Symbol:
Coq10b
Name:
coenzyme Q10B
RGD ID:
1359509
Description:
Predicted to enable ubiquinone binding activity. Predicted to be involved in cellular respiration. Predicted to be located in mitochondrial inner membrane. Predicted to be active in mitochondrion. Orthologous to human COQ10B (coenzyme Q10B); INTERACTS WITH 17alpha-ethynylestradiol; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
coenzyme Q-binding protein COQ10 homolog B, mitochondrial; coenzyme Q10 homolog B; coenzyme Q10 homolog B (S. cerevisiae); MGC109115; RGD1359509; similar to hypothetical protein FLJ13448
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
COQ10B (coenzyme Q10B) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Mus musculus (house mouse):
Coq10b (coenzyme Q10B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Coq10b (coenzyme Q10B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
COQ10B (coenzyme Q10B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
COQ10B (coenzyme Q10B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Coq10b (coenzyme Q10B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
COQ10B (coenzyme Q10B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
COQ10B (coenzyme Q10B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Coq10b (coenzyme Q10B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
COQ10B (coenzyme Q10B)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Coq10b (coenzyme Q10B)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
coq10b (coenzyme Q10B)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
CG9410
Alliance
DIOPT (Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
COQ10
Alliance
DIOPT (Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER)
Caenorhabditis elegans (roundworm):
R144.13
Alliance
DIOPT (Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 9 64,048,168 - 64,068,082 (+) NCBI GRCr8 mRatBN7.2 9 56,553,751 - 56,573,671 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 9 56,553,758 - 56,573,663 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 9 65,063,617 - 65,082,593 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 9 70,179,514 - 70,198,490 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 9 68,479,090 - 68,498,222 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 9 61,655,963 - 61,675,880 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 9 61,655,963 - 61,675,873 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 9 61,337,179 - 61,357,092 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 9 53,858,750 - 53,878,664 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 9 53,860,163 - 53,880,077 (+) NCBI Celera 9 54,036,101 - 54,055,146 (+) NCBI Celera Cytogenetic Map 9 q31 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Coq10b Rat 1,2-dichloroethane decreases expression ISO Coq10b (Mus musculus) 6480464 ethylene dichloride results in decreased expression of COQ10B mRNA CTD PMID:28189721 and PMID:28960355 Coq10b Rat 1,2-dimethylhydrazine decreases expression ISO Coq10b (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of COQ10B mRNA CTD PMID:22206623 Coq10b Rat 1,2-dimethylhydrazine multiple interactions ISO Coq10b (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of COQ10B mRNA CTD PMID:22206623 Coq10b Rat 17alpha-ethynylestradiol increases expression EXP 6480464 Ethinyl Estradiol results in increased expression of COQ10B mRNA CTD PMID:17351261 Coq10b Rat 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of COQ10B mRNA CTD PMID:32145629 Coq10b Rat 17beta-estradiol decreases expression ISO Coq10b (Mus musculus) 6480464 Estradiol results in decreased expression of COQ10B mRNA CTD PMID:39298647 Coq10b Rat 2,3',4,4',5-Pentachlorobiphenyl increases expression ISO Coq10b (Mus musculus) 6480464 2 more ... CTD PMID:31388691 Coq10b Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of COQ10B mRNA CTD PMID:22298810 and PMID:32109520 Coq10b Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of