Symbol:
Tor1aip1
Name:
torsin 1A interacting protein 1
RGD ID:
628851
Description:
Enables lamin binding activity. Predicted to be involved in nuclear membrane organization; positive regulation of ATP-dependent activity; and protein localization to nucleus. Predicted to act upstream of or within protein localization to nuclear envelope. Located in nuclear envelope. Human ortholog(s) of this gene implicated in autosomal recessive limb-girdle muscular dystrophy type 2Y. Orthologous to human TOR1AIP1 (torsin 1A interacting protein 1); INTERACTS WITH 6-propyl-2-thiouracil; amitrole; ammonium chloride.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
lamina-associated polypeptide 1B; lamina-associated polypeptide 1C; Lap1b; Lap1c; MGC93149; torsin A interacting protein 1; torsin-1A-interacting protein 1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 13 70,746,941 - 70,776,382 (-) NCBI GRCr8 mRatBN7.2 13 68,196,681 - 68,226,121 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 13 68,196,681 - 68,225,862 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 13 70,776,432 - 70,805,603 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 13 72,097,134 - 72,126,168 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 13 69,358,610 - 69,387,653 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 13 73,670,649 - 73,704,668 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 13 73,670,141 - 73,704,678 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 13 78,593,998 - 78,629,999 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 13 71,042,848 - 71,072,766 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 13 71,057,068 - 71,086,822 (-) NCBI Celera 13 68,060,269 - 68,088,483 (-) NCBI Celera Cytogenetic Map 13 q22 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
1.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.
cDNA cloning and characterization of lamina-associated polypeptide 1C (LAP1C), an integral protein of the inner nuclear membrane.
Martin L, etal., J Biol Chem 1995 Apr 14;270(15):8822-8.
3.
Evolution of Na,K-ATPase beta m-subunit into a coregulator of transcription in placental mammals.
Pestov NB, etal., Proc Natl Acad Sci U S A. 2007 Jul 3;104(27):11215-20. Epub 2007 Jun 25.
4.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
5.
The nuclear envelope protein, LAP1B, is a novel protein phosphatase 1 substrate.
Santos M, etal., PLoS One. 2013 Oct 7;8(10):e76788. doi: 10.1371/journal.pone.0076788. eCollection 2013.
Tor1aip1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 13 70,746,941 - 70,776,382 (-) NCBI GRCr8 mRatBN7.2 13 68,196,681 - 68,226,121 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 13 68,196,681 - 68,225,862 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 13 70,776,432 - 70,805,603 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 13 72,097,134 - 72,126,168 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 13 69,358,610 - 69,387,653 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 13 73,670,649 - 73,704,668 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 13 73,670,141 - 73,704,678 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 13 78,593,998 - 78,629,999 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 13 71,042,848 - 71,072,766 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 13 71,057,068 - 71,086,822 (-) NCBI Celera 13 68,060,269 - 68,088,483 (-) NCBI Celera Cytogenetic Map 13 q22 NCBI
TOR1AIP1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 1 179,882,285 - 179,920,076 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 1 179,882,042 - 179,920,077 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 1 179,851,420 - 179,889,211 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 1 178,118,043 - 178,155,834 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 1 152,959,025 - 152,996,742 (+) NCBI Celera Cytogenetic Map 1 q25.2 NCBI HuRef 1 151,083,015 - 151,120,943 (+) NCBI HuRef CHM1_1 1 181,274,983 - 181,312,965 (+) NCBI CHM1_1 T2T-CHM13v2.0 1 179,238,027 - 179,275,744 (+) NCBI T2T-CHM13v2.0
