Symbol:
Gpm6a
Name:
glycoprotein m6a
RGD ID:
631368
Description:
Enables calcium channel activity. Involved in positive regulation of filopodium assembly; regulation of synapse organization; and synapse assembly. Located in several cellular components, including filopodium; neuron projection; and neuronal cell body. Is active in glutamatergic synapse; parallel fiber to Purkinje cell synapse; and presynaptic active zone membrane. Orthologous to human GPM6A (glycoprotein M6A); INTERACTS WITH 2,2',4,4'-Tetrabromodiphenyl ether; 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
M6a; neuronal membrane glycoprotein M6-a
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
GPM6A (glycoprotein M6A) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Gpm6a (glycoprotein m6a) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Gpm6a (glycoprotein M6A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
GPM6A (glycoprotein M6A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
GPM6A (glycoprotein M6A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Gpm6a (glycoprotein M6A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
GPM6A (glycoprotein M6A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
GPM6A (glycoprotein M6A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Gpm6a (glycoprotein M6A) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
GPM6A (glycoprotein M6A)
Alliance
DIOPT (HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Gpm6a (glycoprotein m6a)
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
gpm6aa (glycoprotein M6Aa)
Alliance
DIOPT (OMA|OrthoFinder|PANTHER)
Danio rerio (zebrafish):
gpm6ab (glycoprotein M6Ab)
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Drosophila melanogaster (fruit fly):
M6
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
nmgp-1
Alliance
DIOPT (Ensembl Compara|Hieranoid|OrthoFinder|PANTHER)
Xenopus tropicalis (tropical clawed frog):
gpm6a
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 16 43,374,385 - 43,706,461 (-) NCBI GRCr8 mRatBN7.2 16 36,641,282 - 36,973,377 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 16 36,641,284 - 36,973,475 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 16 42,008,018 - 42,338,043 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 16 45,368,826 - 45,698,861 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 16 40,750,344 - 41,066,575 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 16 39,367,697 - 39,719,292 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 16 39,367,692 - 39,719,187 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 16 39,144,853 - 39,493,517 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 16 39,670,748 - 39,783,384 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 16 39,670,823 - 39,783,459 (-) NCBI Celera 16 34,795,943 - 34,908,788 (-) NCBI Celera Cytogenetic Map 16 p11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Gpm6a Rat (2,4,5-trichlorophenoxy)acetic acid decreases expression ISO Gpm6a (Mus musculus) 6480464 2 more ... CTD PMID:18579281 Gpm6a Rat 1,1-dichloroethene decreases expression ISO Gpm6a (Mus musculus) 6480464 vinylidene chloride results in decreased expression of GPM6A mRNA CTD PMID:26682919 Gpm6a Rat 1,2-dimethylhydrazine decreases expression ISO Gpm6a (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of GPM6A mRNA CTD PMID:22206623 Gpm6a Rat 17beta-estradiol multiple interactions ISO GPM6A (Homo sapiens) 6480464 [Estradiol co-treated with TGFB1 protein] results in decreased expression of GPM6A mRNA CTD PMID:30165855 Gpm6a Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression EXP 6480464 2 more ... CTD PMID:27291303 Gpm6a Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Gpm6a (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of GPM6A mRNA CTD PMID:24680724 Gpm6a Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of GPM6A mRNA CTD PMID:32109520 and PMID:33387578 Gpm6a Rat 2,3,7,8-Tetrachlorodibenzofuran decreases expression EXP 6480464 2 more ... CTD PMID:32109520 Gpm6a Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Gpm6a (Mus musculus) 6480464 2 more ... CTD PMID:38648751 Gpm6a Rat 3,4-methylenedioxymethamphetamine decreases expression EXP 