COQ10B mRNA CTD PMID:33387578 Coq10b Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of COQ10B mRNA CTD PMID:21215274 and PMID:21724226 Coq10b Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Coq10b (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of COQ10B mRNA CTD PMID:21570461 and PMID:28922406 Coq10b Rat 3,3',4,4'-tetrachlorobiphenyl multiple interactions ISO Coq10b (Mus musculus) 6480464 3 more ... CTD PMID:19467301 Coq10b Rat 3,3',5-triiodo-L-thyronine increases expression EXP 6480464 Triiodothyronine results in increased expression of COQ10B mRNA CTD PMID:29357290 Coq10b Rat 3-chloropropane-1,2-diol decreases expression EXP 6480464 alpha-Chlorohydrin results in decreased expression of COQ10B protein CTD PMID:34915118 Coq10b Rat 4,4'-sulfonyldiphenol affects expression ISO Coq10b (Mus musculus) 6480464 bisphenol S affects the expression of COQ10B mRNA CTD PMID:39298647 Coq10b Rat 4,4'-sulfonyldiphenol decreases expression ISO Coq10b (Mus musculus) 6480464 bisphenol S results in decreased expression of COQ10B mRNA CTD PMID:33297965 Coq10b Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of COQ10B mRNA CTD PMID:30047161 Coq10b Rat acetamide decreases expression EXP 6480464 acetamide results in decreased expression of COQ10B mRNA CTD PMID:31881176 Coq10b Rat acrylamide increases expression ISO Coq10b (Mus musculus) 6480464 Acrylamide results in increased expression of COQ10B mRNA CTD PMID:30807115 Coq10b Rat aflatoxin B1 increases expression ISO COQ10B (Homo sapiens) 6480464 Aflatoxin B1 results in increased expression of COQ10B mRNA CTD PMID:21641981 Coq10b Rat aflatoxin B1 increases expression EXP 6480464 Aflatoxin B1 results in increased expression of COQ10B mRNA CTD PMID:33354967 Coq10b Rat amitrole increases expression EXP 6480464 Amitrole results in increased expression of COQ10B mRNA CTD PMID:30047161 Coq10b Rat amphetamine increases expression EXP 6480464 Amphetamine results in increased expression of COQ10B mRNA CTD PMID:30779732 Coq10b Rat antirheumatic drug decreases expression ISO COQ10B (Homo sapiens) 6480464 Antirheumatic Agents results in decreased expression of COQ10B mRNA CTD PMID:24449571 Coq10b Rat arsane multiple interactions ISO COQ10B (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of COQ10B mRNA CTD PMID:39836092 Coq10b Rat arsenic atom multiple interactions ISO COQ10B (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of COQ10B mRNA CTD PMID:39836092 Coq10b Rat arsenite(3-) multiple interactions ISO COQ10B (Homo sapiens) 6480464 arsenite promotes the reaction [G3BP1 protein binds to COQ10B mRNA] CTD PMID:32406909 Coq10b Rat benzo[a]pyrene increases expression ISO Coq10b (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of COQ10B mRNA CTD PMID:21569818 and PMID:22228805 Coq10b Rat benzo[a]pyrene multiple interactions ISO Coq10b (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of COQ10B mRNA CTD PMID:27858113 Coq10b Rat benzo[b]fluoranthene increases expression ISO Coq10b (Mus musculus) 6480464 benzo(b)fluoranthene results in increased expression of COQ10B mRNA CTD PMID:26377693 Coq10b Rat benzo[b]fluoranthene multiple interactions ISO Coq10b (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of COQ10B mRNA CTD PMID:27858113 Coq10b Rat beta-naphthoflavone decreases expression ISO Coq10b (Mus musculus) 6480464 beta-Naphthoflavone results in decreased expression of COQ10B mRNA CTD PMID:22234961 Coq10b Rat beta-naphthoflavone multiple interactions ISO Coq10b (Mus musculus) 6480464 AHR protein affects the reaction [beta-Naphthoflavone results in decreased expression of COQ10B mRNA] CTD PMID:22234961 Coq10b Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of COQ10B mRNA CTD PMID:25181051 and PMID:32145629 Coq10b Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of COQ10B mRNA CTD PMID:34947998 Coq10b Rat bisphenol A increases expression ISO Coq10b (Mus musculus) 6480464 bisphenol A results in increased