Symbol:
Tcf7l1
Name:
transcription factor 7 like 1
RGD ID:
1311671
Description:
Predicted to enable several functions, including DNA-binding transcription factor activity, RNA polymerase II-specific; RNA polymerase II cis-regulatory region sequence-specific DNA binding activity; and beta-catenin binding activity. Predicted to be involved in canonical Wnt signaling pathway and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within several processes, including axial mesoderm morphogenesis; regulation of DNA-templated transcription; and somatic stem cell population maintenance. Predicted to be located in cytosol and nucleoplasm. Predicted to be part of beta-catenin-TCF complex. Predicted to be active in chromatin. Orthologous to human TCF7L1 (transcription factor 7 like 1); PARTICIPATES IN Wnt signaling, canonical pathway; INTERACTS WITH 1,2-dimethylhydrazine; 2,3,7,8-tetrachlorodibenzodioxine; acrylamide.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
LOC312451; Tcf3; transcription factor 3; transcription factor 7-like 1; transcription factor 7-like 1 (T-cell specific, HMG-box)
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 106,238,892 - 106,404,012 (-) NCBI GRCr8 mRatBN7.2 4 104,680,734 - 104,846,086 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 104,680,739 - 104,845,287 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 110,059,625 - 110,224,156 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 105,834,747 - 105,999,257 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 104,448,498 - 104,613,031 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 100,492,796 - 100,660,401 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 100,491,798 - 100,660,140 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 165,263,179 - 165,427,206 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 106,128,203 - 106,149,229 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 106,372,784 - 106,393,874 (-) NCBI Celera 4 93,833,646 - 93,998,059 (-) NCBI Celera Cytogenetic Map 4 q32 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Tcf7l1 Rat 1,2-dimethylhydrazine decreases expression EXP 6480464 1 and 2-Dimethylhydrazine results in decreased expression of TCF7L1 mRNA CTD PMID:27840820 Tcf7l1 Rat 17beta-estradiol decreases expression ISO TCF7L1 (Homo sapiens) 6480464 Estradiol results in decreased expression of TCF7L1 mRNA CTD PMID:31614463 Tcf7l1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Tcf7l1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of TCF7L1 mRNA CTD PMID:24058054 Tcf7l1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of TCF7L1 mRNA CTD PMID:34747641 Tcf7l1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Tcf7l1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of TCF7L1 mRNA CTD PMID:37172768 Tcf7l1 Rat 3,3',5,5'-tetrabromobisphenol A decreases expression ISO Tcf7l1 (Mus musculus) 6480464 tetrabromobisphenol A results in decreased expression of TCF7L1 mRNA CTD PMID:25172293 Tcf7l1 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of TCF7L1 mRNA CTD PMID:28628672 Tcf7l1 Rat 4,4'-sulfonyldiphenol multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of TCF7L1 mRNA CTD PMID:28628672 Tcf7l1 Rat 4,4'-sulfonyldiphenol affects methylation ISO Tcf7l1 (Mus musculus) 6480464 bisphenol S affects the methylation of TCF7L1 gene CTD PMID:31683443 Tcf7l1 Rat 4,4'-sulfonyldiphenol increases methylation ISO TCF7L1 (Homo sapiens) 6480464 bisphenol S results in increased methylation of TCF7L1 gene CTD PMID:31601247 Tcf7l1 Rat acrylamide decreases expression EXP 6480464 Acrylamide results in decreased expression of TCF7L1 mRNA CTD PMID:28959563 Tcf7l1 Rat aflatoxin B1 increases methylation ISO TCF7L1 (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of TCF7L1 intron CTD PMID:30157460 