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of GPM6A mRNA CTD PMID:30071829 Gpm6a Rat 4,4'-sulfonyldiphenol increases expression ISO Gpm6a (Mus musculus) 6480464 bisphenol S results in increased expression of GPM6A mRNA CTD PMID:31881267 Gpm6a Rat 4-hydroxyphenyl retinamide decreases expression ISO Gpm6a (Mus musculus) 6480464 Fenretinide results in decreased expression of GPM6A mRNA CTD PMID:28973697 Gpm6a Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of GPM6A mRNA CTD PMID:24780913 Gpm6a Rat aflatoxin B1 decreases expression ISO GPM6A (Homo sapiens) 6480464 Aflatoxin B1 results in decreased expression of GPM6A mRNA CTD PMID:22100608 and PMID:32234424 Gpm6a Rat aflatoxin B1 affects methylation ISO GPM6A (Homo sapiens) 6480464 Aflatoxin B1 affects the methylation of GPM6A intron CTD PMID:30157460 Gpm6a Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of GPM6A mRNA CTD PMID:16483693 Gpm6a Rat aristolochic acid A multiple interactions EXP 6480464 [aristolochic acid I co-treated with aristolochic acid II] results in decreased expression of GPM6A mRNA CTD PMID:23912714 Gpm6a Rat arsenite(3-) multiple interactions ISO GPM6A (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to GPM6A mRNA] CTD PMID:32406909 Gpm6a Rat arsenous acid increases expression ISO GPM6A (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of GPM6A mRNA CTD PMID:15761015 Gpm6a Rat benzo[a]pyrene increases methylation ISO GPM6A (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of GPM6A 5' UTR and Benzo(a)pyrene results in increased methylation of GPM6A promoter CTD PMID:27901495 Gpm6a Rat benzo[a]pyrene decreases expression ISO GPM6A (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of GPM6A mRNA CTD PMID:32234424 Gpm6a Rat benzo[a]pyrene affects methylation ISO GPM6A (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of GPM6A exon and Benzo(a)pyrene affects the methylation of GPM6A intron CTD PMID:27901495 and PMID:30157460 Gpm6a Rat Benzo[ghi]perylene increases expression ISO Gpm6a (Mus musculus) 6480464 1 and 12-benzoperylene results in increased expression of GPM6A mRNA CTD PMID:26377693 Gpm6a Rat Benzo[k]fluoranthene decreases expression ISO Gpm6a (Mus musculus) 6480464 benzo(k)fluoranthene results in decreased expression of GPM6A mRNA CTD PMID:26377693 Gpm6a Rat beta-naphthoflavone multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in increased expression of GPM6A mRNA CTD PMID:18164116 Gpm6a Rat bexarotene multiple interactions EXP 6480464 [bexarotene co-treated with Tamoxifen] results in increased expression of GPM6A mRNA CTD PMID:17630414 Gpm6a Rat bis(2-ethylhexyl) phthalate increases expression ISO Gpm6a (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of GPM6A mRNA CTD PMID:28085963 Gpm6a Rat bis(2-ethylhexyl) phthalate decreases expression ISO GPM6A (Homo sapiens) 6480464 Diethylhexyl Phthalate results in decreased expression of GPM6A mRNA CTD PMID:31163220 Gpm6a Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of GPM6A mRNA CTD PMID:25181051 Gpm6a Rat bisphenol A decreases expression ISO GPM6A (Homo sapiens) 6480464 bisphenol A results in decreased expression of GPM6A protein CTD PMID:37664457 Gpm6a Rat bisphenol A increases expression ISO Gpm6a (Mus musculus) 6480464 bisphenol A results in increased expression of GPM6A mRNA CTD PMID:32156529 Gpm6a Rat bisphenol A multiple interactions ISO GPM6A (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in increased methylation of GPM6A gene CTD PMID:31601247 Gpm6a Rat bisphenol A affects methylation ISO GPM6A (Homo sapiens) 6480464 bisphenol A affects the methylation of GPM6A gene CTD PMID:31601247 Gpm6a Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of GPM6A mRNA CTD PMID:32145629 Gpm6a Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of GPM6A mRNA CTD PMID:30816183 and PMID:33296240 Gpm6a Rat cadmium atom decreases expression ISO Gpm6a (Mus musculus) 6480464 Cadmium results in decreased expression of GPM6A mRNA CTD PMID:24067728 Gpm6a Rat cadmium dichloride decreases methylation EXP 6480464 Cadmium Chloride results in decreased methylation of GPM6A promoter CTD PMID:22457795 Gpm6a Rat carbon nanotube decreases expression ISO Gpm6a (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Gpm6a