expression of COQ10B mRNA CTD PMID:25594700 Coq10b Rat bromobenzene affects expression EXP 6480464 bromobenzene affects the expression of COQ10B mRNA CTD PMID:32479839 Coq10b Rat cadmium dichloride multiple interactions ISO Coq10b (Mus musculus) 6480464 MT3 affects the reaction [Cadmium Chloride affects the expression of COQ10B mRNA] CTD PMID:20371981 Coq10b Rat carbon nanotube increases expression ISO Coq10b (Mus musculus) 6480464 Nanotubes and Carbon analog results in increased expression of COQ10B mRNA CTD PMID:25554681 Coq10b Rat carbon nanotube decreases expression ISO Coq10b (Mus musculus) 6480464 Nanotubes and Carbon results in decreased expression of COQ10B mRNA CTD PMID:25620056 Coq10b Rat carbon nanotube affects expression ISO Coq10b (Mus musculus) 6480464 Nanotubes and Carbon affects the expression of COQ10B mRNA CTD PMID:25554681 Coq10b Rat CGP 52608 multiple interactions ISO COQ10B (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to COQ10B gene] CTD PMID:28238834 Coq10b Rat chlorpyrifos increases expression ISO Coq10b (Mus musculus) 6480464 Chlorpyrifos results in increased expression of COQ10B mRNA CTD PMID:37019170 Coq10b Rat chrysene multiple interactions ISO Coq10b (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of COQ10B mRNA CTD PMID:27858113 Coq10b Rat cobalt dichloride increases expression EXP 6480464 cobaltous chloride results in increased expression of COQ10B mRNA CTD PMID:24386269 Coq10b Rat cobalt dichloride increases expression ISO COQ10B (Homo sapiens) 6480464 cobaltous chloride results in increased expression of COQ10B mRNA CTD PMID:19376846 Coq10b Rat copper atom multiple interactions ISO COQ10B (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of COQ10B mRNA CTD PMID:20971185 Coq10b Rat copper(0) multiple interactions ISO COQ10B (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of COQ10B mRNA CTD PMID:20971185 Coq10b Rat copper(II) sulfate increases expression ISO COQ10B (Homo sapiens) 6480464 Copper Sulfate results in increased expression of COQ10B mRNA CTD PMID:19549813 Coq10b Rat crocidolite asbestos increases expression ISO COQ10B (Homo sapiens) 6480464 Asbestos and Crocidolite results in increased expression of COQ10B mRNA CTD PMID:18687144 Coq10b Rat crocidolite asbestos decreases expression ISO Coq10b (Mus musculus) 6480464 Asbestos and Crocidolite results in decreased expression of COQ10B mRNA CTD PMID:29279043 Coq10b Rat cyclosporin A increases expression ISO COQ10B (Homo sapiens) 6480464 Cyclosporine results in increased expression of COQ10B mRNA CTD PMID:20106945 and PMID:25562108 Coq10b Rat cylindrospermopsin increases expression ISO COQ10B (Homo sapiens) 6480464 cylindrospermopsin results in increased expression of COQ10B mRNA CTD PMID:24921660 Coq10b Rat dibenz[a,h]anthracene increases expression ISO Coq10b (Mus musculus) 6480464 1 more ... CTD PMID:26377693 Coq10b Rat Dibutyl phosphate affects expression ISO COQ10B (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of COQ10B mRNA CTD PMID:37042841 Coq10b Rat dibutyl phthalate increases expression EXP 6480464 Dibutyl Phthalate results in increased expression of COQ10B mRNA CTD PMID:21266533 Coq10b Rat dibutyl phthalate increases expression ISO Coq10b (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of COQ10B mRNA CTD PMID:17361019 and PMID:21266533 Coq10b Rat dicrotophos decreases expression ISO COQ10B (Homo sapiens) 6480464 dicrotophos results in decreased expression of COQ10B mRNA CTD PMID:28302478 Coq10b Rat diethylstilbestrol increases expression ISO COQ10B (Homo sapiens) 6480464 Diethylstilbestrol results in increased expression of COQ10B mRNA CTD PMID:36621641 Coq10b Rat dioxygen multiple interactions ISO Coq10b (Mus musculus) 6480464 [NFE2L2 protein affects the susceptibility to Oxygen] which affects the expression of COQ10B mRNA CTD PMID:30529165 Coq10b Rat diuron increases expression EXP 6480464 Diuron results in increased expression of COQ10B mRNA CTD