Tor1aip1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 155,880,328 - 155,912,226 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 155,880,345 - 155,912,226 (-) Ensembl GRCm39 Ensembl GRCm38 1 156,004,599 - 156,036,480 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 156,004,599 - 156,036,480 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 157,851,729 - 157,883,610 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 157,768,999 - 157,798,513 (-) NCBI MGSCv36 mm8 Celera 1 158,442,340 - 158,474,394 (-) NCBI Celera Cytogenetic Map 1 G3 NCBI cM Map 1 67.69 NCBI
Tor1aip1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955406 19,122,926 - 19,151,522 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955406 19,122,906 - 19,152,458 (+) NCBI ChiLan1.0 ChiLan1.0
TOR1AIP1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 1 69,847,349 - 69,886,436 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 1 69,505,625 - 69,544,043 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 1 155,362,806 - 155,401,185 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 1 159,042,982 - 159,081,408 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 1 159,043,072 - 159,081,408 (+) Ensembl panpan1.1 panPan2
TOR1AIP1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 7 13,452,808 - 13,501,392 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 7 13,452,949 - 13,501,307 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 7 13,031,899 - 13,080,621 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 7 13,179,822 - 13,228,560 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 7 13,179,965 - 13,266,838 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 7 13,091,335 - 13,140,041 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 7 13,197,272 - 13,245,962 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 7 13,322,123 - 13,370,847 (+) NCBI UU_Cfam_GSD_1.0
Tor1aip1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024409344 91,387,630 - 91,415,014 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936481 9,232,588 - 9,262,563 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936481 9,234,379 - 9,261,961 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
TOR1AIP1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 9 121,515,570 - 121,566,796 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 9 121,515,691 - 121,566,799 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 9 133,362,871 - 133,391,167 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
TOR1AIP1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 25 49,454,642 - 49,492,903 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 25 49,452,289 - 49,491,525 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666055 50,849,688 - 50,887,405 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Tor1aip1
.
Assembly: mRatBN7.2 Assembly: Rnor_6.0
Predicted Target Of
Count of predictions: 113 Count of miRNA genes: 86 Interacting mature miRNAs: 92 Transcripts: ENSRNOT00000005280, ENSRNOT00000005296 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1298066 Bp159 Blood pressure QTL 159 0.004 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 46088046 91088046 Rat 10755495 Bp387 Blood pressure QTL 387 3.78 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 34663461 87525369 Rat 1354655 Bp241 Blood pressure QTL 241 3.9 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 56056920 101056920 Rat 70220 Bp55 Blood pressure QTL 55 5.75 arterial blood pressure trait (VT:2000000) blood pressure measurement (CMO:0000003) 13 37374509 82374509 Rat 71119 Thym2 Thymus enlargement QTL 2 3.8 thymus mass (VT:0004954) thymus weight to body weight ratio (CMO:0000612) 13 46197976 84753113 Rat 4889861 Pur29 Proteinuria QTL 29 13.8 0.005 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 13 37415584 80753406 Rat 12879441 Bp396 Blood