Rat CGP 52608 multiple interactions ISO GPM6A (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to GPM6A gene] CTD PMID:28238834 Gpm6a Rat chlorohydrocarbon multiple interactions EXP 6480464 [Hydrocarbons and Chlorinated co-treated with Polychlorinated Biphenyls co-treated with methylmercuric chloride] results in increased expression of GPM6A mRNA CTD PMID:30744511 Gpm6a Rat cobalt atom decreases expression ISO Gpm6a (Mus musculus) 6480464 Cobalt results in decreased expression of GPM6A mRNA CTD PMID:34468815 Gpm6a Rat cobalt dichloride increases expression ISO GPM6A (Homo sapiens) 6480464 cobaltous chloride results in increased expression of GPM6A mRNA CTD PMID:17553155 Gpm6a Rat cocaine decreases expression ISO GPM6A (Homo sapiens) 6480464 Cocaine results in decreased expression of GPM6A mRNA CTD PMID:12629581 Gpm6a Rat copper(II) sulfate decreases expression ISO Gpm6a (Mus musculus) 6480464 Copper Sulfate results in decreased expression of GPM6A mRNA CTD PMID:18579281 Gpm6a Rat Cuprizon decreases expression EXP 6480464 Cuprizone results in decreased expression of GPM6A mRNA CTD PMID:26577399 Gpm6a Rat cytarabine increases expression ISO GPM6A (Homo sapiens) 6480464 Cytarabine results in increased expression of GPM6A mRNA CTD PMID:21198554 Gpm6a Rat diarsenic trioxide increases expression ISO GPM6A (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of GPM6A mRNA CTD PMID:15761015 Gpm6a Rat diquat decreases expression ISO Gpm6a (Mus musculus) 6480464 Diquat results in decreased expression of GPM6A mRNA CTD PMID:36851058 Gpm6a Rat diuron decreases expression EXP 6480464 Diuron results in decreased expression of GPM6A mRNA CTD PMID:25152437 Gpm6a Rat dorsomorphin multiple interactions ISO GPM6A (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Gpm6a Rat doxorubicin increases expression ISO Gpm6a (Mus musculus) 6480464 Doxorubicin results in increased expression of GPM6A mRNA CTD PMID:17888722 Gpm6a Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of GPM6A mRNA CTD PMID:29391264 Gpm6a Rat entinostat increases expression ISO GPM6A (Homo sapiens) 6480464 entinostat results in increased expression of GPM6A mRNA CTD PMID:26272509 Gpm6a Rat entinostat multiple interactions ISO GPM6A (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of GPM6A mRNA CTD PMID:27188386 Gpm6a Rat ethanol affects splicing ISO Gpm6a (Mus musculus) 6480464 Ethanol affects the splicing of GPM6A mRNA CTD PMID:30319688 Gpm6a Rat fenvalerate increases expression EXP 6480464 fenvalerate results in increased expression of GPM6A mRNA CTD PMID:30307764 Gpm6a Rat folic acid decreases expression ISO Gpm6a (Mus musculus) 6480464 Folic Acid results in decreased expression of GPM6A mRNA CTD PMID:25629700 Gpm6a Rat fonofos increases methylation ISO GPM6A (Homo sapiens) 6480464 Fonofos results in increased methylation of GPM6A promoter CTD PMID:22847954 Gpm6a Rat fulvestrant multiple interactions ISO GPM6A (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in increased methylation of GPM6A gene CTD PMID:31601247 Gpm6a Rat genistein increases expression ISO Gpm6a (Mus musculus) 6480464 Genistein results in increased expression of GPM6A mRNA CTD PMID:32186404 Gpm6a Rat Indeno[1,2,3-cd]pyrene decreases expression ISO Gpm6a (Mus musculus) 6480464 indeno(1 more ... CTD PMID:26377693 Gpm6a Rat ivermectin decreases expression ISO GPM6A (Homo sapiens) 6480464 Ivermectin results in decreased expression of GPM6A protein CTD PMID:32959892 Gpm6a Rat lead(0) affects expression ISO GPM6A (Homo sapiens) 6480464 Lead affects the expression of GPM6A mRNA CTD PMID:28903495 Gpm6a Rat mercury dibromide increases expression ISO GPM6A (Homo sapiens) 6480464 mercuric bromide results in increased expression of GPM6A mRNA CTD PMID:26272509 Gpm6a Rat Mesaconitine increases expression EXP 6480464 mesaconitine results in increased expression of GPM6A protein CTD PMID:37182599 Gpm6a Rat methylmercury chloride decreases expression ISO GPM6A (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of GPM6A mRNA CTD PMID:28001369 Gpm6a Rat methylmercury chloride increases expression ISO GPM6A (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of GPM6A mRNA CTD PMID:34089799 Gpm6a