Advanced Search (OLGA)

Gene: Pkig (cAMP-dependent protein kinase inhibitor gamma) Rattus norvegicus

Subscribe to Updates

Analyze

Symbol:

Pkig

Name:

cAMP-dependent protein kinase inhibitor gamma

RGD ID:

628775

Description:

Enables cAMP-dependent protein kinase inhibitor activity. Predicted to act upstream of or within negative regulation of protein import into nucleus; negative regulation of protein kinase activity; and negative regulation of transcription by RNA polymerase II. Predicted to be active in cytoplasm and nucleus. Orthologous to human PKIG (cAMP-dependent protein kinase inhibitor gamma); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; bisphenol A; dibutyl phthalate.

Type:

protein-coding

RefSeq Status:

VALIDATED

Previously known as:

MGC108574; protein kinase (cAMP-dependent, catalytic) inhibitor gamma; protein kinase inhibitor, gamma

RGD Orthologs

Alliance Orthologs

More Info

more info ...

Latest Assembly:

GRCr8 - GRCr8 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	3	172,749,871 - 172,817,514 (+)	NCBI		GRCr8
mRatBN7.2	3	152,330,477 - 152,398,085 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	3	152,366,041 - 152,398,082 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	3	156,137,960 - 156,205,545 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	3	164,636,891 - 164,704,478 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	3	162,380,926 - 162,448,601 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	3	160,047,257 - 160,115,180 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	3	160,047,296 - 160,115,177 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	3	166,238,121 - 166,305,341 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	3	154,568,485 - 154,635,867 (+)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
RGSC_v3.1	3	154,474,520 - 154,541,903 (+)	NCBI
Celera	3	150,983,346 - 151,050,377 (+)	NCBI		Celera
Cytogenetic Map	3	q42	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Pkig	Rat	adenosine deaminase deficiency		ISO	PKIG (Homo sapiens)	8554872	ClinVar Annotator: match by term: Severe combined immunodeficiency more ...	ClinVar	PMID:26255240 more ...
Pkig	Rat	focal epilepsy		ISO	PKIG (Homo sapiens)	8554872	ClinVar Annotator: match by term: Focal-onset seizure	ClinVar	PMID:32581362
Pkig	Rat	T-Cell Immunodeficiency, Recurrent Infections, and Autoimmunity with or without Cardiac Malformations		ISO	PKIG (Homo sapiens)	8554872	ClinVar Annotator: match by term: T-cell immunodeficiency more ...	ClinVar	PMID:22174160 and PMID:28492532