PMID:21551480 Coq10b Rat epoxiconazole affects expression ISO Coq10b (Mus musculus) 6480464 epoxiconazole affects the expression of COQ10B mRNA CTD PMID:35436446 Coq10b Rat ethanol affects splicing ISO Coq10b (Mus musculus) 6480464 Ethanol affects the splicing of COQ10B mRNA CTD PMID:30319688 Coq10b Rat fluoranthene multiple interactions ISO Coq10b (Mus musculus) 6480464 [1-methylanthracene co-treated with fluoranthene] results in increased expression of COQ10B mRNA CTD PMID:28329830 Coq10b Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of COQ10B mRNA CTD PMID:24136188 Coq10b Rat folic acid decreases expression ISO Coq10b (Mus musculus) 6480464 Folic Acid results in decreased expression of COQ10B mRNA CTD PMID:25629700 Coq10b Rat folic acid multiple interactions ISO Coq10b (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of COQ10B mRNA CTD PMID:22206623 Coq10b Rat FR900359 decreases phosphorylation ISO COQ10B (Homo sapiens) 6480464 FR900359 results in decreased phosphorylation of COQ10B protein CTD PMID:37730182 Coq10b Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of COQ10B mRNA CTD PMID:33387578 Coq10b Rat glafenine increases expression EXP 6480464 Glafenine results in increased expression of COQ10B mRNA CTD PMID:24136188 Coq10b Rat indole-3-methanol affects expression EXP 6480464 indole-3-carbinol affects the expression of COQ10B mRNA CTD PMID:21396975 Coq10b Rat inulin multiple interactions ISO Coq10b (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in decreased expression of COQ10B mRNA CTD PMID:36331819 Coq10b Rat leflunomide increases expression ISO COQ10B (Homo sapiens) 6480464 leflunomide results in increased expression of COQ10B mRNA CTD PMID:28988120 and PMID:29427785 Coq10b Rat methamphetamine increases expression EXP 6480464 Methamphetamine results in increased expression of COQ10B mRNA CTD PMID:19564919 Coq10b Rat methamphetamine multiple interactions EXP 6480464 [Methamphetamine co-treated with SCH 23390] results in increased expression of COQ10B mRNA CTD PMID:19564919 Coq10b Rat methimazole increases expression EXP 6480464 Methimazole results in increased expression of COQ10B mRNA CTD PMID:30047161 Coq10b Rat methylmercury chloride increases expression ISO COQ10B (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of COQ10B mRNA CTD PMID:28001369 Coq10b Rat monosodium L-glutamate multiple interactions ISO Coq10b (Mus musculus) 6480464 [Trans Fatty Acids co-treated with Sodium Glutamate] results in increased expression of COQ10B mRNA CTD PMID:22078008 Coq10b Rat nimesulide increases expression EXP 6480464 nimesulide results in increased expression of COQ10B mRNA CTD PMID:24136188 Coq10b Rat paracetamol increases expression ISO COQ10B (Homo sapiens) 6480464 Acetaminophen results in increased expression of COQ10B mRNA CTD PMID:21420995 Coq10b Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of COQ10B mRNA CTD PMID:32479839 and PMID:33387578 Coq10b Rat paracetamol affects expression ISO COQ10B (Homo sapiens) 6480464 Acetaminophen affects the expression of COQ10B mRNA CTD PMID:25704631 Coq10b Rat perfluorohexanesulfonic acid increases expression ISO Coq10b (Mus musculus) 6480464 perfluorohexanesulfonic acid results in increased expression of COQ10B mRNA CTD PMID:37995155 Coq10b Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Coq10b (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in decreased expression of COQ10B mRNA CTD PMID:36331819 Coq10b Rat phenobarbital increases expression ISO Coq10b (Mus musculus) 6480464 Phenobarbital results in increased expression of COQ10B mRNA CTD PMID:19270015 Coq10b Rat phenobarbital affects expression ISO Coq10b (Mus musculus) 6480464 Phenobarbital affects the expression of COQ10B mRNA CTD PMID:23091169 Coq10b Rat phenobarbital affects expression ISO COQ10B (Homo sapiens) 6480464 Phenobarbital affects the expression of COQ10B mRNA CTD PMID:19159669 Coq10b Rat pirinixic acid decreases expression ISO