Rat methylmercury chloride multiple interactions EXP 6480464 [Hydrocarbons and Chlorinated co-treated with Polychlorinated Biphenyls co-treated with methylmercuric chloride] results in increased expression of GPM6A mRNA CTD PMID:30744511 Gpm6a Rat N-methyl-4-phenylpyridinium increases expression EXP 6480464 1-Methyl-4-phenylpyridinium results in increased expression of GPM6A mRNA CTD PMID:28801915 Gpm6a Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with beta-Naphthoflavone] results in increased expression of GPM6A mRNA CTD PMID:18164116 Gpm6a Rat N-nitrosodiethylamine multiple interactions ISO Gpm6a (Mus musculus) 6480464 [Diethylnitrosamine co-treated with Phenobarbital] results in decreased expression of GPM6A mRNA CTD PMID:24535843 Gpm6a Rat N-Nitrosopyrrolidine decreases expression ISO GPM6A (Homo sapiens) 6480464 N-Nitrosopyrrolidine results in decreased expression of GPM6A mRNA CTD PMID:32234424 Gpm6a Rat O-methyleugenol decreases expression ISO GPM6A (Homo sapiens) 6480464 methyleugenol results in decreased expression of GPM6A mRNA CTD PMID:32234424 Gpm6a Rat ozone multiple interactions ISO Gpm6a (Mus musculus) 6480464 [Air Pollutants results in increased abundance of Ozone] which results in decreased expression of GPM6A mRNA CTD PMID:27106289 Gpm6a Rat ozone multiple interactions EXP 6480464 [Air Pollutants results in increased abundance of Ozone] which results in decreased expression of GPM6A mRNA CTD PMID:37871705 Gpm6a Rat ozone multiple interactions ISO GPM6A (Homo sapiens) 6480464 [Air Pollutants results in increased abundance of Ozone] which affects the expression of GPM6A mRNA CTD PMID:35430440 Gpm6a Rat parathion increases methylation ISO GPM6A (Homo sapiens) 6480464 Parathion results in increased methylation of GPM6A promoter CTD PMID:22847954 Gpm6a Rat phenobarbital multiple interactions ISO Gpm6a (Mus musculus) 6480464 [Diethylnitrosamine co-treated with Phenobarbital] results in decreased expression of GPM6A mRNA CTD PMID:24535843 Gpm6a Rat phenylephrine decreases expression EXP 6480464 Phenylephrine results in decreased expression of GPM6A mRNA CTD PMID:18158353 Gpm6a Rat phenylmercury acetate increases expression ISO GPM6A (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of GPM6A mRNA CTD PMID:26272509 Gpm6a Rat phenylmercury acetate multiple interactions ISO GPM6A (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of GPM6A mRNA CTD PMID:27188386 Gpm6a Rat phenytoin increases expression EXP 6480464 Phenytoin results in increased expression of GPM6A mRNA CTD PMID:20345932 Gpm6a Rat pioglitazone multiple interactions ISO Gpm6a (Mus musculus) 6480464 [N-nitroso-tris-chloroethylurea co-treated with pioglitazone] results in decreased expression of GPM6A mRNA CTD PMID:27935865 Gpm6a Rat potassium dichromate increases expression ISO Gpm6a (Mus musculus) 6480464 Potassium Dichromate results in increased expression of GPM6A mRNA CTD PMID:23608068 Gpm6a Rat SB 431542 multiple interactions ISO GPM6A (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Gpm6a Rat sodium arsenite decreases expression ISO Gpm6a (Mus musculus) 6480464 sodium arsenite results in decreased expression of GPM6A mRNA CTD PMID:32068019 Gpm6a Rat sodium arsenite decreases expression ISO GPM6A (Homo sapiens) 6480464 sodium arsenite results in decreased expression of GPM6A mRNA CTD PMID:34032870 Gpm6a Rat sodium dichromate affects expression EXP 6480464 sodium bichromate affects the expression of GPM6A mRNA CTD PMID:22110744 Gpm6a Rat tamoxifen multiple interactions EXP 6480464 [bexarotene co-treated with Tamoxifen] results in increased expression of GPM6A mRNA CTD PMID:17630414 Gpm6a Rat terbufos increases methylation ISO GPM6A (Homo sapiens) 6480464 terbufos results in increased methylation of GPM6A promoter CTD PMID:22847954 Gpm6a Rat theophylline increases expression ISO GPM6A (Homo sapiens) 6480464 Theophylline results in increased expression of GPM6A mRNA CTD PMID:16083514 Gpm6a Rat titanium dioxide affects expression ISO Gpm6a (Mus musculus) 6480464 titanium dioxide affects the expression of GPM6A mRNA CTD PMID:23557971 Gpm6a Rat titanium dioxide decreases expression EXP 6480464 titanium dioxide results in decreased expression of GPM6A mRNA