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Pkig	Rat	(-)-demecolcine	increases expression	ISO	PKIG (Homo sapiens)	6480464	Demecolcine results in increased expression of PKIG mRNA	CTD	PMID:23649840
Pkig	Rat	1,2-dimethylhydrazine	decreases expression	ISO	Pkig (Mus musculus)	6480464	1 and 2-Dimethylhydrazine results in decreased expression of PKIG mRNA	CTD	PMID:22206623
Pkig	Rat	17alpha-ethynylestradiol	multiple interactions	ISO	Pkig (Mus musculus)	6480464	[Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PKIG mRNA	CTD	PMID:17942748
Pkig	Rat	17beta-estradiol	affects expression	ISO	PKIG (Homo sapiens)	6480464	Estradiol affects the expression of PKIG mRNA	CTD	PMID:22574217
Pkig	Rat	2,3',4,4',5-Pentachlorobiphenyl	increases expression	ISO	Pkig (Mus musculus)	6480464	2 more ...	CTD	PMID:31388691
Pkig	Rat	2,3,7,8-tetrachlorodibenzodioxine	multiple interactions	ISO	Pkig (Mus musculus)	6480464	[Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PKIG mRNA and Tetrachlorodibenzodioxin inhibits the reaction [EGF protein results in increased expression of PKIG mRNA]	CTD	PMID:15667827 and PMID:17942748
Pkig	Rat	2,3,7,8-tetrachlorodibenzodioxine	affects expression	EXP		6480464	Tetrachlorodibenzodioxin affects the expression of PKIG mRNA	CTD	PMID:34747641
Pkig	Rat	2,3,7,8-tetrachlorodibenzodioxine	affects expression	ISO	Pkig (Mus musculus)	6480464	Tetrachlorodibenzodioxin affects the expression of PKIG mRNA	CTD	PMID:20702594 and PMID:21570461
Pkig	Rat	2,3,7,8-tetrachlorodibenzodioxine	increases expression	ISO	Pkig (Mus musculus)	6480464	Tetrachlorodibenzodioxin results in increased expression of PKIG mRNA	CTD	PMID:19465110
Pkig	Rat	2,3,7,8-Tetrachlorodibenzofuran	affects expression	ISO	Pkig (Mus musculus)	6480464	2 more ...	CTD	PMID:20702594
Pkig	Rat	5-aza-2'-deoxycytidine	affects expression	ISO	PKIG (Homo sapiens)	6480464	Decitabine affects the expression of PKIG mRNA	CTD	PMID:23300844
Pkig	Rat	aflatoxin B1	affects expression	ISO	PKIG (Homo sapiens)	6480464	Aflatoxin B1 affects the expression of PKIG protein	CTD	PMID:20106945
Pkig	Rat	aflatoxin B1	decreases expression	ISO	PKIG (Homo sapiens)	6480464	Aflatoxin B1 results in decreased expression of PKIG mRNA	CTD	PMID:22100608
Pkig	Rat	all-trans-retinoic acid	decreases expression	ISO	PKIG (Homo sapiens)	6480464	Tretinoin results in decreased expression of PKIG mRNA	CTD	PMID:33167477
Pkig	Rat	antirheumatic drug	increases expression	ISO	PKIG (Homo sapiens)	6480464	Antirheumatic Agents results in increased expression of PKIG mRNA	CTD	PMID:24449571
Pkig	Rat	arsane	multiple interactions	ISO	PKIG (Homo sapiens)	6480464	[[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PKIG mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of PKIG mRNA	CTD	PMID:39836092
Pkig	Rat	arsenic atom	multiple interactions	ISO	PKIG (Homo sapiens)	6480464	[[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PKIG mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of PKIG mRNA	CTD	PMID:39836092
Pkig	Rat	arsenite(3-)	multiple interactions	ISO	PKIG (Homo sapiens)	6480464	arsenite promotes the reaction [G3BP1 protein binds to PKIG mRNA]	CTD	PMID:32406909
Pkig	Rat	benzene	decreases expression	ISO	PKIG (Homo sapiens)	6480464	Benzene results in decreased expression of PKIG mRNA	CTD	PMID:15929907
Pkig	Rat	benzo[a]pyrene	increases expression	ISO	Pkig (Mus musculus)	6480464	Benzo(a)pyrene results in increased expression of PKIG mRNA	CTD	PMID:22228805
Pkig	Rat	benzo[a]pyrene	decreases expression	ISO	PKIG (Homo sapiens)	6480464	Benzo(a)pyrene results in decreased expression of PKIG mRNA	CTD	PMID:32234424
Pkig	Rat	benzo[a]pyrene	increases methylation	ISO	PKIG (Homo sapiens)	6480464	Benzo(a)pyrene results in increased methylation of PKIG promoter	CTD	PMID:27901495
Pkig	Rat	benzo[a]pyrene	affects methylation	ISO	PKIG (Homo sapiens)	6480464	Benzo(a)pyrene affects the methylation of PKIG 5' UTR	CTD	PMID:27901495
Pkig	Rat	benzo[a]pyrene	multiple interactions	ISO	Pkig (Mus musculus)	6480464	[Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of PKIG mRNA	CTD	PMID:27858113
Pkig	Rat	benzo[b]fluoranthene	increases expression	ISO	Pkig (Mus musculus)	6480464	benzo(b)fluoranthene results in increased expression of PKIG mRNA	CTD	PMID:26377693
Pkig	Rat	benzo[b]fluoranthene	multiple interactions	ISO	Pkig (Mus musculus)	6480464	[Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of PKIG mRNA	CTD	PMID:27858113
Pkig	Rat	benzo[e]pyrene	decreases methylation	ISO	PKIG (Homo sapiens)	6480464	benzo(e)pyrene results in decreased methylation of PKIG intron	CTD	PMID:30157460
Pkig	Rat	beta-lapachone	increases expression	ISO	PKIG (Homo sapiens)	6480464	beta-lapachone results in increased expression of PKIG mRNA	CTD	PMID:38218311
Pkig	Rat	bisphenol A	increases expression	EXP		6480464	bisphenol A results in increased expression of PKIG mRNA	CTD	PMID:25181051 and PMID:32145629
Pkig	Rat	bisphenol A	decreases expression	ISO	Pkig (Mus musculus)	6480464	bisphenol A results in decreased expression of PKIG mRNA	CTD	PMID:35598803
Pkig	Rat	carbon nanotube	increases expression	ISO	Pkig (Mus musculus)	6480464	Nanotubes and Carbon analog results in increased expression of PKIG mRNA	CTD	PMID:25554681
Pkig	Rat	choline	multiple interactions	ISO	Pkig (Mus musculus)	6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of PKIG gene	CTD	PMID:20938992
Pkig	Rat	chrysene	multiple interactions	ISO	Pkig (Mus musculus)	6480464	[Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of PKIG mRNA	CTD	PMID:27858113
Pkig	Rat	cisplatin	affects expression	ISO	PKIG (Homo sapiens)	6480464	Cisplatin affects the expression of PKIG mRNA	CTD	PMID:23300844
Pkig	Rat	cisplatin	decreases expression	ISO	PKIG (Homo sapiens)	6480464	Cisplatin results in decreased expression of PKIG mRNA	CTD	PMID:27392435