Coq10b (Mus musculus) 6480464 pirinixic acid results in decreased expression of COQ10B mRNA CTD PMID:23811191 Coq10b Rat propiconazole increases expression ISO Coq10b (Mus musculus) 6480464 propiconazole results in increased expression of COQ10B mRNA CTD PMID:21278054 Coq10b Rat quercetin multiple interactions ISO Coq10b (Mus musculus) 6480464 [Quercetin co-treated with Dietary Fats] affects the expression of COQ10B mRNA CTD PMID:23359794 Coq10b Rat SCH 23390 multiple interactions EXP 6480464 [Methamphetamine co-treated with SCH 23390] results in increased expression of COQ10B mRNA CTD PMID:19564919 Coq10b Rat sodium arsenite increases expression ISO COQ10B (Homo sapiens) 6480464 sodium arsenite results in increased expression of COQ10B mRNA CTD PMID:38568856 Coq10b Rat sodium arsenite multiple interactions ISO COQ10B (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of COQ10B mRNA CTD PMID:39836092 Coq10b Rat sodium dichromate increases expression EXP 6480464 sodium bichromate results in increased expression of COQ10B mRNA CTD PMID:22561333 Coq10b Rat Soman increases expression EXP 6480464 Soman results in increased expression of COQ10B mRNA CTD PMID:19281266 Coq10b Rat sulfadimethoxine increases expression EXP 6480464 Sulfadimethoxine results in increased expression of COQ10B mRNA CTD PMID:30047161 Coq10b Rat tamoxifen increases expression ISO Coq10b (Mus musculus) 6480464 Tamoxifen results in increased expression of COQ10B mRNA CTD PMID:25123088 Coq10b Rat testosterone decreases expression ISO COQ10B (Homo sapiens) 6480464 Testosterone results in decreased expression of COQ10B mRNA CTD PMID:33359661 Coq10b Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of COQ10B mRNA CTD PMID:31150632 Coq10b Rat tetrachloromethane decreases expression ISO Coq10b (Mus musculus) 6480464 Carbon Tetrachloride results in decreased expression of COQ10B mRNA CTD PMID:31919559 Coq10b Rat tetraphene multiple interactions ISO Coq10b (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of COQ10B mRNA CTD PMID:27858113 Coq10b Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of COQ10B mRNA CTD PMID:34492290 Coq10b Rat thiram increases expression ISO COQ10B (Homo sapiens) 6480464 Thiram results in increased expression of COQ10B mRNA CTD PMID:38568856 Coq10b Rat titanium dioxide decreases expression ISO Coq10b (Mus musculus) 6480464 titanium dioxide results in decreased expression of COQ10B mRNA CTD PMID:23557971 Coq10b Rat titanium dioxide decreases methylation ISO Coq10b (Mus musculus) 6480464 titanium dioxide results in decreased methylation of COQ10B promoter CTD PMID:35295148 Coq10b Rat triphenyl phosphate affects expression ISO COQ10B (Homo sapiens) 6480464 triphenyl phosphate affects the expression of COQ10B mRNA CTD PMID:37042841 Coq10b Rat tungsten increases expression ISO Coq10b (Mus musculus) 6480464 Tungsten results in increased expression of COQ10B mRNA CTD PMID:30912803 Coq10b Rat tunicamycin increases expression ISO COQ10B (Homo sapiens) 6480464 Tunicamycin results in increased expression of COQ10B mRNA CTD PMID:22378314 Coq10b Rat valproic acid affects expression ISO Coq10b (Mus musculus) 6480464 Valproic Acid affects the expression of COQ10B mRNA CTD PMID:17292431 and PMID:17963808 Coq10b Rat zinc atom multiple interactions ISO COQ10B (Homo sapiens) 6480464 [PCI 5002 co-treated with Zinc] results in increased expression of COQ10B mRNA CTD PMID:18593933 Coq10b Rat zinc(0) multiple interactions ISO COQ10B (Homo sapiens) 6480464 [PCI 5002 co-treated with Zinc] results in increased expression of COQ10B mRNA CTD PMID:18593933