pressure QTL 396 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 45699983 90699983 Rat 2293687 Bss26 Bone structure and strength QTL 26 4.6 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 13 65103704 106807694 Rat 619615 Bp80 Blood pressure QTL 80 0.0354 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 39754544 84754544 Rat 2303028 Bp329 Blood pressure QTL 329 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 58497872 73485113 Rat 1581570 Eae17 Experimental allergic encephalomyelitis QTL 17 4.1 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) 13 8897350 101631289 Rat 70170 Eae14 Experimental allergic encephalomyelitis QTL 14 0.0024 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) 13 23203448 68203448 Rat 61340 Bp25 Blood pressure QTL 25 4.2 0.004 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 34535218 79535218 Rat 1581573 Uae36 Urinary albumin excretion QTL 36 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 13 5994833 77046787 Rat 1549897 Stresp12 Stress response QTL 12 3.35 stress-related behavior trait (VT:0010451) number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960) 13 38433408 83433408 Rat 724564 Uae11 Urinary albumin excretion QTL 11 5.7 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 13 59492522 77046890 Rat 7207885 Glom27 Glomerulus QTL 27 3.9 kidney glomerulus integrity trait (VT:0010546) kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139) 13 20605871 101339738 Rat 7387280 Uae43 Urinary albumin excretion QTL 43 5.69 0.4174 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 13 66451204 106807694 Rat 738026 Lnnr5 Liver neoplastic nodule remodeling QTL 5 3.29 liver integrity trait (VT:0010547) liver remodeling tumorous lesion number (CMO:0001461) 13 59874408 85581182 Rat 1558644 Cm45 Cardiac mass QTL 45 3.6 0.002 heart mass (VT:0007028) heart wet weight (CMO:0000069) 13 23692969 68692969 Rat 70181 BpQTLcluster11 Blood pressure QTL cluster 11 6.922 arterial blood pressure trait (VT:2000000) absolute change in mean arterial blood pressure (CMO:0000533) 13 31241331 93395974 Rat 2293702 Bss34 Bone structure and strength QTL 34 4.61 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 13 65103704 106807694 Rat 61349 Bp31 Blood pressure QTL 31 5.75 arterial blood pressure trait (VT:2000000) blood pressure measurement (CMO:0000003) 13 37374509 82374509 Rat 2303563 Bw89 Body weight QTL 89 6 body mass (VT:0001259) body weight (CMO:0000012) 13 32284471 77284471 Rat 1354621 Rf47 Renal function QTL 47 3.7 kidney renin amount (VT:0010559) kidney renin level (CMO:0002166) 13 30395351 101056920 Rat 1581554 Pur11 Proteinuria QTL 11 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 13 5994833 77046787 Rat 12879477 Bp401 Blood pressure QTL 401 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 37262092 82262092 Rat 1331750 Bp220 Blood pressure QTL 220 2.98 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 13 37415584 82415584 Rat 6893338 Cm76 Cardiac mass QTL 76 0 0.99 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 13 23692969 68692969 Rat 1641901 Alcrsp6 Alcohol response QTL 6 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 13 52362171 97362171 Rat 12879475 Bp400 Blood pressure QTL 400 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 61825626 106807694 Rat 1354666 Bp244 Blood pressure QTL 244 4.9 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 1 101056920 Rat
RH129301
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 13 68,196,722 - 68,196,916 (+) MAPPER mRatBN7.2 Rnor_6.0 13 73,670,691 - 73,670,884 NCBI Rnor6.0 Rnor_5.0 13 78,595,740 - 78,595,933 UniSTS Rnor5.0 RGSC_v3.4 13 71,042,890 - 71,043,083 UniSTS RGSC3.4 Celera 13 68,060,311 - 68,060,504 UniSTS RH 3.4 Map 8 1192.4 UniSTS Cytogenetic Map 13 q21 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000005280 ⟹ ENSRNOP00000005280
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 13 68,196,681 - 68,225,862 (-) Ensembl Rnor_6.0 Ensembl 13 73,670,141 - 73,704,678 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000005296 ⟹ ENSRNOP00000005296