Pkig	Rat	copper(II) sulfate	decreases expression	ISO	PKIG (Homo sapiens)	6480464	Copper Sulfate results in decreased expression of PKIG mRNA	CTD	PMID:19549813
Pkig	Rat	cyclosporin A	decreases expression	ISO	PKIG (Homo sapiens)	6480464	Cyclosporine results in decreased expression of PKIG mRNA	CTD	PMID:25562108
Pkig	Rat	dibenz[a,h]anthracene	increases expression	ISO	Pkig (Mus musculus)	6480464	1 more ...	CTD	PMID:26377693
Pkig	Rat	dibutyl phthalate	increases expression	EXP		6480464	Dibutyl Phthalate results in increased expression of PKIG mRNA	CTD	PMID:21266533
Pkig	Rat	doxorubicin	decreases expression	ISO	PKIG (Homo sapiens)	6480464	Doxorubicin results in decreased expression of PKIG mRNA	CTD	PMID:29803840
Pkig	Rat	epoxiconazole	decreases expression	ISO	Pkig (Mus musculus)	6480464	epoxiconazole results in decreased expression of PKIG mRNA	CTD	PMID:35436446
Pkig	Rat	folic acid	multiple interactions	ISO	Pkig (Mus musculus)	6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of PKIG gene	CTD	PMID:20938992
Pkig	Rat	formaldehyde	increases expression	ISO	PKIG (Homo sapiens)	6480464	Formaldehyde results in increased expression of PKIG mRNA	CTD	PMID:23649840
Pkig	Rat	isoflurane	decreases methylation	ISO	Pkig (Mus musculus)	6480464	Isoflurane results in decreased methylation of PKIG mRNA	CTD	PMID:35249202
Pkig	Rat	L-methionine	multiple interactions	ISO	Pkig (Mus musculus)	6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of PKIG gene	CTD	PMID:20938992
Pkig	Rat	lipopolysaccharide	increases expression	ISO	PKIG (Homo sapiens)	6480464	Lipopolysaccharides results in increased expression of PKIG mRNA	CTD	PMID:35811015
Pkig	Rat	lipopolysaccharide	multiple interactions	ISO	PKIG (Homo sapiens)	6480464	[S-(1 and 2-dichlorovinyl)cysteine affects the susceptibility to Lipopolysaccharides] which results in increased expression of PKIG mRNA	CTD	PMID:35811015
Pkig	Rat	manganese atom	multiple interactions	ISO	PKIG (Homo sapiens)	6480464	[[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PKIG mRNA	CTD	PMID:39836092
Pkig	Rat	manganese(0)	multiple interactions	ISO	PKIG (Homo sapiens)	6480464	[[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PKIG mRNA	CTD	PMID:39836092
Pkig	Rat	manganese(II) chloride	multiple interactions	ISO	PKIG (Homo sapiens)	6480464	[[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PKIG mRNA	CTD	PMID:39836092
Pkig	Rat	methapyrilene	decreases methylation	ISO	PKIG (Homo sapiens)	6480464	Methapyrilene results in decreased methylation of PKIG intron	CTD	PMID:30157460
Pkig	Rat	N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal	decreases expression	ISO	Pkig (Mus musculus)	6480464	benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in decreased expression of PKIG mRNA	CTD	PMID:25566086
Pkig	Rat	O-methyleugenol	decreases expression	ISO	PKIG (Homo sapiens)	6480464	methyleugenol results in decreased expression of PKIG mRNA	CTD	PMID:32234424
Pkig	Rat	oxaliplatin	decreases expression	ISO	PKIG (Homo sapiens)	6480464	oxaliplatin results in decreased expression of PKIG mRNA	CTD	PMID:17762391
Pkig	Rat	paracetamol	affects expression	ISO	Pkig (Mus musculus)	6480464	Acetaminophen affects the expression of PKIG mRNA	CTD	PMID:17562736
Pkig	Rat	paracetamol	affects response to substance	ISO	PKIG (Homo sapiens)	6480464	PKIG gene polymorphism affects the susceptibility to Acetaminophen	CTD	PMID:26104854
Pkig	Rat	PCB138	decreases expression	EXP		6480464	2 more ...	CTD	PMID:23829299
Pkig	Rat	pyrogallol	decreases expression	ISO	Pkig (Mus musculus)	6480464	Pyrogallol results in decreased expression of PKIG mRNA	CTD	PMID:20362636
Pkig	Rat	pyrogallol	multiple interactions	ISO	Pkig (Mus musculus)	6480464	Silymarin inhibits the reaction [Pyrogallol results in decreased expression of PKIG mRNA]	CTD	PMID:20362636
Pkig	Rat	S-(1,2-dichlorovinyl)-L-cysteine	multiple interactions	ISO	PKIG (Homo sapiens)	6480464	[S-(1 and 2-dichlorovinyl)cysteine affects the susceptibility to Lipopolysaccharides] which results in increased expression of PKIG mRNA	CTD	PMID:35811015
Pkig	Rat	silicon dioxide	decreases expression	ISO	PKIG (Homo sapiens)	6480464	Silicon Dioxide results in decreased expression of PKIG mRNA	CTD	PMID:25351596
Pkig	Rat	sodium arsenite	multiple interactions	ISO	PKIG (Homo sapiens)	6480464	[[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of PKIG mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of PKIG mRNA	CTD	PMID:39836092
Pkig	Rat	sulforaphane	decreases expression	ISO	PKIG (Homo sapiens)	6480464	sulforaphane results in decreased expression of PKIG mRNA	CTD	PMID:31838189
Pkig	Rat	sunitinib	decreases expression	ISO	PKIG (Homo sapiens)	6480464	Sunitinib results in decreased expression of PKIG mRNA	CTD	PMID:31533062
Pkig	Rat	T-2 toxin	affects expression	EXP		6480464	T-2 Toxin affects the expression of PKIG protein	CTD	PMID:26141394
Pkig	Rat	tetrachloromethane	increases expression	ISO	Pkig (Mus musculus)	6480464	Carbon Tetrachloride results in increased expression of PKIG mRNA	CTD	PMID:31919559
Pkig	Rat	tetraphene	multiple interactions	ISO	Pkig (Mus musculus)	6480464	[Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of PKIG mRNA	CTD	PMID:27858113
Pkig	Rat	titanium dioxide	decreases methylation	ISO	Pkig (Mus musculus)	6480464	titanium dioxide results in decreased methylation of PKIG gene	CTD	PMID:35295148
Pkig	Rat	triphenyl phosphate	affects expression	ISO	PKIG (Homo sapiens)	6480464	triphenyl phosphate affects the expression of PKIG mRNA	CTD	PMID:37042841
Pkig	Rat	valproic acid	increases expression	ISO	PKIG (Homo sapiens)	6480464	Valproic Acid results in increased expression of PKIG mRNA	CTD	PMID:28001369 and PMID:29154799
Pkig	Rat	vincristine	increases expression	ISO	PKIG (Homo sapiens)	6480464	Vincristine results in increased expression of PKIG mRNA	CTD	PMID:23649840