1,2-dichloroethane (ISO) 1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (EXP) 17beta-estradiol (EXP,ISO) 2,3',4,4',5-Pentachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 3,3',4,4'-tetrachlorobiphenyl (ISO) 3,3',5-triiodo-L-thyronine (EXP) 3-chloropropane-1,2-diol (EXP) 4,4'-sulfonyldiphenol (ISO) 6-propyl-2-thiouracil (EXP) acetamide (EXP) acrylamide (ISO) aflatoxin B1 (EXP,ISO) amitrole (EXP) amphetamine (EXP) antirheumatic drug (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) benzo[a]pyrene (ISO) benzo[b]fluoranthene (ISO) beta-naphthoflavone (ISO) bisphenol A (EXP,ISO) bromobenzene (EXP) cadmium dichloride (ISO) carbon nanotube (ISO) CGP 52608 (ISO) chlorpyrifos (ISO) chrysene (ISO) cobalt dichloride (EXP,ISO) copper atom (ISO) copper(0) (ISO) copper(II) sulfate (ISO) crocidolite asbestos (ISO) cyclosporin A (ISO) cylindrospermopsin (ISO) dibenz[a,h]anthracene (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (EXP,ISO) dicrotophos (ISO) diethylstilbestrol (ISO) dioxygen (ISO) diuron (EXP) epoxiconazole (ISO) ethanol (ISO) fluoranthene (ISO) flutamide (EXP) folic acid (ISO) FR900359 (ISO) gentamycin (EXP) glafenine (EXP) indole-3-methanol (EXP) inulin (ISO) leflunomide (ISO) methamphetamine (EXP) methimazole (EXP) methylmercury chloride (ISO) monosodium L-glutamate (ISO) nimesulide (EXP) paracetamol (EXP,ISO) perfluorohexanesulfonic acid (ISO) perfluorooctane-1-sulfonic acid (ISO) phenobarbital (ISO) pirinixic acid (ISO) propiconazole (ISO) quercetin (ISO) SCH 23390 (EXP) sodium arsenite (ISO) sodium dichromate (EXP) Soman (EXP) sulfadimethoxine (EXP) tamoxifen (ISO) testosterone (ISO) tetrachloromethane (EXP,ISO) tetraphene (ISO) thioacetamide (EXP) thiram (ISO) titanium dioxide (ISO) triphenyl phosphate (ISO) tungsten (ISO) tunicamycin (ISO) valproic acid (ISO) zinc atom (ISO) zinc(0) (ISO)
Coq10b Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 9 64,048,168 - 64,068,082 (+) NCBI GRCr8 mRatBN7.2 9 56,553,751 - 56,573,671 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 9 56,553,758 - 56,573,663 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 9 65,063,617 - 65,082,593 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 9 70,179,514 - 70,198,490 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 9 68,479,090 - 68,498,222 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 9 61,655,963 - 61,675,880 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 9 61,655,963 - 61,675,873 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 9 61,337,179 - 61,357,092 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 9 53,858,750 - 53,878,664 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 9 53,860,163 - 53,880,077 (+) NCBI Celera 9 54,036,101 - 54,055,146 (+) NCBI Celera Cytogenetic Map 9 q31 NCBI
COQ10B Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 197,453,552 - 197,475,310 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 197,453,493 - 197,475,310 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 198,318,276 - 198,340,034 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 198,026,476 - 198,048,096 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 2 192,074,111 - 192,095,724 (+) NCBI Celera Cytogenetic Map 2 q33.1 NCBI HuRef 2 190,170,684 - 190,192,464 (+) NCBI HuRef CHM1_1 2 198,324,072 - 198,345,690 (+) NCBI CHM1_1 T2T-CHM13v2.0 2 197,937,200 - 197,958,936 (+) NCBI T2T-CHM13v2.0
Coq10b Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 55,091,929 - 55,111,861 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 55,091,929 - 55,111,861 (+) Ensembl GRCm39 Ensembl GRCm38 1 55,052,770 - 55,072,702 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 55,052,770 - 55,072,702 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 55,109,614 - 55,129,546 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 54,997,315 - 55,016,498 (+) NCBI MGSCv36 mm8 Celera 1 55,572,843 - 55,592,772 (+) NCBI Celera Cytogenetic Map 1 C1.2 NCBI cM Map 1 28.0 NCBI
Coq10b Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955403 3,080,945 - 3,090,982 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955403 3,080,945 - 3,090,978 (-) NCBI ChiLan1.0 ChiLan1.0
