expression ISO Crot (Mus musculus) 6480464 Potassium Dichromate results in decreased expression of CROT mRNA CTD PMID:23608068 Crot Rat potassium dichromate increases expression ISO CROT (Homo sapiens) 6480464 Potassium Dichromate results in increased expression of CROT protein CTD PMID:23718831 Crot Rat pregnenolone 16alpha-carbonitrile decreases expression EXP 6480464 Pregnenolone Carbonitrile results in decreased expression of CROT mRNA CTD PMID:19162173 Crot Rat pregnenolone 16alpha-carbonitrile decreases expression ISO Crot (Mus musculus) 6480464 Pregnenolone Carbonitrile results in decreased expression of CROT mRNA CTD PMID:28903501 Crot Rat pregnenolone 16alpha-carbonitrile multiple interactions ISO Crot (Mus musculus) 6480464 Pregnenolone Carbonitrile inhibits the reaction [Lithocholic Acid results in decreased expression of CROT mRNA] CTD PMID:20359477 Crot Rat propiconazole decreases expression ISO Crot (Mus musculus) 6480464 propiconazole results in decreased expression of CROT mRNA CTD PMID:21278054 Crot Rat rac-lactic acid decreases expression ISO CROT (Homo sapiens) 6480464 Lactic Acid results in decreased expression of CROT mRNA CTD PMID:30851411 Crot Rat resveratrol multiple interactions EXP 6480464 [resveratrol co-treated with Streptozocin] results in decreased expression of CROT mRNA CTD PMID:25905778 Crot Rat resveratrol multiple interactions ISO Crot (Mus musculus) 6480464 [bisphenol A co-treated with Resveratrol co-treated with Corn Oil] results in increased expression of CROT mRNA CTD PMID:36432690 Crot Rat resveratrol multiple interactions ISO CROT (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of CROT mRNA CTD PMID:23557933 Crot Rat resveratrol decreases expression EXP 6480464 resveratrol results in decreased expression of CROT mRNA CTD PMID:25905778 Crot Rat ritonavir decreases expression EXP 6480464 Ritonavir results in decreased expression of CROT mRNA CTD PMID:17719200 Crot Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of CROT mRNA CTD PMID:28374803 Crot Rat rotenone decreases expression ISO CROT (Homo sapiens) 6480464 Rotenone results in decreased expression of CROT mRNA CTD PMID:29955902 Crot Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO CROT (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine affects the susceptibility to Lipopolysaccharides] which results in increased expression of CROT mRNA CTD PMID:35811015 Crot Rat SB 431542 multiple interactions ISO CROT (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Crot Rat silicon dioxide decreases expression ISO Crot (Mus musculus) 6480464 Silicon Dioxide results in decreased expression of CROT mRNA CTD PMID:19073995 and PMID:33720480 Crot Rat sodium arsenite increases expression EXP 6480464 sodium arsenite results in increased expression of CROT mRNA CTD PMID:25697676 Crot Rat sodium arsenite multiple interactions ISO CROT (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of CROT mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of CROT mRNA CTD PMID:39836092 Crot Rat sodium arsenite decreases expression ISO CROT (Homo sapiens) 6480464 sodium arsenite results in decreased expression of CROT mRNA CTD PMID:38568856 Crot Rat streptozocin multiple interactions EXP 6480464 [resveratrol co-treated with Streptozocin] results in decreased expression of CROT mRNA CTD PMID:25905778 Crot Rat streptozocin decreases expression EXP 6480464 Streptozocin results in decreased expression of CROT mRNA CTD PMID:25905778 Crot Rat Tesaglitazar increases expression EXP 6480464 tesaglitazar results in increased expression of CROT mRNA CTD PMID:21515302 Crot Rat tetrachloroethene increases expression ISO Crot (Mus musculus) 6480464 Tetrachloroethylene results in increased expression of CROT mRNA CTD PMID:28973375 Crot Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of