Biological Process

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Pkig	Rat	negative regulation of protein import into nucleus	acts_upstream_of_or_within	ISO	Pkig (Mus musculus)	1624291	PMID:9218452	RGD	PMID:9218452
Pkig	Rat	negative regulation of protein kinase activity	acts_upstream_of_or_within	ISO	Pkig (Mus musculus)	1624291	PMID:9218452	RGD	PMID:9218452
Pkig	Rat	negative regulation of transcription by RNA polymerase II	acts_upstream_of_or_within	ISO	Pkig (Mus musculus)	1624291	PMID:9218452	RGD	PMID:9218452

Cellular Component

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Pkig	Rat	cytoplasm	is_active_in	IBA	MGI:104747 and PANTHER:PTN000395870	1600115	GO_REF:0000033	GO_Central	GO_REF:0000033
Pkig	Rat	nucleus	is_active_in	IBA	MGI:104747 and PANTHER:PTN000395870	1600115	GO_REF:0000033	GO_Central	GO_REF:0000033

Molecular Function

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Pkig	Rat	cAMP-dependent protein kinase inhibitor activity		IMP		1359036		RGD
Pkig	Rat	cAMP-dependent protein kinase inhibitor activity	enables	IEA	InterPro:IPR004171	1600115	GO_REF:0000002	InterPro	GO_REF:0000002
Pkig	Rat	cAMP-dependent protein kinase inhibitor activity	enables	ISO	Pkig (Mus musculus)	1624291	PMID:9218452	RGD	PMID:9218452
Pkig	Rat	cAMP-dependent protein kinase inhibitor activity	enables	IBA	MGI:101937 more ...	1600115	GO_REF:0000033	GO_Central	GO_REF:0000033
Pkig	Rat	protein binding	enables	ISO	PKIG (Homo sapiens)	1624291	UniProtKB:P50222 more ...	RGD	PMID:25416956 and PMID:32296183
Pkig	Rat	protein kinase inhibitor activity	enables	IEA	UniProtKB-KW:KW-0649	1600115	GO_REF:0000043	UniProt	GO_REF:0000043

#	Reference Title	Reference Citation
1.	Endogenous protein kinase inhibitor gamma terminates immediate-early gene expression induced by cAMP-dependent protein kinase (PKA) signaling: termination depends on PKA inactivation rather than PKA export from the nucleus.	Chen X, etal., J Biol Chem 2005 Jan 28;280(4):2700-7. Epub 2004 Nov 19.
2.	Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.	Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
3.	GOA pipeline	RGD automated data pipeline
4.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

PMID:9218452	PMID:12477932

Pkig
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	3	172,749,871 - 172,817,514 (+)	NCBI		GRCr8
mRatBN7.2	3	152,330,477 - 152,398,085 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	3	152,366,041 - 152,398,082 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	3	156,137,960 - 156,205,545 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	3	164,636,891 - 164,704,478 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	3	162,380,926 - 162,448,601 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	3	160,047,257 - 160,115,180 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	3	160,047,296 - 160,115,177 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	3	166,238,121 - 166,305,341 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	3	154,568,485 - 154,635,867 (+)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
RGSC_v3.1	3	154,474,520 - 154,541,903 (+)	NCBI
Celera	3	150,983,346 - 151,050,377 (+)	NCBI		Celera
Cytogenetic Map	3	q42	NCBI

PKIG
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	20	44,531,875 - 44,619,037 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	20	44,531,785 - 44,624,247 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	20	43,160,516 - 43,247,678 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	20	42,593,850 - 42,681,092 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Build 34	20	42,593,849 - 42,681,091	NCBI
Celera	20	39,869,083 - 39,956,320 (+)	NCBI		Celera
Cytogenetic Map	20	q13.12	NCBI
HuRef	20	39,901,964 - 39,989,219 (+)	NCBI		HuRef
CHM1_1	20	43,063,548 - 43,150,794 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	20	46,267,641 - 46,354,809 (+)	NCBI		T2T-CHM13v2.0

Pkig
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	2	163,500,306 - 163,568,078 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	2	163,500,306 - 163,568,078 (+)	Ensembl		GRCm39 Ensembl
GRCm38	2	163,658,211 - 163,726,158 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	2	163,658,386 - 163,726,158 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	2	163,484,122 - 163,551,894 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	2	163,349,892 - 163,417,599 (+)	NCBI		MGSCv36	mm8
Celera	2	169,601,971 - 169,669,883 (+)	NCBI		Celera
Cytogenetic Map	2	H3	NCBI
cM Map	2	84.4	NCBI

Pkig
(Chinchilla lanigera - long-tailed chinchilla)

Chinchilla Assembly	Chr	Position (strand)	Source	Genome Browsers
Chinchilla Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChiLan1.0 Ensembl	NW_004955445	12,717,962 - 12,818,734 (-)	Ensembl	ChiLan1.0
ChiLan1.0	NW_004955445	12,717,962 - 12,818,734 (-)	NCBI	ChiLan1.0	ChiLan1.0

PKIG
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	21	50,264,249 - 50,352,262 (+)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	20	50,257,358 - 50,345,365 (+)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	20	40,861,694 - 40,949,756 (+)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	20	41,955,938 - 42,044,131 (+)	NCBI	panpan1.1	PanPan1.1	panPan2
PanPan1.1 Ensembl	20	42,039,676 - 42,049,064 (+)	Ensembl	panpan1.1		panPan2

PKIG
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	24	31,983,131 - 32,083,307 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	24	32,050,242 - 32,082,919 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	24	31,624,520 - 31,724,671 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	24	32,689,751 - 32,790,237 (+)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	24	32,696,491 - 32,790,234 (+)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	24	31,952,297 - 32,051,932 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	24	32,066,281 - 32,166,638 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	24	32,607,496 - 32,707,896 (+)	NCBI		UU_Cfam_GSD_1.0