CTD PMID:30012374 Gpm6a Rat trichostatin A increases expression ISO GPM6A (Homo sapiens) 6480464 trichostatin A results in increased expression of GPM6A mRNA CTD PMID:24935251 and PMID:26272509 Gpm6a Rat trichostatin A multiple interactions ISO GPM6A (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of GPM6A mRNA CTD PMID:27188386 Gpm6a Rat triclosan decreases expression ISO GPM6A (Homo sapiens) 6480464 Triclosan results in decreased expression of GPM6A mRNA CTD PMID:30510588 Gpm6a Rat trimellitic anhydride decreases expression ISO Gpm6a (Mus musculus) 6480464 trimellitic anhydride results in decreased expression of GPM6A mRNA CTD PMID:19042947 Gpm6a Rat valproic acid decreases expression ISO GPM6A (Homo sapiens) 6480464 Valproic Acid results in decreased expression of GPM6A mRNA CTD PMID:23179753 Gpm6a Rat valproic acid multiple interactions ISO GPM6A (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of GPM6A mRNA CTD PMID:27188386 Gpm6a Rat valproic acid increases expression ISO GPM6A (Homo sapiens) 6480464 Valproic Acid results in increased expression of GPM6A mRNA CTD PMID:19101580 more ... Gpm6a Rat vancomycin increases expression ISO Gpm6a (Mus musculus) 6480464 Vancomycin results in increased expression of GPM6A mRNA CTD PMID:18930951 Gpm6a Rat vinclozolin increases expression EXP 6480464 vinclozolin results in increased expression of GPM6A mRNA CTD PMID:23869203
(2,4,5-trichlorophenoxy)acetic acid (ISO) 1,1-dichloroethene (ISO) 1,2-dimethylhydrazine (ISO) 17beta-estradiol (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,3,7,8-Tetrachlorodibenzofuran (EXP) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 3,4-methylenedioxymethamphetamine (EXP) 4,4'-sulfonyldiphenol (ISO) 4-hydroxyphenyl retinamide (ISO) 6-propyl-2-thiouracil (EXP) aflatoxin B1 (ISO) ammonium chloride (EXP) aristolochic acid A (EXP) arsenite(3-) (ISO) arsenous acid (ISO) benzo[a]pyrene (ISO) Benzo[ghi]perylene (ISO) Benzo[k]fluoranthene (ISO) beta-naphthoflavone (EXP) bexarotene (EXP) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) cadmium atom (ISO) cadmium dichloride (EXP) carbon nanotube (ISO) CGP 52608 (ISO) chlorohydrocarbon (EXP) cobalt atom (ISO) cobalt dichloride (ISO) cocaine (ISO) copper(II) sulfate (ISO) Cuprizon (EXP) cytarabine (ISO) diarsenic trioxide (ISO) diquat (ISO) diuron (EXP) dorsomorphin (ISO) doxorubicin (ISO) endosulfan (EXP) entinostat (ISO) ethanol (ISO) fenvalerate (EXP) folic acid (ISO) fonofos (ISO) fulvestrant (ISO) genistein (ISO) Indeno[1,2,3-cd]pyrene (ISO) ivermectin (ISO) lead(0) (ISO) mercury dibromide (ISO) Mesaconitine (EXP) methylmercury chloride (EXP,ISO) N-methyl-4-phenylpyridinium (EXP) N-nitrosodiethylamine (EXP,ISO) N-Nitrosopyrrolidine (ISO) O-methyleugenol (ISO) ozone (EXP,ISO) parathion (ISO) phenobarbital (ISO) phenylephrine (EXP) phenylmercury acetate (ISO) phenytoin (EXP) pioglitazone (ISO) potassium dichromate (ISO) SB 431542 (ISO) sodium arsenite (ISO) sodium dichromate (EXP) tamoxifen (EXP) terbufos (ISO) theophylline (ISO) titanium dioxide (EXP,ISO) trichostatin A (ISO) triclosan (ISO) trimellitic anhydride (ISO) valproic acid (ISO) vancomycin (ISO) vinclozolin (EXP)
Biological Process
calcium ion transmembrane transport (IEA) nervous system development (IEA) neural retina development (IEA,ISO,ISS) neuron migration (IEA,ISO,ISS) neuron projection development (IBA) neuron projection morphogenesis (IEA,ISO,ISS) positive regulation of filopodium assembly (IDA) regulation of synapse organization (IDA,IMP) response to bacterium (IEA,ISO) stem cell differentiation (IEA,ISO,ISS) synapse assembly (IDA)
Cellular Component
axon (IEA) axonal growth cone (IBA,IEA,ISO,ISS) cell projection (IEA) dendritic spine (IEA) filopodium (IBA,IDA,IEA) glutamatergic synapse (EXP,IDA,IMP) growth cone (IEA) membrane (IEA) neuron projection (IDA,IEA) neuronal cell body (IBA,IDA) parallel fiber to Purkinje cell synapse (IDA) plasma membrane (IBA,IDA,IEA) presynapse (IDA) presynaptic active zone membrane (EXP,IDA) synapse (IEA)
1.
The stress-regulated protein M6a is a key modulator for neurite outgrowth and filopodium/spine formation.
Alfonso J, etal., Proc Natl Acad Sci U S A. 2005 Nov 22;102(47):17196-201. Epub 2005 Nov 14.