CROT mRNA CTD PMID:31150632 Crot Rat tetrachloromethane decreases expression ISO Crot (Mus musculus) 6480464 Carbon Tetrachloride results in decreased expression of CROT mRNA CTD PMID:31919559 Crot Rat tetrachloromethane multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in decreased expression of CROT mRNA] CTD PMID:31150632 Crot Rat tetracycline increases expression ISO Crot (Mus musculus) 6480464 Tetracycline results in increased expression of CROT mRNA CTD PMID:16917069 Crot Rat tetracycline decreases expression ISO Crot (Mus musculus) 6480464 Tetracycline results in decreased expression of CROT mRNA CTD PMID:24489787 Crot Rat thioacetamide multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Thioacetamide] results in decreased expression of CROT mRNA CTD PMID:28943392 Crot Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of CROT mRNA CTD PMID:34492290 Crot Rat titanium dioxide decreases methylation ISO Crot (Mus musculus) 6480464 titanium dioxide results in decreased methylation of CROT promoter CTD PMID:35295148 Crot Rat trichostatin A increases expression ISO CROT (Homo sapiens) 6480464 trichostatin A results in increased expression of CROT mRNA CTD PMID:24935251 Crot Rat trichostatin A multiple interactions ISO CROT (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of CROT mRNA CTD PMID:27188386 Crot Rat trichostatin A decreases expression ISO CROT (Homo sapiens) 6480464 trichostatin A results in decreased expression of CROT mRNA CTD PMID:26272509 Crot Rat triphenyl phosphate decreases expression EXP 6480464 triphenyl phosphate results in decreased expression of CROT mRNA CTD PMID:30589522 Crot Rat triphenyl phosphate affects expression ISO CROT (Homo sapiens) 6480464 triphenyl phosphate affects the expression of CROT mRNA CTD PMID:37042841 Crot Rat tris(2-butoxyethyl) phosphate affects expression ISO CROT (Homo sapiens) 6480464 tris(2-butoxyethyl) phosphate affects the expression of CROT mRNA CTD PMID:29024780 Crot Rat troglitazone increases expression EXP 6480464 troglitazone results in increased expression of CROT mRNA CTD PMID:21515302 Crot Rat valproic acid affects expression ISO Crot (Mus musculus) 6480464 Valproic Acid affects the expression of CROT mRNA CTD PMID:17963808 Crot Rat valproic acid increases expression EXP 6480464 Valproic Acid results in increased expression of CROT mRNA CTD PMID:29427782 Crot Rat valproic acid affects expression ISO CROT (Homo sapiens) 6480464 Valproic Acid affects the expression of CROT mRNA CTD PMID:25979313 Crot Rat valproic acid decreases methylation ISO CROT (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of CROT gene CTD PMID:29154799 Crot Rat valproic acid increases expression ISO CROT (Homo sapiens) 6480464 Valproic Acid results in increased expression of CROT mRNA CTD PMID:23179753 more ... Crot Rat vinclozolin increases methylation EXP 6480464 vinclozolin results in increased methylation of CROT gene CTD PMID:31079544 Crot Rat vorinostat affects expression ISO CROT (Homo sapiens) 6480464 vorinostat affects the expression of CROT mRNA CTD PMID:27188386
Imported Annotations - SMPDB
(+)-schisandrin B (EXP) (-)-epigallocatechin 3-gallate (ISO) (R)-noradrenaline (EXP) 1,1-dichloroethene (ISO) 1,2-dimethylhydrazine (ISO) 1-naphthyl isothiocyanate (EXP) 17beta-estradiol (EXP,ISO) 17beta-hydroxy-5alpha-androstan-3-one (ISO) 2,2',4,4',5,5'-hexachlorobiphenyl (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (EXP,ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4,6-tribromophenol (ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 2,6-dinitrotoluene (EXP) 2-hydroxypropanoic acid (ISO) 3,3',4,4',5-pentachlorobiphenyl (EXP) 3H-1,2-dithiole-3-thione (EXP) 4,4'-diaminodiphenylmethane (EXP) 4,4'-sulfonyldiphenol (ISO) 4-hydroxynon-2-enal (ISO) 4-hydroxyphenyl retinamide (ISO) 6-propyl-2-thiouracil (EXP) 9-cis-retinoic acid (EXP) aflatoxin B1 (ISO) amiodarone (ISO) ammonium chloride (EXP) arsane (ISO) arsenic atom (ISO) atrazine (ISO) benzo[a]pyrene (ISO) Benzo[k]fluoranthene (ISO) beta-naphthoflavone (EXP) bexarotene (EXP) bezafibrate (EXP) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bromuconazole (EXP) cadmium atom (ISO) cadmium dichloride (EXP,ISO) cannabidiol (ISO) CGP 52608 (ISO) chlorpyrifos (ISO) cisplatin (ISO) clofibrate (EXP,ISO) clofibric acid (EXP) cobalt dichloride (EXP) copper atom (EXP) copper(0) (EXP) corn oil (EXP,ISO) cyclosporin A (ISO) DDT (EXP) decabromodiphenyl ether (ISO) deoxycholic acid (ISO) dibenz[a,h]anthracene (ISO) Dibutyl phosphate (ISO) dichloroacetic acid (ISO) dorsomorphin (ISO) endosulfan (EXP) entinostat (ISO) epoxiconazole (ISO) ethanol (ISO) ethyl methanesulfonate (ISO) fenofibrate (EXP) fentin chloride (EXP) flutamide (EXP) formaldehyde (ISO) furan (EXP) gentamycin (EXP) glafenine (EXP) glycidyl methacrylate (ISO) glyphosate (ISO) gold atom (ISO) gold(0) (ISO) indometacin (EXP) ivermectin (ISO) lipopolysaccharide (ISO) lithocholic acid (ISO) maneb (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) metformin (EXP) methapyrilene (EXP) methyl methanesulfonate (ISO) methylmercury chloride (ISO) Muraglitazar (EXP) N-nitrosodiethylamine (EXP) nefazodone (EXP) niclosamide (ISO) nimesulide (EXP) O-octanoylcarnitine (ISO) p-toluidine (EXP) paracetamol (ISO) paraquat (ISO) perfluorononanoic acid (ISO) perfluorooctane-1-sulfonic acid (EXP) perfluorooctanoic acid (EXP,ISO) permethrin (ISO) phenformin (EXP) phenobarbital (EXP,ISO) phenylmercury acetate (ISO) pirinixic acid (EXP,ISO) potassium chromate (ISO) potassium dichromate (ISO) pregnenolone 16alpha-carbonitrile (EXP,ISO) propiconazole (ISO) rac-lactic acid (ISO) resveratrol (EXP,ISO) ritonavir (EXP) rotenone (EXP,ISO) S-(1,2-dichlorovinyl)-L-cysteine (ISO) SB 431542 (ISO) silicon dioxide (ISO) sodium arsenite (EXP,ISO) streptozocin (EXP) Tesaglitazar (EXP) tetrachloroethene (ISO) tetrachloromethane (EXP,ISO) tetracycline (ISO) thioacetamide (EXP) titanium dioxide (ISO) trichostatin A (ISO) triphenyl phosphate (EXP,ISO) tris(2-butoxyethyl) phosphate (ISO) troglitazone (EXP) valproic acid (EXP,ISO) vinclozolin (EXP) vorinostat (ISO)
Biological Process
carnitine metabolic process (IEA,ISO,ISS) cellular response to norepinephrine stimulus (HEP) coenzyme A metabolic process (IEA,ISO,ISS) fatty acid beta-oxidation (IEA,ISO) fatty acid metabolic process (IEA,ISO,ISS) fatty acid transport (IEA,ISO) generation of precursor metabolites and energy (IEA,ISO,ISS) lipid metabolic process (IEA) long-chain fatty acid transport (TAS) medium-chain fatty acid metabolic process (IEA,ISO,ISS) medium-chain fatty acid transport (TAS) response to xenobiotic stimulus (IDA)
1.
Cloning, sequencing, and regulation of rat liver carnitine octanoyltransferase: transcriptional stimulation of the enzyme during peroxisome proliferation.
Chatterjee B, etal., Biochemistry 1988 Dec 13;27(25):9000-6.
2.
Molecular cloning and sequence analysis of the rat liver carnitine octanoyltransferase cDNA, its natural gene and the gene promoter.
Choi SJ, etal., Biochim Biophys Acta 1995 Nov 7;1264(2):215-22.
3.
Molecular cloning and expression of human carnitine octanoyltransferase: evidence for its role in the peroxisomal beta-oxidation of branched-chain fatty acids.
Ferdinandusse S, etal., Biochem Biophys Res Commun. 1999 Sep 16;263(1):213-8.
4.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
5.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
6.
KEGG: Kyoto Encyclopedia of Genes and Genomes
KEGG
7.
Gene expression profile of cardiomyocytes in hypertrophic heart induced by continuous norepinephrine infusion in the rats.