Pkig
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)

Squirrel Assembly	Chr	Position (strand)	Source	Genome Browsers
Squirrel Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HiC_Itri_2	NW_024408640	180,979,965 - 181,081,729 (+)	NCBI		HiC_Itri_2
SpeTri2.0 Ensembl	NW_004936530	2,224,496 - 2,262,653 (-)	Ensembl	SpeTri2.0	SpeTri2.0 Ensembl
SpeTri2.0	NW_004936530	2,224,492 - 2,326,287 (-)	NCBI	SpeTri2.0	SpeTri2.0		SpeTri2.0

PKIG
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	17	47,008,035 - 47,044,049 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	17	46,933,418 - 47,044,044 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	17	52,419,567 - 52,501,664 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

PKIG
(Chlorocebus sabaeus - green monkey)

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	2	19,200,718 - 19,289,649 (-)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
ChlSab1.1 Ensembl	2	19,201,221 - 19,237,497 (-)	Ensembl	ChlSab1.1	ChlSab1.1 Ensembl	chlSab2
Vero_WHO_p1.0	NW_023666050	67,869,101 - 67,958,344 (-)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

Pkig
(Heterocephalus glaber - naked mole-rat)

Naked Mole-Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Naked Mole-Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HetGla_female_1.0 Ensembl	NW_004624790	9,829,686 - 9,871,564 (-)	Ensembl	HetGla_female_1.0	HetGla_female_1.0 Ensembl	hetGla2
HetGla 1.0	NW_004624790	9,829,686 - 9,936,336 (-)	NCBI	HetGla_female_1.0	HetGla 1.0	hetGla2

Variants in Pkig
254 total Variants

Predicted Target Of

	Summary Value
Count of predictions:	362
Count of miRNA genes:	191
Interacting mature miRNAs:	220
Transcripts:	ENSRNOT00000051590
Prediction methods:	Microtar, Miranda, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
12879876	Bw182	Body weight QTL 182		0.003	body mass (VT:0001259)	body weight (CMO:0000012)	3	145925360	166177555	Rat
2301411	Bp320	Blood pressure QTL 320		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	3	145925360	166177555	Rat
2312673	Scl63	Serum cholesterol level QTL 63		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	3	98535255	168026850	Rat
1300113	Bp176	Blood pressure QTL 176	3.9		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	3	145956084	157309487	Rat
12879872	Cm97	Cardiac mass QTL 97		0.001	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	3	145925360	166177555	Rat
1598877	Bp285	Blood pressure QTL 285	1.5	0.03	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	3	120538241	165538241	Rat
1578653	Vnigr3	Vascular neointimal growth QTL 3	3.1		artery morphology trait (VT:0002191)	artery neointimal hyperplastic lesion area (CMO:0001414)	3	130656562	169034231	Rat
12879873	Cm96	Cardiac mass QTL 96		0.001	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	3	145925360	166177555	Rat
2302373	Gluco39	Glucose level QTL 39	5.01		blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	3	98535386	161695835	Rat
12879874	Cm98	Cardiac mass QTL 98		0.005	heart right ventricle mass (VT:0007033)	heart right ventricle weight to body weight ratio (CMO:0000914)	3	145925360	166177555	Rat
1298068	Bp167	Blood pressure QTL 167		0.004	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	3	141074471	169034231	Rat
12879875	Kidm64	Kidney mass QTL 64		0.001	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	3	145925360	166177555	Rat
70216	Cm14	Cardiac mass QTL 14	2.1		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	3	31172320	163586636	Rat
2298477	Eau4	Experimental allergic uveoretinitis QTL 4		0.0011	uvea integrity trait (VT:0010551)	experimental autoimmune uveitis score (CMO:0001504)	3	137398739	169034231	Rat
8552791	Vie2	Viral induced encephalitis QTL 2	4.1		brain integrity trait (VT:0010579)	encephalitis incidence/prevalence measurement (CMO:0002361)	3	145956084	169034231	Rat
61335	Bp20	Blood pressure QTL 20	3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	3	141339236	155617360	Rat
1581568	Rf53	Renal function QTL 53			urine total protein amount (VT:0000032)	urine protein excretion rate to body weight ratio (CMO:0001099)	3	56395968	161299569	Rat
2317883	Alcrsp26	Alcohol response QTL 26	1.8	0.63	response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	3	145526770	169034231	Rat
1578754	Stresp16	Stress response QTL 16	4	0.001	blood renin amount (VT:0003349)	plasma renin activity level (CMO:0000116)	3	112681431	157681431	Rat
1331726	Bp208	Blood pressure QTL 208	3.129		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	3	141339013	162184794	Rat
1598854	Memor10	Memory QTL 10	2		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	3	145956084	161299569	Rat
9589106	Insul23	Insulin level QTL 23	13.86	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	3	131635904	169034231	Rat
10755461	Coatc16	Coat color QTL 16			coat/hair pigmentation trait (VT:0010463)	pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)	3	122438700	167438700	Rat
8662816	Vetf4	Vascular elastic tissue fragility QTL 4	4		renal artery integrity trait (VT:0010642)	number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)	3	59242096	157323038	Rat
1559282	Emca5	Estrogen-induced mammary cancer QTL 5	3.9		mammary gland integrity trait (VT:0010552)	percentage of study population developing mammary tumors during a period of time (CMO:0000948)	3	43827364	169034231	Rat
2303620	Vencon4	Ventilatory control QTL 4	3.9		respiration trait (VT:0001943)	tidal volume (CMO:0000222)	3	127162703	168026850	Rat
631841	Niddm39	Non-insulin dependent diabetes mellitus QTL 39	3.36		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	3	94856903	159898684	Rat
1576306	Schws3	Schwannoma susceptibility QTL 3		0.001	nervous system integrity trait (VT:0010566)	percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)	3	118839124	163839124	Rat
619618	Rf3	Renal disease susceptibility QTL 3	6.5	0.001	urine albumin amount (VT:0002871)	urine albumin excretion rate to body weight ratio (CMO:0001270)	3	107693393	152693393	Rat
1300159	Kidm4	Kidney mass QTL 4	3.83		kidney mass (VT:0002707)	right kidney wet weight to body weight ratio (CMO:0001953)	3	121056165	157309487	Rat
2301971	Cm71	Cardiac mass QTL 71	4.63		heart left ventricle mass (VT:0007031)	heart left ventricle weight (CMO:0000776)	3	41874578	155617519	Rat
2312659	Slep7	Serum leptin concentration QTL 7		0.001	blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	3	98535255	168026850	Rat
631673	Iddm13	Insulin dependent diabetes mellitus QTL 13	1.3	0.663	blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	3	130193298	161695983	Rat
2301970	Bw81	Body weight QTL 81	5.19		body mass (VT:0001259)	body weight (CMO:0000012)	3	41874578	155617519	Rat
1578666	Vnigr1	Vascular neointimal growth QTL 1	4.6		artery morphology trait (VT:0002191)	artery lumen area (CMO:0001409)	3	149040888	168026850	Rat
1578656	Vnigr2	Vascular neointimal growth QTL 2	4.2		artery morphology trait (VT:0002191)	lesioned artery residual lumen area (CMO:0001417)	3	130656562	169034231	Rat
8552952	Pigfal13	Plasma insulin-like growth factor 1 level QTL 13			blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	3	138799500	169034231	Rat
12879871	Am7	Aortic mass QTL 7		0.001	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	3	145925360	166177555	Rat
631541	Bp81	Blood pressure QTL 81	4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	3	124122556	169034231	Rat
2312670	Bw94	Body weight QTL 94		0.01	inguinal fat pad mass (VT:0010424)	inguinal fat pad weight to body weight ratio (CMO:0001253)	3	98535255	168026850	Rat