COQ10B Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 13 100,065,332 - 100,088,862 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2B 100,080,324 - 100,103,854 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2B 84,696,607 - 84,718,187 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2B 202,591,244 - 202,612,215 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2B 202,591,240 - 202,612,215 (+) Ensembl panpan1.1 panPan2
COQ10B Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 37 6,984,886 - 7,005,572 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 37 6,984,935 - 7,005,406 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 37 7,931,067 - 7,951,766 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 37 6,875,413 - 6,896,131 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 37 6,808,860 - 6,914,722 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 37 6,874,210 - 6,894,913 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 37 6,841,018 - 6,861,879 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 37 6,864,326 - 6,885,030 (+) NCBI UU_Cfam_GSD_1.0
Coq10b Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405303 155,118,998 - 155,143,556 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936506 1,694,380 - 1,719,414 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936506 1,694,516 - 1,718,994 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
COQ10B Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 15 101,338,141 - 101,354,948 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 15 101,338,012 - 101,354,714 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 15 112,512,217 - 112,528,766 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
COQ10B Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 10 82,966,422 - 82,989,000 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 10 82,966,377 - 82,989,184 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666040 116,455,152 - 116,477,537 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Coq10b
.
Predicted Target Of
Count of predictions: 695 Count of miRNA genes: 290 Interacting mature miRNAs: 366 Transcripts: ENSRNOT00000040461 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
7411571 Bw138 Body weight QTL 138 14.3 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 9 32535505 77535505 Rat 1300180 Bw14 Body weight QTL 14 3.776 body mass (VT:0001259) body weight (CMO:0000012) 9 23754024 61381613 Rat 11353957 Bmd92 Bone mineral density QTL 92 0.01 tibia mineral mass (VT:1000283) volumetric bone mineral density (CMO:0001553) 9 46114199 91114199 Rat 631680 Cm11 Cardiac mass QTL 11 3.1 0.00089 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 9 20430519 65430519 Rat 70218 Cm28 Cardiac mass QTL 28 8.3 0.0001 heart mass (VT:0007028) heart wet weight (CMO:0000069) 9 25268044 79271759 Rat 724544 Uae9 Urinary albumin excretion QTL 9 4.5 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 9 25268044 114175309 Rat 7207805 Bmd88 Bone mineral density QTL 88 4 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 9 23754024 58157242 Rat 631643 Bp120 Blood pressure QTL 120 3 0.004 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 22071200 67071200 Rat 12879506 Pur33 Proteinuria QTL 33 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 9 44649921 89649921 Rat 731164 Uae25 Urinary albumin excretion QTL 25 3.5 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 9 25661188 100929786 Rat 1598849 Memor17 Memory QTL 17 2.2 exploratory behavior trait (VT:0010471) difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678) 9 49968546 71098346 Rat 10058949 Gmadr5 Adrenal mass QTL 5 2 0.014 adrenal gland mass (VT:0010420) both adrenal glands wet weight to body weight ratio (CMO:0002411) 9 42791513 87976209 Rat 631656 Bp108 Blood pressure QTL 108 5.97 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 48598251 93598251 Rat 2303170 Bp332 Blood pressure QTL 332 3.73 0.027 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 9 55847841 77026453 Rat 8662828 Vetf6 Vascular elastic tissue fragility QTL 