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 13 68,197,444 - 68,225,862 (-) Ensembl Rnor_6.0 Ensembl 13 73,671,412 - 73,704,480 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000098741 ⟹ ENSRNOP00000085745
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 13 68,196,681 - 68,225,862 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000107683 ⟹ ENSRNOP00000087328
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 13 68,196,681 - 68,225,862 (-) Ensembl
RefSeq Acc Id:
NM_145092 ⟹ NP_659560
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 13 70,746,941 - 70,776,123 (-) NCBI mRatBN7.2 13 68,196,681 - 68,225,862 (-) NCBI Rnor_6.0 13 73,670,649 - 73,704,668 (-) NCBI Rnor_5.0 13 78,593,998 - 78,629,999 (-) NCBI RGSC_v3.4 13 71,042,848 - 71,072,766 (-) RGD Celera 13 68,060,269 - 68,088,483 (-) RGD
Sequence:
AAAACACACCATGGGCCCAGAGGCTGGTTTGTGGCACACTAGCGAGGACGCAGGAGGTGGCGCCGGCAACTCTCAACTGCCTCCCTGACCACTGTGACAACCTCCTCGAAGCCATCGCCACCACCTGC
hide sequence
RefSeq Acc Id:
XM_006250027 ⟹ XP_006250089
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 13 70,746,946 - 70,774,560 (-) NCBI mRatBN7.2 13 68,197,301 - 68,224,299 (-) NCBI Rnor_6.0 13 73,670,650 - 73,703,162 (-) NCBI Rnor_5.0 13 78,593,998 - 78,629,999 (-) NCBI
Sequence:
ATTATGAGGTAAAATTCTGAGGTTTAGACTCACAATGGGATGTCCTTGGTAATAATGGTAGACA
hide sequence
RefSeq Acc Id:
XM_006250028 ⟹ XP_006250090
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 13 70,746,946 - 70,775,002 (-) NCBI mRatBN7.2 13 68,197,301 - 68,224,977 (-) NCBI Rnor_6.0 13 73,670,650 - 73,703,973 (-) NCBI Rnor_5.0 13 78,593,998 - 78,629,999 (-) NCBI
Sequence:
GGGAGCGCGCGCGGTGGCGGGCACGGGCGCACGCGGCGTGAGGCGCGCCCCTGTGGAGTCCGGC
hide sequence
RefSeq Acc Id:
XM_039090334 ⟹ XP_038946262
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 13 70,746,946 - 70,776,382 (-) NCBI mRatBN7.2 13 68,197,317 - 68,226,121 (-) NCBI
RefSeq Acc Id:
NP_659560 ⟸ NM_145092
- UniProtKB:
Q62741 (UniProtKB/Swiss-Prot), Q62754 (UniProtKB/Swiss-Prot), Q5PQX1 (UniProtKB/Swiss-Prot), A6ICZ9 (UniProtKB/TrEMBL), A0A8I6AGC6 (UniProtKB/TrEMBL)
- Sequence:
MAGERWRAEGLGEGWAIYVTPRAPIREGRRRLATQNGDGSDAPAYETHPSRHGRREVRFSEEPPEVYGDFEPRAAKERSPGERRTPPEKFRSDSAKEEVRESAYNLRSRQRRQRGPQEAEEMKTRRST
hide sequence
RefSeq Acc Id:
XP_006250090 ⟸ XM_006250028
- Peptide Label:
isoform X2
- Sequence:
MSEDPISNLCRPPLRSPRPDASIVQHINPFEEGETEDDLESSYSDVTIRIRSRDSVESRDEAAVAAGHHPDSLWGLPHSRGDFTAHENQPSLLPTGCQKNPQEWVEQAVRMRTRMAYNNIQKSDFGNQ
hide sequence
RefSeq Acc Id:
XP_006250089 ⟸ XM_006250027
- Peptide Label:
isoform X2
- Sequence:
MSEDPISNLCRPPLRSPRPDASIVQHINPFEEGETEDDLESSYSDVTIRIRSRDSVESRDEAAV
hide sequence
Ensembl Acc Id:
ENSRNOP00000005296 ⟸ ENSRNOT00000005296
Ensembl Acc Id:
ENSRNOP00000005280 ⟸ ENSRNOT00000005280
RefSeq Acc Id:
XP_038946262 ⟸ XM_039090334
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I6A2B4 (UniProtKB/TrEMBL), A0A8I6AGC6 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000087328 ⟸ ENSRNOT00000107683
Ensembl Acc Id:
ENSRNOP00000085745 ⟸ ENSRNOT00000098741
RGD ID: 13698912 Promoter ID: EPDNEW_R9437 Type: initiation region Name: Tor1aip1_1 Description: torsin 1A interacting protein 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 13 73,704,689 - 73,704,749 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-02-03
Tor1aip1
torsin 1A interacting protein 1
Tor1aip1
torsin A interacting protein 1
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2006-03-30
Tor1aip1
torsin A interacting protein 1
Lap1b
lamina-associated polypeptide 1B
Symbol and Name updated
1299863 APPROVED
2005-01-20
Lap1b
lamina-associated polypeptide 1B
Lap1c
lamina-associated polypeptide 1C
Symbol and Name updated
1299863 APPROVED
2003-02-27
Lap1c
lamina-associated polypeptide 1C
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_cellular_localization
localized to the inner nuclear membrane
633106
gene_protein
506-amino acid protein
633106