2.
Molecular profiling of synaptic vesicle docking sites reveals novel proteins but few differences between glutamatergic and GABAergic synapses.
Boyken J, etal., Neuron. 2013 Apr 24;78(2):285-97. doi: 10.1016/j.neuron.2013.02.027.
3.
Evidence for a role of glycoprotein M6a in dendritic spine formation and synaptogenesis.
Formoso K, etal., Mol Cell Neurosci. 2016 Dec;77:95-104. doi: 10.1016/j.mcn.2016.10.005. Epub 2016 Oct 26.
4.
Cysteine residues in the large extracellular loop (EC2) are essential for the function of the stress-regulated glycoprotein M6a.
Fuchsova B, etal., J Biol Chem. 2009 Nov 13;284(46):32075-88. doi: 10.1074/jbc.M109.012377. Epub 2009 Sep 8.
5.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
6.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
7.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
8.
M6a acts as a nerve growth factor-gated Ca(2+) channel in neuronal differentiation.
Mukobata S, etal., Biochem Biophys Res Commun 2002 Oct 4;297(4):722-8.
9.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
10.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
11.
Immunoelectron microscopic localization of the M6a antigen in rat brain.
Roussel G, etal., J Neurocytol. 1998 Sep;27(9):695-703. doi: 10.1023/a:1006924400768.
12.
Neuronal glycoprotein M6a induces filopodia formation via association with cholesterol-rich lipid rafts.
Scorticati C, etal., J Neurochem. 2011 Nov;119(3):521-31. doi: 10.1111/j.1471-4159.2011.07252.x. Epub 2011 Apr 13.
13.
Membrane glycoprotein M6a interacts with the micro-opioid receptor and facilitates receptor endocytosis and recycling.
Wu DF, etal., J Biol Chem. 2007 Jul 27;282(30):22239-47. Epub 2007 Jun 4.
Gpm6a Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 16 43,374,385 - 43,706,461 (-) NCBI GRCr8 mRatBN7.2 16 36,641,282 - 36,973,377 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 16 36,641,284 - 36,973,475 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 16 42,008,018 - 42,338,043 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 16 45,368,826 - 45,698,861 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 16 40,750,344 - 41,066,575 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 16 39,367,697 - 39,719,292 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 16 39,367,692 - 39,719,187 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 16 39,144,853 - 39,493,517 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 16 39,670,748 - 39,783,384 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 16 39,670,823 - 39,783,459 (-) NCBI Celera 16 34,795,943 - 34,908,788 (-) NCBI Celera Cytogenetic Map 16 p11 NCBI
GPM6A Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 4 175,632,937 - 176,002,393 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 4 175,632,934 - 176,002,664 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 4 176,554,088 - 176,923,544 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 4 176,791,082 - 177,160,642 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 4 176,929,237 - 177,298,797 NCBI Celera 4 173,882,262 - 174,251,819 (-) NCBI Celera Cytogenetic Map 4 q34.2 NCBI HuRef 4 172,304,394 - 172,674,410 (-) NCBI HuRef CHM1_1 4 176,530,612 - 176,900,675 (-) NCBI CHM1_1 T2T-CHM13v2.0 4 178,971,366 - 179,340,845 (-) NCBI T2T-CHM13v2.0
Gpm6a Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 8 55,232,469 - 55,513,913 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 8 55,407,878 - 55,513,906 (+) Ensembl GRCm39 Ensembl GRCm38 8 54,779,434 - 55,060,878 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 8 54,954,843 - 55,060,871 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 8 56,040,081 - 56,146,231 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 8 56,453,541 - 56,559,569 (+) NCBI MGSCv36 mm8 Celera 8 57,650,307 - 57,756,272 (+) NCBI Celera Cytogenetic Map 8 B1.3 NCBI cM Map 8 29.33 NCBI
Gpm6a Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955403 31,861,945 - 31,997,382 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955403 31,704,540 - 31,997,382 (+) NCBI ChiLan1.0 ChiLan1.0
GPM6A Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 3 173,359,853 - 173,727,990 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 4 173,740,237 - 174,109,774 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 4 167,826,285 - 168,194,244 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 4 180,059,938 - 180,428,838 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 4 180,059,938 - 180,428,459 (-) Ensembl panpan1.1 panPan2
GPM6A Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 16 53,697,830 - 53,846,773 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 16 53,698,043 - 53,845,259 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 16 49,017,267 - 49,350,436 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 16 55,829,048 - 56,161,090 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 16 55,829,183 - 56,163,600 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 16 53,724,013 - 54,054,937 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 16 54,320,566 - 54,651,964 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 16 54,556,465 - 54,887,736 (+) NCBI UU_Cfam_GSD_1.0
Gpm6a Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404943 25,924,766 - 26,232,887 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936516 6,338,819 - 6,481,425 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936516 6,339,058 - 6,647,412 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
GPM6A Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 15 38,259,244 - 38,305,603 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 15 38,258,496 - 38,555,129 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 15 43,980,735 - 44,241,919 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
GPM6A Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 7 121,715,329 - 122,082,175 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 7 121,714,770 - 121,894,739 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666037 101,794,371 - 102,161,053 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Gpm6a
.