RH131830

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	3	152,397,761 - 152,397,972 (+)	MAPPER	mRatBN7.2
Rnor_6.0	3	160,114,857 - 160,115,067	NCBI	Rnor6.0
Rnor_5.0	3	166,305,018 - 166,305,228	UniSTS	Rnor5.0
RGSC_v3.4	3	154,635,547 - 154,635,757	UniSTS	RGSC3.4
Celera	3	151,050,057 - 151,050,267	UniSTS
Cytogenetic Map	3	q42	UniSTS

BF410183

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	3	152,385,476 - 152,385,706 (+)	MAPPER	mRatBN7.2
Rnor_6.0	3	160,102,572 - 160,102,801	NCBI	Rnor6.0
Rnor_5.0	3	166,292,733 - 166,292,962	UniSTS	Rnor5.0
RGSC_v3.4	3	154,623,263 - 154,623,492	UniSTS	RGSC3.4
Celera	3	151,037,770 - 151,037,999	UniSTS
RH 3.4 Map	3	1376.5	UniSTS
Cytogenetic Map	3	q42	UniSTS

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

alimentary part of gastrointestinal system	appendage	circulatory system	ectoderm	endocrine system	endoderm	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	mesenchyme	mesoderm	nervous system	renal system	reproductive system	respiratory system
9	11	49	113	91	90	59	25	59	6	218	97	93	45	60	31


RefSeq Transcripts	NM_001401793	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NM_001401794	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NM_001401795	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NM_001401796	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NM_001401797	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NM_153469	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_008762470	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_063283174	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_063283175	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AY150308	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC088108	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CH474005	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ218619	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAXUCZ010000003	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSRNOT00000051590 ⟹ ENSRNOP00000044753

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	3	152,366,041 - 152,398,082 (+)	Ensembl
Rnor_6.0 Ensembl	3	160,047,296 - 160,115,177 (+)	Ensembl

Ensembl Acc Id:

ENSRNOT00000080707 ⟹ ENSRNOP00000071633

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0 Ensembl	3	160,092,975 - 160,114,554 (+)	Ensembl

RefSeq Acc Id:

NM_001401793 ⟹ NP_001388722

RefSeq Status:

VALIDATED

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	3	172,749,915 - 172,817,514 (+)	NCBI
mRatBN7.2	3	152,330,477 - 152,398,085 (+)	NCBI

RefSeq Acc Id:

NM_001401794 ⟹ NP_001388723

RefSeq Status:

VALIDATED

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	3	172,750,132 - 172,817,514 (+)	NCBI
mRatBN7.2	3	152,330,694 - 152,398,085 (+)	NCBI

RefSeq Acc Id:

NM_001401795 ⟹ NP_001388724

RefSeq Status:

VALIDATED

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	3	172,750,132 - 172,817,514 (+)	NCBI
mRatBN7.2	3	152,330,694 - 152,398,085 (+)	NCBI

RefSeq Acc Id:

NM_001401796 ⟹ NP_001388725

RefSeq Status:

VALIDATED

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	3	172,786,275 - 172,817,514 (+)	NCBI
mRatBN7.2	3	152,366,847 - 152,398,085 (+)	NCBI

RefSeq Acc Id:

NM_001401797 ⟹ NP_001388726

RefSeq Status:

VALIDATED

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	3	172,786,275 - 172,817,514 (+)	NCBI
mRatBN7.2	3	152,366,847 - 152,398,085 (+)	NCBI

RefSeq Acc Id:

NM_153469 ⟹ NP_703199

RefSeq Status:

VALIDATED

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	3	172,749,915 - 172,817,514 (+)	NCBI
mRatBN7.2	3	152,330,477 - 152,398,085 (+)	NCBI
Rnor_6.0	3	160,047,296 - 160,115,177 (+)	NCBI
Rnor_5.0	3	166,238,121 - 166,305,341 (+)	NCBI
RGSC_v3.4	3	154,568,485 - 154,635,867 (+)	RGD
Celera	3	150,983,346 - 151,050,377 (+)	RGD

Sequence:

show sequence

CGCTCGCGCCGTCGGCCCGGGCTCCGCGAGGCGACGAGGCGGCAGGCCTGAGGAGCGATGCGACAGGCATGATGGAAGTCGAGTCCTCCTACTCGGACTTCATCTCCTGTGACCGGACAGGCCGTCGG
AATGCAGTCCCTGACATCCAGGGTGACTCGGAGGCCGTGAGCGTGCGGAAGCTAGCTGGAGACATGGGCGAGCTCGCACTTGAGGGGGCAGAAGGACAGGCAGAGGGAAGTACCCCAGACAAGGAAGC
CAGCAGCCAGCCGGAGAGCAGTGACGCGAACACCTCATCCTGAGTCTGCCTGTGGTCCTCACAGGCTGAGAGAGACCTGCTGTCCCTCCTGCACTGGAGCCCTGGCCAGCCAGGCTGACTGAGAGCCT
CATGGAGTCCTCTGTGGCCCCTGCTCCAGTAAAGTCCTCCACTCACACCACAGGCTCCTCTTTCCCACCTCCCACGGTGCCCACGGTGCCCAGGGTGCCCAGGCGCACTTCAGAGACACGAGCACCAT
GAGGTGTTATCTCTTCAGCTGGGCGGGGCTCGAGCCAGGCCCTGCCCCTAGGTGAGCGGCTGTCACCTGGACAGGGATGTCCGGCCACCACTCACCCCTCCAGCCAGCCCCCTCTAGCCAGCCATCCG
TTGAGAAGATCTTCCTAGCCCTTTTTTAAAGCCTCTTTTACATTTTTTAAAAACATAACTTTTTCAGAGAGAGAGAGGGGAGCGGACAATCACTTTTTTTCTGTTTTGGTTTTTGGTTGGTTTTTTTT
CTTTTTTTGAAAGACATTTTAAGCTCAGTTCTGATGATCTATGCAGCTCTAAGTTCCCTCACAGAGCCTCACAGATCCAGTTTTGGGAAAGGATTTGGACTCAAAACTAACTGACCAATTCTTTGCCC
TTTGTACCAAGAGACTGATACTTAGACCTAGGAAATAAATGCTGGTGATTTGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

hide sequence

RefSeq Acc Id:

XM_008762470 ⟹ XP_008760692

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	3	172,754,966 - 172,817,511 (+)	NCBI
mRatBN7.2	3	152,335,545 - 152,398,085 (+)	NCBI
Rnor_6.0	3	160,052,372 - 160,115,180 (+)	NCBI

Sequence:

show sequence

ACTATGTAGACCAGGCTGGTCTTGAACTCAGAGAGCCACTTACCTCTGCTTCTGGAATACTGTGGTTAAAGGCCTGAGGAGCGATGCGACAGGCATGATGGAAGTCGAGTCCTCCTACTCGGACTTCA
TCTCCTGTGACCGGACAGGCCGTCGGAATGCAGTCCCTGACATCCAGGGTGACTCGGAGGCCGTGAGCGTGCGGAAGCTAGCTGGAGACATGGGCGAGCTCGCACTTGAGGGGGCAGAAGGACAGGCA
GAGGGAAGTACCCCAGACAAGGAAGCCAGCAGCCAGCCGGAGAGCAGTGACGCGAACACCTCATCCTGAGTCTGCCTGTGGTCCTCACAGGCTGAGAGAGACCTGCTGTCCCTCCTGCACTGGAGCCC
TGGCCAGCCAGGCTGACTGAGAGCCTCATGGAGTCCTCTGTGGCCCCTGCTCCAGTAAAGTCCTCCACTCACACCACAGGCTCCTCTTTCCCACCTCCCACGGTGCCCACGGTGCCCAGGGTGCCCAG
GCGCACTTCAGAGACACGAGCACCATGAGGTGTTATCTCTTCAGCTGGGCGGGGCTCGAGCCAGGCCCTGCCCCTAGGTGAGCGGCTGTCACCTGGACAGGGATGTCCGGCCACCACTCACCCCTCCA
GCCAGCCCCCTCTAGCCAGCCATCCGTTGAGAAGATCTTCCTAGCCCTTTTTTAAAGCCTCTTTTACATTTTTTAAAAACATAACTTTTTCAGAGAGAGAGAGGGGAGCGGACAATCACTTTTTTTCT
GTTTTGGTTTTTGGTTGGTTTTTTTTCTTTTTTTGAAAGACATTTTAAGCTCAGTTCTGATGATCTATGCAGCTCTAAGTTCCCTCACAGAGCCTCACAGATCCAGTTTTGGGAAAGGATTTGGACTC
AAAACTAACTGACCAATTCTTTGCCCTTTGTACCAAGAGACTGATACTTAGACCTAGGAAATAAATGCTGGTGATTTGTGTGA

hide sequence

RefSeq Acc Id:

XM_063283174 ⟹ XP_063139244

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	3	172,776,632 - 172,814,026 (+)	NCBI

RefSeq Acc Id:

XM_063283175 ⟹ XP_063139245

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	3	172,749,871 - 172,814,026 (+)	NCBI