6 3.9 artery integrity trait (VT:0010639) patent ductus arteriosus score (CMO:0002566) 9 36962359 92058970 Rat 61352 Bp34 Blood pressure QTL 34 5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 42495343 79271511 Rat 1598834 Memor11 Memory QTL 11 2.5 exploratory behavior trait (VT:0010471) average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674) 9 36962359 77814038 Rat 70186 Niddm26 Non-insulin dependent diabetes mellitus QTL 26 3.87 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 9 22071169 86369743 Rat 7207814 Bmd91 Bone mineral density QTL 91 3.5 femur size trait (VT:1000369) femoral neck cross-sectional area (CMO:0001697) 9 23754144 83851531 Rat 6903941 Pur31 Proteinuria QTL 31 0.036 urine total protein amount (VT:0000032) urine protein excretion rate (CMO:0000759) 9 40194188 85194188 Rat 2290450 Scl57 Serum cholesterol level QTL 57 4.15 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 9 36962359 95410867 Rat 11353949 Bp393 Blood pressure QTL 393 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 40194188 85194188 Rat 11353951 Bp394 Blood pressure QTL 394 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 9 44649921 89649921 Rat 10054125 Srcrt7 Stress Responsive Cort QTL 7 3.33 0.0011 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 9 1 87073594 Rat 1331757 Cdexp1 CD45RC expression in CD8 T cells QTL 1 4.3 CD8-positive T cell quantity (VT:0008077) blood CD45RC(high) CD8 T cell count to CD45RC(low) CD8 T cell count ratio (CMO:0001990) 9 1024537 67509080 Rat 7411656 Foco26 Food consumption QTL 26 9.8 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 9 32535505 77535505 Rat 1641894 Alcrsp12 Alcohol response QTL 12 response to alcohol trait (VT:0010489) brain neurotensin receptor 1 density (CMO:0002068) 9 27468639 72468639 Rat
BQ204877
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 9 56,573,728 - 56,573,885 (+) MAPPER mRatBN7.2 Rnor_6.0 9 61,675,938 - 61,676,094 NCBI Rnor6.0 Rnor_5.0 9 61,357,154 - 61,357,310 UniSTS Rnor5.0 RGSC_v3.4 9 53,878,726 - 53,878,882 UniSTS RGSC3.4 Celera 9 54,055,208 - 54,055,364 UniSTS RH 3.4 Map 5 804.19 UniSTS Cytogenetic Map 9 q31 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000040461 ⟹ ENSRNOP00000050509
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 9 56,553,758 - 56,573,663 (+) Ensembl Rnor_6.0 Ensembl 9 61,655,963 - 61,675,873 (+) Ensembl
RefSeq Acc Id:
NM_001009671 ⟹ NP_001009671
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 9 64,048,168 - 64,068,082 (+) NCBI mRatBN7.2 9 56,553,751 - 56,573,667 (+) NCBI Rnor_6.0 9 61,655,963 - 61,675,876 (+) NCBI Rnor_5.0 9 61,337,179 - 61,357,092 (+) NCBI RGSC_v3.4 9 53,858,750 - 53,878,664 (+) RGD Celera 9 54,036,101 - 54,055,146 (+) RGD
Sequence:
CCGGCTTCACAAAGATGATCATGGCAGCTCGGACTAGTCAGAGGACTCTGGCTAGGGTGGCATCGGGATGCCGTCCGAAGTCAACCACAGTGACGGAAGCCCGGGTGCGAGGGTCTGCGCGCAACGTC
hide sequence
RefSeq Acc Id:
NP_001009671 ⟸ NM_001009671
- UniProtKB:
Q5I0I9 (UniProtKB/Swiss-Prot), A6IP05 (UniProtKB/TrEMBL)
- Sequence:
MIMAARTSQRTLARVASGCRPKSTTVTEARVRGSARNVRYLAPCGILMNRTLAPWASVLPKEICARTFFRITTPLVNKRKEYSERRIIGYSMQEMYDVVSGMEDYKHFVPWCKKSDILSRRSGYCKTR
hide sequence
Ensembl Acc Id:
ENSRNOP00000050509 ⟸ ENSRNOT00000040461
RGD ID: 13696670 Promoter ID: EPDNEW_R7194 Type: multiple initiation site Name: Coq10b_1 Description: coenzyme Q10B SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 9 61,655,973 - 61,656,033 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2015-06-24
Coq10b
coenzyme Q10B
Coq10b
coenzyme Q10 homolog B (S. cerevisiae)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-03-07
Coq10b
coenzyme Q10 homolog B (S. cerevisiae)
RGD1359509
similar to hypothetical protein FLJ13448
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-11-17
RGD1359509
similar to hypothetical protein FLJ13448
Symbol updated
1299863 APPROVED
2005-07-29
MGC109115
similar to hypothetical protein FLJ13448
Symbol and Name status set to provisional
70820 PROVISIONAL