Tcf7l1 Rat Aflatoxin B2 alpha decreases methylation ISO TCF7L1 (Homo sapiens) 6480464 aflatoxin B2 results in decreased methylation of TCF7L1 intron CTD PMID:30157460 Tcf7l1 Rat alpha-Zearalanol multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in increased expression of TCF7L1 mRNA CTD PMID:35163327 Tcf7l1 Rat antirheumatic drug increases expression ISO TCF7L1 (Homo sapiens) 6480464 Antirheumatic Agents results in increased expression of TCF7L1 mRNA CTD PMID:24449571 Tcf7l1 Rat arsane multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of TCF7L1 mRNA CTD PMID:39836092 Tcf7l1 Rat arsenic atom multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of TCF7L1 mRNA CTD PMID:39836092 Tcf7l1 Rat arsenite(3-) multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to TCF7L1 mRNA] CTD PMID:32406909 Tcf7l1 Rat arsenous acid decreases expression ISO TCF7L1 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of TCF7L1 mRNA CTD PMID:29633893 Tcf7l1 Rat benzo[a]pyrene decreases methylation ISO TCF7L1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of TCF7L1 promoter CTD PMID:27901495 Tcf7l1 Rat benzo[a]pyrene affects methylation ISO TCF7L1 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of TCF7L1 intron CTD PMID:30157460 Tcf7l1 Rat benzo[a]pyrene diol epoxide I decreases expression ISO TCF7L1 (Homo sapiens) 6480464 7 more ... CTD PMID:20382639 Tcf7l1 Rat bis(2-ethylhexyl) phthalate decreases expression ISO Tcf7l1 (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of TCF7L1 mRNA CTD PMID:34319233 Tcf7l1 Rat bisphenol A decreases expression ISO Tcf7l1 (Mus musculus) 6480464 bisphenol A results in decreased expression of TCF7L1 mRNA CTD PMID:25270620 Tcf7l1 Rat bisphenol A increases expression ISO Tcf7l1 (Mus musculus) 6480464 bisphenol A results in increased expression of TCF7L1 mRNA CTD PMID:32156529 Tcf7l1 Rat bisphenol A increases methylation ISO TCF7L1 (Homo sapiens) 6480464 bisphenol A results in increased methylation of TCF7L1 gene CTD PMID:31601247 Tcf7l1 Rat bisphenol A multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in increased methylation of TCF7L1 gene CTD PMID:31601247 Tcf7l1 Rat bisphenol A affects methylation ISO Tcf7l1 (Mus musculus) 6480464 bisphenol A affects the methylation of TCF7L1 promoter CTD PMID:27334623 Tcf7l1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of TCF7L1 mRNA CTD PMID:25181051 Tcf7l1 Rat buta-1,3-diene decreases expression ISO Tcf7l1 (Mus musculus) 6480464 1 and 3-butadiene results in decreased expression of TCF7L1 mRNA CTD PMID:29038090 Tcf7l1 Rat cadmium atom decreases expression ISO Tcf7l1 (Mus musculus) 6480464 Cadmium results in decreased expression of TCF7L1 mRNA CTD PMID:24067728 Tcf7l1 Rat cadmium atom multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of TCF7L1 mRNA CTD PMID:35301059 Tcf7l1 Rat cadmium dichloride increases expression ISO TCF7L1 (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of TCF7L1 mRNA CTD PMID:38568856 Tcf7l1 Rat cadmium dichloride multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of TCF7L1 mRNA CTD PMID:35301059 Tcf7l1 Rat calcitriol decreases expression ISO TCF7L1 (Homo sapiens) 6480464 Calcitriol results in decreased expression of TCF7L1 mRNA CTD PMID:16002434 Tcf7l1 Rat cannabidiol affects methylation EXP 6480464 Cannabidiol affects the methylation of TCF7L1 gene CTD PMID:30521419 Tcf7l1 Rat carbamazepine affects expression ISO TCF7L1 (Homo sapiens) 6480464 Carbamazepine affects the expression of TCF7L1 mRNA CTD PMID:25979313 Tcf7l1 Rat chromium(6+) multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [zinc chromate results in increased abundance of chromium hexavalent ion] which results in decreased expression of TCF7L1 mRNA CTD PMID:38479592 Tcf7l1 Rat cisplatin decreases expression ISO TCF7L1 (Homo sapiens) 6480464 Cisplatin results in decreased expression of TCF7L1 mRNA CTD PMID:27392435 Tcf7l1 Rat cisplatin multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in decreased expression of TCF7L1 mRNA CTD PMID:27392435 Tcf7l1 Rat clofibrate decreases expression ISO Tcf7l1 (Mus musculus) 6480464 Clofibrate results in decreased expression of TCF7L1 mRNA CTD PMID:17585979 Tcf7l1 Rat coumestrol multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [Coumestrol co-treated with 2 more ... CTD PMID:19167446 Tcf7l1 Rat cyclosporin A decreases expression ISO TCF7L1 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of TCF7L1 mRNA CTD PMID:27989131 Tcf7l1 Rat dexamethasone multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of TCF7L1 mRNA CTD PMID:28628672 Tcf7l1 Rat diarsenic trioxide decreases expression ISO TCF7L1 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of TCF7L1 mRNA CTD PMID:29633893 Tcf7l1 Rat Dibutyl phosphate affects expression ISO TCF7L1 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of TCF7L1 mRNA CTD PMID:37042841 Tcf7l1 Rat dicrotophos increases expression ISO TCF7L1 (Homo sapiens) 6480464 dicrotophos results in increased expression of TCF7L1 mRNA CTD PMID:28302478 Tcf7l1 Rat dorsomorphin multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TCF7L1 mRNA CTD PMID:27188386 Tcf7l1 Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of TCF7L1 mRNA CTD PMID:29391264 Tcf7l1 Rat Enterolactone multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [Coumestrol co-treated with 2 and 3-bis(3'-hydroxybenzyl)butyrolactone] results in decreased expression of TCF7L1 mRNA CTD PMID:19167446 Tcf7l1 Rat entinostat increases expression ISO TCF7L1 (Homo sapiens) 6480464 entinostat results in increased expression of TCF7L1 mRNA CTD PMID:26272509 Tcf7l1 Rat entinostat multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TCF7L1 mRNA CTD PMID:27188386 Tcf7l1 Rat ethanol increases expression ISO Tcf7l1 (Mus musculus) 6480464 Ethanol results in increased expression of TCF7L1 mRNA CTD PMID:30319688 Tcf7l1 Rat ethanol affects expression ISO Tcf7l1 (Mus musculus) 6480464 Ethanol affects the expression of TCF7L1 mRNA CTD PMID:30319688 Tcf7l1 Rat folic acid decreases expression ISO Tcf7l1 (Mus musculus) 6480464 Folic Acid results in decreased expression of TCF7L1 mRNA CTD PMID:25629700 Tcf7l1 Rat formaldehyde decreases expression ISO TCF7L1 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of TCF7L1 mRNA CTD PMID:20655997 Tcf7l1 Rat fulvestrant multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in increased methylation of TCF7L1 gene CTD PMID:31601247 Tcf7l1 Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of TCF7L1 mRNA CTD PMID:33387578 Tcf7l1 Rat indometacin multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of TCF7L1 mRNA CTD PMID:28628672 Tcf7l1 Rat lead diacetate increases expression ISO Tcf7l1 (Mus musculus) 6480464 lead acetate results in increased expression of TCF7L1 mRNA CTD PMID:22609695 Tcf7l1 Rat malathion increases expression ISO TCF7L1 (Homo sapiens) 6480464 Malathion results in increased expression of TCF7L1 mRNA CTD PMID:37047231 Tcf7l1 Rat manganese atom multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of TCF7L1 mRNA CTD PMID:39836092 Tcf7l1 Rat manganese(0) multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of TCF7L1 mRNA CTD PMID:39836092 Tcf7l1 Rat manganese(II) chloride multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of TCF7L1 mRNA CTD PMID:39836092 Tcf7l1 Rat methylmercury chloride increases expression ISO TCF7L1 (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of TCF7L1 mRNA CTD PMID:28001369 Tcf7l1 Rat nickel atom decreases expression ISO TCF7L1 (Homo sapiens) 6480464 Nickel results in decreased expression of TCF7L1 mRNA CTD