Protein RefSeqs	NP_001388722	(Get FASTA)	NCBI Sequence Viewer
	NP_001388723	(Get FASTA)	NCBI Sequence Viewer
	NP_001388724	(Get FASTA)	NCBI Sequence Viewer
	NP_001388725	(Get FASTA)	NCBI Sequence Viewer
	NP_001388726	(Get FASTA)	NCBI Sequence Viewer
	NP_703199	(Get FASTA)	NCBI Sequence Viewer
	XP_008760692	(Get FASTA)	NCBI Sequence Viewer
	XP_063139244	(Get FASTA)	NCBI Sequence Viewer
	XP_063139245	(Get FASTA)	NCBI Sequence Viewer
GenBank Protein	AAH88108	(Get FASTA)	NCBI Sequence Viewer
	AAN15275	(Get FASTA)	NCBI Sequence Viewer
	EDL96563	(Get FASTA)	NCBI Sequence Viewer
	EDL96564	(Get FASTA)	NCBI Sequence Viewer
	EDL96565	(Get FASTA)	NCBI Sequence Viewer
	EDL96566	(Get FASTA)	NCBI Sequence Viewer
	EDL96567	(Get FASTA)	NCBI Sequence Viewer
	EDL96568	(Get FASTA)	NCBI Sequence Viewer
Ensembl Protein	ENSRNOP00000044753.2
	ENSRNOP00000108043

RefSeq Acc Id:	NP_703199 ⟸ NM_153469
- UniProtKB:	Q6YH22 (UniProtKB/TrEMBL), A6JX44 (UniProtKB/TrEMBL), A6JX43 (UniProtKB/TrEMBL)
- Sequence:	show sequence MMEVESSYSDFISCDRTGRRNAVPDIQGDSEAVSVRKLAGDMGELALEGAEGQAEGSTPDKEASSQPESSDANTSS hide sequence

RefSeq Acc Id:	XP_008760692 ⟸ XM_008762470
- Peptide Label:	isoform X2
- UniProtKB:	Q6YH22 (UniProtKB/TrEMBL), A6JX44 (UniProtKB/TrEMBL), A6JX43 (UniProtKB/TrEMBL)
- Sequence:	show sequence MMEVESSYSDFISCDRTGRRNAVPDIQGDSEAVSVRKLAGDMGELALEGAEGQAEGSTPDKEASSQPESSDANTSS hide sequence

Ensembl Acc Id:

ENSRNOP00000071633 ⟸ ENSRNOT00000080707

Ensembl Acc Id:

ENSRNOP00000044753 ⟸ ENSRNOT00000051590

RefSeq Acc Id:	NP_001388722 ⟸ NM_001401793
- UniProtKB:	Q6YH22 (UniProtKB/TrEMBL), A6JX44 (UniProtKB/TrEMBL), A6JX43 (UniProtKB/TrEMBL)

Name	Modeler	Protein Id	AA Range	Protein Structure
AF-Q6YH22-F1-model_v2	AlphaFold	Q6YH22	1-76	view protein structure

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

RGD ID:

13692640

Promoter ID:

EPDNEW_R3163

Type:

initiation region

Name:

Pkig_1

Description:

cAMP-dependent protein kinase inhibitor gamma

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0	3	160,047,247 - 160,047,307	EPDNEW

Database	Acc Id	Source(s)
BioCyc Gene	G2FUF-46897	BioCyc
Ensembl Genes	ENSRNOG00000010235	Ensembl, ENTREZGENE, UniProtKB/TrEMBL
Ensembl Transcript	ENSRNOT00000051590.3	UniProtKB/TrEMBL
	ENSRNOT00000133815	ENTREZGENE
IMAGE_CLONE	IMAGE:7368431	IMAGE-MGC_LOAD
InterPro	cAMP_dep_PKI	UniProtKB/TrEMBL
MGC_CLONE	MGC:108574	IMAGE-MGC_LOAD
NCBI Gene	266709	ENTREZGENE
PANTHER	PTHR15416	UniProtKB/TrEMBL
Pfam	PKI	UniProtKB/TrEMBL
PhenoGen	Pkig	PhenoGen
PIRSF	PKI	UniProtKB/TrEMBL
RatGTEx	ENSRNOG00000010235	RatGTEx
UniProt	A6JX43	ENTREZGENE, UniProtKB/TrEMBL
	A6JX44	ENTREZGENE, UniProtKB/TrEMBL
	F7F4X2	ENTREZGENE, UniProtKB/TrEMBL
	Q6YH22	ENTREZGENE
UniProt Secondary	Q6YH22	UniProtKB/TrEMBL

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2017-01-03	Pkig	cAMP-dependent protein kinase inhibitor gamma	Pkig	protein kinase (cAMP-dependent, catalytic) inhibitor gamma	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2014-03-13	Pkig	protein kinase (cAMP-dependent, catalytic) inhibitor gamma	Pkig	protein kinase inhibitor, gamma	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2008-12-15	Pkig	protein kinase inhibitor, gamma	Pkig	protein kinase (cAMP-dependent, catalytic) inhibitor gamma	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2008-09-09	Pkig	protein kinase (cAMP-dependent, catalytic) inhibitor gamma	Pkig	protein kinase inhibitor, gamma	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2004-12-14	Pkig	protein kinase inhibitor, gamma			Symbol and Name status set to approved	1299863	APPROVED
2003-02-27	Pkig	protein kinase inhibitor, gamma			Symbol and Name status set to provisional	70820	PROVISIONAL

Note Type	Note	Reference
gene_cellular_localization	localized to the nucleus and cytoplasm	1359036

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Send us a Message

Imported Disease Annotations - ClinVar