Li P, etal., Cell Mol Life Sci. 2003 Oct;60(10):2200-9.
8.
Gene Data Set
MGD Curation, June 12, 2002
9.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
10.
Purification and properties of carnitine octanoyltransferase and carnitine palmitoyltransferase from rat liver.
Miyazawa S, etal., J Biochem. 1983 Aug;94(2):529-42.
11.
Inhibition by etomoxir of rat liver carnitine octanoyltransferase is produced through the co-ordinate interaction with two histidine residues.
Morillas M, etal., Biochem J. 2000 Oct 15;351 Pt 2:495-502.
12.
Structural model of a malonyl-CoA-binding site of carnitine octanoyltransferase and carnitine palmitoyltransferase I: mutational analysis of a malonyl-CoA affinity domain.
Morillas M, etal., J Biol Chem 2002 Mar 29;277(13):11473-80.
13.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
14.
SMPDB Annotation Import Pipeline
Pipeline to import SMPDB annotations from SMPDB into RGD
15.
GOA pipeline
RGD automated data pipeline
16.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
17.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
18.
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.
Strausberg RL, etal., Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16899-903. Epub 2002 Dec 11.
Crot Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 26,031,729 - 26,088,057 (+) NCBI GRCr8 mRatBN7.2 4 25,068,270 - 25,133,111 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 25,080,587 - 25,133,109 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 30,097,079 - 30,131,595 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 26,023,348 - 26,057,839 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 24,409,862 - 24,444,651 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 22,079,837 - 22,116,265 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 22,081,604 - 22,116,265 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 22,018,106 - 22,053,087 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 22,023,913 - 22,067,029 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 22,023,912 - 22,067,029 (-) NCBI Celera 4 20,575,938 - 20,626,257 (+) NCBI Celera Cytogenetic Map 4 q12 NCBI
CROT Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 7 87,345,664 - 87,399,794 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 7 87,345,664 - 87,399,794 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 7 86,974,980 - 87,029,110 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 7 86,812,947 - 86,867,045 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 7 86,619,661 - 86,673,760 NCBI Celera 7 81,679,821 - 81,733,990 (+) NCBI Celera Cytogenetic Map 7 q21.12 NCBI HuRef 7 81,585,930 - 81,640,108 (+) NCBI HuRef CHM1_1 7 86,905,052 - 86,959,218 (+) NCBI CHM1_1 T2T-CHM13v2.0 7 88,595,278 - 88,649,555 (+) NCBI T2T-CHM13v2.0 CRA_TCAGchr7v2 7 86,306,455 - 86,360,622 (+) NCBI
Crot Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 5 9,016,033 - 9,047,926 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 5 9,016,033 - 9,047,324 (-) Ensembl GRCm39 Ensembl GRCm38 5 8,966,033 - 8,997,146 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 5 8,966,033 - 8,997,324 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 5 8,966,048 - 8,997,146 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 5 8,972,054 - 9,003,152 (-) NCBI MGSCv36 mm8 Celera 5 8,885,457 - 8,916,553 (-) NCBI Celera Cytogenetic Map 5 A1 NCBI cM Map 5 3.5 NCBI
Crot Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955607 378,439 - 413,394 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955607 379,121 - 413,394 (-) NCBI ChiLan1.0 ChiLan1.0
CROT Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 6 105,224,533 - 105,278,705 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 7 153,489,171 - 153,543,350 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 7 79,339,498 - 79,393,676 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 7 92,989,868 - 93,043,832 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 7 92,989,868 - 93,043,832 (+) Ensembl panpan1.1 panPan2
CROT Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 14 13,475,130 - 13,532,536 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 14 13,475,235 - 13,532,536 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 14 13,046,798 - 13,104,279 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 14 13,240,042 - 13,298,355 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 14 13,240,015 - 13,299,882 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 14 13,443,706 - 13,500,941 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 14 13,169,264 - 13,227,485 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 14 13,452,909 - 13,510,196 (+) NCBI UU_Cfam_GSD_1.0
Crot Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405118 26,538,694 - 26,575,933 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936763 1,424,935 - 1,462,679 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936763 1,425,394 - 1,462,638 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
CROT Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 9 93,258,619 - 93,308,151 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 9 93,263,606 - 93,308,150 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 9 102,743,699 - 102,788,243 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
CROT Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 21 61,531,263 - 61,584,448 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 21 61,531,060 - 61,584,447 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666042 42,477,754 - 42,533,686 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Crot
.