Predicted Target Of
Count of predictions: 562 Count of miRNA genes: 278 Interacting mature miRNAs: 354 Transcripts: ENSRNOT00000014312 Prediction methods: Microtar, Miranda, Targetscan Result types: miRGate_prediction
631561 Hcuc2 Hepatic copper content QTL 2 2.8 liver copper amount (VT:0003065) liver total copper weight (CMO:0001507) 16 1 39533949 Rat 70215 Niddm29 Non-insulin dependent diabetes mellitus QTL 29 3.54 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 16 19004435 75226532 Rat 1578768 Stresp22 Stress response QTL 22 2.8 thymus mass (VT:0004954) thymus wet weight (CMO:0000855) 16 35288870 80288870 Rat 2302057 Pia29 Pristane induced arthritis QTL 29 3.6 0.001 blood autoantibody amount (VT:0003725) serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111) 16 21735975 66735975 Rat 1354584 Despr6 Despair related QTL 6 3.1 0.0067 locomotor behavior trait (VT:0001392) amount of time spent in voluntary immobility (CMO:0001043) 16 1 39533930 Rat 737819 Hcas4 Hepatocarcinoma susceptibility QTL 4 4.43 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 16 4227609 46975965 Rat 1354625 Despr7 Despair related QTL 7 3.16 0.016 locomotor behavior trait (VT:0001392) amount of time spent in voluntary immobility (CMO:0001043) 16 1 44977551 Rat 6903294 Stl30 Serum triglyceride level QTL 30 2.6 0.0013 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 16 25152793 70152793 Rat 61338 Bp23 Blood pressure QTL 23 4.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 16 4227609 49227609 Rat 61405 Niddm6 Non-insulin dependent diabetes mellitus QTL 6 3.66 0.001 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 16 4227609 48972724 Rat 7411664 Foco30 Food consumption QTL 30 11 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 16 1 44588133 Rat 1600378 Arunc4 Aerobic running capacity QTL 4 0.03 exercise endurance trait (VT:0002332) maximum distance run on treadmill (CMO:0001406) 16 380245 80345693 Rat 70183 BpQTLcluster13 Blood pressure QTL cluster 13 3.654 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 16 4227609 43025077 Rat 737826 Alc11 Alcohol consumption QTL 11 3.2 consumption behavior trait (VT:0002069) ethanol drink intake rate (CMO:0001407) 16 4227609 60252231 Rat 2303566 Bw90 Body weight QTL 90 2 body mass (VT:0001259) body weight (CMO:0000012) 16 1 39533930 Rat 8694453 Bw172 Body weight QTL 172 8.33 0.001 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 16 24325513 69325513 Rat 1298529 Arunc1 Aerobic running capacity QTL 1 4 exercise endurance trait (VT:0002332) maximum distance run on treadmill (CMO:0001406) 16 31951520 60148445 Rat 2312663 Slep9 Serum leptin concentration QTL 9 0.001 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 16 832236 59492508 Rat 2306902 Bp339 Blood pressure QTL 339 0.01 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 16 3380150 43025077 Rat 2312660 Bw95 Body weight QTL 95 0.05 inguinal fat pad mass (VT:0010424) inguinal fat pad weight to body weight ratio (CMO:0001253) 16 832236 59492508 Rat 2312666 Insul16 Insulin level QTL 16 0.01 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 16 832236 59492508 Rat 70205 Gcr3 Gastric cancer resistance QTL 3 2.3 stomach morphology trait (VT:0000470) stomach tumor diameter (CMO:0001889) 16 17696791 82635055 Rat 2293343 Glom16 Glomerulus QTL 16 7.4 kidney glomerulus integrity trait (VT:0010546) kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269) 16 832236 46053497 Rat 6903319 Bw114 Body weight QTL 114 2.7 0.0037 body mass (VT:0001259) body weight (CMO:0000012) 16 1 43534949 Rat 2312669 Stl23 Serum triglyceride level QTL 23 0.01 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 16 832236 59492508 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
10
49
113
91
90
59
25
59
6
217
96