Predicted Target Of
Count of predictions: 109 Count of miRNA genes: 84 Interacting mature miRNAs: 103 Transcripts: ENSRNOT00000067462 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
2302371 Stl22 Serum triglyceride level QTL 22 5.15 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 4 5218294 57114705 Rat 2303585 Bw86 Body weight QTL 86 4 body mass (VT:0001259) body weight (CMO:0000012) 4 14678065 59678065 Rat 8552903 Pigfal2 Plasma insulin-like growth factor 1 level QTL 2 7.3 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 4 1 31934116 Rat 724557 Plsm1 Polydactyly-luxate syndrome (PLS) morphotypes QTL 1 0.0003 forelimb integrity trait (VT:0010562) front foot phalanges count (CMO:0001947) 4 1 27716890 Rat 9590100 Sffal4 Serum free fatty acids level QTL 4 7.36 0.05 blood free fatty acid amount (VT:0001553) plasma free fatty acids level (CMO:0000546) 4 1 31934116 Rat 8552906 Pigfal3 Plasma insulin-like growth factor 1 level QTL 3 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 4 10084089 55084089 Rat 1357341 Gluco5 Glucose level QTL 5 6.4 adipocyte free fatty acid secretion trait (VT:0010465) absolute change in adipocyte free fatty acid secretion per unit volume (CMO:0001446) 4 1 33250345 Rat 1357343 Gluco4 Glucose level QTL 4 0.00002 adipocyte glucose uptake trait (VT:0004185) adipocyte maximal glucose uptake to basal glucose uptake ratio (CMO:0000874) 4 1 33250345 Rat 6478766 Anxrr47 Anxiety related response QTL 47 0.09637 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 10084089 55084089 Rat 70222 Eae2 Experimental allergic encephalomyelitis QTL 2 4.3 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) 4 21333343 39505420 Rat 631642 Stl2 Serum triglyceride level QTL 2 3.3 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 4 5219178 56647776 Rat 6478769 Anxrr48 Anxiety related response QTL 48 0.02514 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 10084089 55084089 Rat 631261 Tcas3 Tongue tumor susceptibility QTL 3 6.88 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 4 10814170 91360527 Rat 61333 Gluco16 Glucose level QTL 16 4.3 0.00001 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 1 30372989 Rat 634323 Hc2 Hypercalciuria QTL 2 2.15 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 4 210796 45210796 Rat 2313401 Anxrr27 Anxiety related response QTL 27 aggression-related behavior trait (VT:0015014) tameness/aggressiveness composite score (CMO:0002136) 4 17933508 62933508 Rat 61408 Scl23 Serum cholesterol level QTL 23 0.0005 blood HDL phospholipid amount (VT:0010504) serum high density lipoprotein phospholipid level (CMO:0001567) 4 1 27716890 Rat 631209 Bw2 Body weight QTL2 4.2 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 4 9940885 44463908 Rat 8552803 Bw144 Body weight QTL 144 16 body mass (VT:0001259) change in body weight to body weight ratio (CMO:0002216) 4 22710685 34430484 Rat 8694374 Bw155 Body weight QTL 155 3.39 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 4 10084089 55084089 Rat 2303168 Bp330 Blood pressure QTL 330 4.25 0.017 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 5214602 146446691 Rat 9589046 Scfw2 Subcutaneous fat weight QTL 2 5.54 0.001 subcutaneous adipose mass (VT:1000472) abdominal subcutaneous fat pad weight (CMO:0002069) 4 1 31934116 Rat 61412 Pia2 Pristane induced arthritis QTL 2 3.9 joint integrity trait (VT:0010548) post-insult time to onset of experimental arthritis (CMO:0001450) 4 21333343 62278020 Rat 6478724 Anxrr35 Anxiety related response QTL 35 0.00449 defecation behavior trait (VT:0010462) defecation measurement (CMO:0000997) 4 10084089 55084089 Rat 61351 Bp33 Blood pressure QTL 33 0.0018 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 1 27716890 Rat 61415 Eae11 Experimental allergic encephalomyelitis QTL 11 2.9 nervous system integrity trait (VT:0010566) post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422) 4 1 39505420 Rat 1641905 Colcr1 Colorectal carcinoma resistance QTL 1 4.3 0.0003 intestine integrity trait (VT:0010554) benign colorectal tumor surface area measurement (CMO:0001799) 4 1 29494328 Rat 619616 Bp79 Blood pressure QTL 79 0.0292 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 5214602 78882945 Rat 7387227 Uae40 Urinary albumin excretion QTL 40 2.9 0.0052 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 4 17946999 62946999 Rat 1358201 Gluco12 Glucose level QTL12 1.6 adipocyte glucose uptake trait (VT:0004185) adipocyte maximal glucose uptake (CMO:0000870) 4 5218392 29593287 Rat 738021 Hcar13 Hepatocarcinoma resistance QTL 13 4.3 liver integrity trait (VT:0010547) liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464) 4 1 32584199 Rat 1358203 Stl19 Serum triglyceride level QTL 19 2.8 0.002 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 4 5218294 65958103 Rat 9590304 Scort17 Serum corticosterone level QTL 17 4.96 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 10084089 55084089 Rat 9589097 Slep11 Serum leptin concentration QTL 11 5.09 0.001 blood leptin amount (VT:0005667) plasma leptin level (CMO:0000781) 4 1 31934116 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 1354665 Stl10 Serum triglyceride level QTL 10 3.57 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 4 21333343 44463908 Rat 1300141 Bp178 Blood pressure QTL 178 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 10024901 39524530 Rat
RH142432
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 25,132,724 - 25,132,963 (+) MAPPER mRatBN7.2 Rnor_6.0 4 22,115,881 - 22,116,119 NCBI Rnor6.0 Rnor_5.0 4 22,052,703 - 22,052,941 UniSTS Rnor5.0 RGSC_v3.4 4 22,024,059 - 22,024,297 UniSTS RGSC3.4 Celera 4 20,625,873 - 20,626,111 UniSTS Cytogenetic Map 4 q12 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000067462 ⟹ ENSRNOP00000063856
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 25,098,110 - 25,133,105 (+) Ensembl Rnor_6.0 Ensembl 4 22,081,604 - 22,116,265 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000090968 ⟹ ENSRNOP00000071087
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 25,107,632 - 25,133,109 (+) Ensembl Rnor_6.0 Ensembl 4 22,084,954 - 22,111,749 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000091799 ⟹ ENSRNOP00000073847
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 25,080,587 - 25,133,109 (+) Ensembl Rnor_6.0 Ensembl 4 22,082,194 - 22,116,241 (+) Ensembl
RefSeq Acc Id:
NM_031987 ⟹ NP_114193
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 26,053,124 - 26,088,057 (+) NCBI mRatBN7.2 4 25,098,174 - 25,133,109 (+) NCBI Rnor_6.0 4 22,081,604 - 22,116,265 (+) NCBI Rnor_5.0 4 22,018,106 - 22,053,087 (+) NCBI RGSC_v3.4 4 22,023,913 - 22,067,029 (-) RGD Celera 4 20,575,938 - 20,626,257 (+) RGD
Sequence:
GAGTGCAGAGAGCCAAGCCGGGTGCAGGAGTTTTCTTACTGTGACTATACCATGGAAAATCAATTGGCTAAGTCAATTGAAGAACGAACATTCCAGTACCAGGACTCTCTTCCGCCCTTGCCCGTTCC
hide sequence
RefSeq Acc Id:
XM_006236004 ⟹ XP_006236066
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 26,049,329 - 26,088,057 (+) NCBI mRatBN7.2 4 25,098,279 - 25,133,111 (+) NCBI Rnor_6.0 4 22,081,673 - 22,116,264 (+) NCBI Rnor_5.0 4 22,018,106 - 22,053,087 (+) NCBI
Sequence:
CCCACACGGCGAGGGGTTAAGGGGTATTGCAGTAGCGCGAAGCTGAGCTGAATGCAGTCCGGCTGTGCGCCGAGGCGTCCGGGTCAGGCGCGGGCGTGGTGTCCCCAGAGCATCTCGCCCTTCTGGTT
hide sequence
RefSeq Acc Id:
XM_006236005 ⟹ XP_006236067
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 26,049,329 - 26,088,057 (+) NCBI mRatBN7.2 4 25,097,399 - 25,133,111 (+) NCBI Rnor_6.0 4 22,079,837 - 22,116,264 (+) NCBI Rnor_5.0 4 22,018,106 - 22,053,087 (+) NCBI
Sequence:
AGTACTAGAAATCAATGGTTTTTATAGAAACTTTAAAAAGTTATAATCTCCACTAAGCTAATTT
hide sequence
RefSeq Acc Id:
XM_039108454 ⟹ XP_038964382
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 26,031,729 - 26,088,057 (+) NCBI mRatBN7.2 4 25,079,428 - 25,133,111 (+) NCBI
RefSeq Acc Id:
XM_039108458 ⟹ XP_038964386
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 26,031,729 - 26,088,057 (+) NCBI mRatBN7.2 4 25,079,428 - 25,133,111 (+) NCBI
RefSeq Acc Id:
NP_114193 ⟸ NM_031987
- UniProtKB:
P48033 (UniProtKB/Swiss-Prot), P11466 (UniProtKB/Swiss-Prot), Q6GMN6 (UniProtKB/TrEMBL), A6K232 (UniProtKB/TrEMBL), F7F5D0 (UniProtKB/TrEMBL)
- Sequence:
MENQLAKSIEERTFQYQDSLPPLPVPSLEESLKKYLESVKPFANEDEYKKTEEIVQKFQDGVGKTLHQKLLERAKGKRNWLEEWWLNVAYLDVRIPSQLNVNFVGPSPHFEHYWPAREGTQLERGSIL
hide sequence
RefSeq Acc Id:
XP_006236067 ⟸ XM_006236005
- Peptide Label:
isoform X2
- UniProtKB:
P48033 (UniProtKB/Swiss-Prot), P11466 (UniProtKB/Swiss-Prot), Q6GMN6 (UniProtKB/TrEMBL), A6K232 (UniProtKB/TrEMBL), F7F5D0 (UniProtKB/TrEMBL)
- Sequence:
MENQLAKSIEERTFQYQDSLPPLPVPSLEESLKKYLESVKPFANEDEYKKTEEIVQKFQDGVGKTLHQKLLERAKGKRNWLEEWWLNVAYLDVRIPSQLNVNFVGPSPHFEHYWPAREGTQLERGSIL
hide sequence
RefSeq Acc Id:
XP_006236066 ⟸ XM_006236004
- Peptide Label:
isoform X1
- UniProtKB:
P48033 (UniProtKB/Swiss-Prot), P11466 (UniProtKB/Swiss-Prot)
- Sequence:
MQSGCAPRRPGQARAWCPQSISPFWFGVLTPSVAPALLECRSADRLFSYCDYTMENQLAKSIEERTFQYQDSLPPLPVPSLEESLKKYLESVKPFANEDEYKKTEEIVQKFQDGVGKTLHQKLLERAK
hide sequence
Ensembl Acc Id:
ENSRNOP00000063856 ⟸ ENSRNOT00000067462
Ensembl Acc Id:
ENSRNOP00000071087 ⟸ ENSRNOT00000090968
Ensembl Acc Id:
ENSRNOP00000073847 ⟸ ENSRNOT00000091799
RefSeq Acc Id:
XP_038964382 ⟸ XM_039108454
- Peptide Label:
isoform X2
- UniProtKB:
P48033 (UniProtKB/Swiss-Prot), P11466 (UniProtKB/Swiss-Prot), A6K232 (UniProtKB/TrEMBL), F7F5D0 (UniProtKB/TrEMBL), Q6GMN6 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038964386 ⟸ XM_039108458
- Peptide Label:
isoform X2
- UniProtKB:
P48033 (UniProtKB/Swiss-Prot), P11466 (UniProtKB/Swiss-Prot), Q6GMN6 (UniProtKB/TrEMBL), A6K232 (UniProtKB/TrEMBL), F7F5D0 (UniProtKB/TrEMBL)
RGD ID: 13692826 Promoter ID: EPDNEW_R3351 Type: initiation region Name: Crot_1 Description: carnitine O-octanoyltransferase SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 4 22,081,564 - 22,081,624 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2002-07-09
Crot
carnitine O-octanoyltransferase
Symbol and Name updated to reflect Human and Mouse nomenclature
70877 APPROVED
Note Type
Note
Reference
gene_regulation
activity is inhibited by malonyl-CoA
727629