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000014312 ⟹ ENSRNOP00000014312
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 16 36,641,284 - 36,754,160 (-) Ensembl Rnor_6.0 Ensembl 16 39,367,697 - 39,476,025 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000092968 ⟹ ENSRNOP00000075966
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 16 36,641,776 - 36,754,519 (-) Ensembl Rnor_6.0 Ensembl 16 39,368,185 - 39,476,384 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000092971 ⟹ ENSRNOP00000075962
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 16 36,641,284 - 36,973,475 (-) Ensembl Rnor_6.0 Ensembl 16 39,367,692 - 39,719,187 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000100181 ⟹ ENSRNOP00000095052
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 16 36,641,284 - 36,666,617 (-) Ensembl
RefSeq Acc Id:
NM_001394533 ⟹ NP_001381462
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 43,374,385 - 43,706,461 (-) NCBI mRatBN7.2 16 36,641,282 - 36,973,377 (-) NCBI
RefSeq Acc Id:
NM_001394534 ⟹ NP_001381463
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 43,374,385 - 43,487,812 (-) NCBI mRatBN7.2 16 36,641,282 - 36,754,710 (-) NCBI
RefSeq Acc Id:
NM_178105 ⟹ NP_835206
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 43,374,385 - 43,487,812 (-) NCBI mRatBN7.2 16 36,641,282 - 36,754,710 (-) NCBI Rnor_6.0 16 39,367,697 - 39,476,025 (-) NCBI Rnor_5.0 16 39,144,853 - 39,493,517 (-) NCBI RGSC_v3.4 16 39,670,748 - 39,783,384 (-) RGD Celera 16 34,795,943 - 34,908,788 (-) RGD
Sequence:
TTCTCCTGAAGAAAGGTAGCCATGGAAGAGAATATGGAAGAAGGACAGACACAAAAAGGGTGTTTTGAGTGCTGCATTAAATGCCTGGGAGGTATTCCCTATGCTTCTCTGATTGCTACCATCCTGCT
hide sequence
RefSeq Acc Id:
XM_039094504 ⟹ XP_038950432
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 43,374,385 - 43,602,384 (-) NCBI mRatBN7.2 16 36,641,282 - 36,869,402 (-) NCBI
RefSeq Acc Id:
XM_063275414 ⟹ XP_063131484
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 43,374,385 - 43,706,427 (-) NCBI
RefSeq Acc Id:
XM_063275415 ⟹ XP_063131485
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 43,374,385 - 43,401,416 (-) NCBI
RefSeq Acc Id:
NP_835206 ⟸ NM_178105
- Peptide Label:
isoform 1
- UniProtKB:
Q812E9 (UniProtKB/Swiss-Prot), A0A8I6APM4 (UniProtKB/TrEMBL)
- Sequence:
MEENMEEGQTQKGCFECCIKCLGGIPYASLIATILLYAGVALFCGCGHEALSGTVNILQTYFEMARTAGDTLDVFTMIDIFKYVIYGIAAAFFVYGILLMVEGFFTTGAIKDLYGDFKITTCGRCVSA
hide sequence
Ensembl Acc Id:
ENSRNOP00000075962 ⟸ ENSRNOT00000092971
Ensembl Acc Id:
ENSRNOP00000075966 ⟸ ENSRNOT00000092968
Ensembl Acc Id:
ENSRNOP00000014312 ⟸ ENSRNOT00000014312
RefSeq Acc Id:
XP_038950432 ⟸ XM_039094504
- Peptide Label:
isoform X2
- UniProtKB:
A0A1B0GWN8 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000095052 ⟸ ENSRNOT00000100181
RefSeq Acc Id:
NP_001381462 ⟸ NM_001394533
- Peptide Label:
isoform 2
- UniProtKB:
A6JPG6 (UniProtKB/TrEMBL), A0A8I6APM4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
NP_001381463 ⟸ NM_001394534
- Peptide Label:
isoform 3
- UniProtKB:
A0A1B0GWN8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063131484 ⟸ XM_063275414
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I6APM4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063131485 ⟸ XM_063275415
- Peptide Label:
isoform X2
- UniProtKB:
A0A1B0GWN8 (UniProtKB/TrEMBL)
RGD ID: 13700091 Promoter ID: EPDNEW_R10604 Type: initiation region Name: Gpm6a_1 Description: glycoprotein m6a SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 16 39,719,143 - 39,719,203 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2004-02-11
Gpm6a
glycoprotein m6a
Symbol and Name status set to approved
625702 APPROVED
Note Type
Note
Reference
gene_regulation
gated selectively by phosphorylation with PKC in the downstream of NGF signaling pathway
708586