PMID:24768652 and PMID:25583101 Tcf7l1 Rat nickel subsulfide decreases expression EXP 6480464 nickel subsulfide results in decreased expression of TCF7L1 mRNA CTD PMID:24952340 Tcf7l1 Rat nickel sulfate increases expression ISO TCF7L1 (Homo sapiens) 6480464 nickel sulfate results in increased expression of TCF7L1 mRNA CTD PMID:22714537 Tcf7l1 Rat Nor-9-carboxy-delta9-THC multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [Cannabinoids results in increased abundance of 11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid] which affects the methylation of TCF7L1 gene CTD PMID:30521419 Tcf7l1 Rat paracetamol decreases expression ISO TCF7L1 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of TCF7L1 mRNA CTD PMID:22230336 and PMID:26690555 Tcf7l1 Rat paraquat decreases expression ISO Tcf7l1 (Mus musculus) 6480464 Paraquat results in decreased expression of TCF7L1 mRNA CTD PMID:30171970 Tcf7l1 Rat paraquat multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 WNT1 protein inhibits the reaction [Paraquat results in decreased expression of TCF7L1 mRNA] CTD PMID:30171970 Tcf7l1 Rat penconazole increases expression ISO TCF7L1 (Homo sapiens) 6480464 penconazole results in increased expression of TCF7L1 mRNA CTD PMID:23811263 Tcf7l1 Rat perfluorooctanoic acid multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in increased expression of TCF7L1 mRNA CTD PMID:35163327 Tcf7l1 Rat resveratrol multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [Coumestrol co-treated with resveratrol] results in decreased expression of TCF7L1 mRNA CTD PMID:19167446 Tcf7l1 Rat SB 431542 multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of TCF7L1 mRNA CTD PMID:27188386 Tcf7l1 Rat silicon dioxide decreases expression ISO TCF7L1 (Homo sapiens) 6480464 Silicon Dioxide analog results in decreased expression of TCF7L1 mRNA CTD PMID:25895662 Tcf7l1 Rat silver atom increases expression ISO Tcf7l1 (Mus musculus) 6480464 Silver results in increased expression of TCF7L1 mRNA CTD PMID:27131904 Tcf7l1 Rat silver(0) increases expression ISO Tcf7l1 (Mus musculus) 6480464 Silver results in increased expression of TCF7L1 mRNA CTD PMID:27131904 Tcf7l1 Rat sodium arsenite multiple interactions ISO TCF7L1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of TCF7L1 mRNA CTD PMID:39836092 Tcf7l1 Rat sulforaphane decreases expression ISO TCF7L1 (Homo sapiens) 6480464 sulforaphane results in decreased expression of TCF7L1 mRNA CTD PMID:31838189 Tcf7l1 Rat sunitinib decreases expression ISO TCF7L1 (Homo sapiens) 6480464 Sunitinib results in decreased expression of TCF7L1 mRNA CTD PMID:31533062 Tcf7l1 Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of TCF7L1 mRNA CTD PMID:31150632 Tcf7l1 Rat thimerosal decreases expression ISO TCF7L1 (Homo sapiens) 6480464 Thimerosal results in decreased expression of TCF7L1 mRNA CTD PMID:27188386 Tcf7l1 Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of TCF7L1 mRNA CTD PMID:34492290 Tcf7l1 Rat titanium dioxide decreases methylation ISO Tcf7l1 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of TCF7L1 gene and titanium dioxide results in decreased methylation of TCF7L1 promoter CTD PMID:35295148 Tcf7l1 Rat triphenyl phosphate increases expression EXP 6480464 triphenyl phosphate results in increased expression of TCF7L1 mRNA CTD PMID:30589522 Tcf7l1 Rat triphenyl phosphate affects expression ISO TCF7L1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of TCF7L1 mRNA CTD PMID:37042841 Tcf7l1 Rat troglitazone decreases expression ISO Tcf7l1 (Mus musculus) 6480464 troglitazone results in decreased expression of TCF7L1 mRNA CTD PMID:28973697 Tcf7l1 Rat urethane decreases expression ISO TCF7L1 (Homo sapiens) 6480464 Urethane results in decreased expression of TCF7L1 mRNA CTD PMID:28818685 Tcf7l1 Rat valproic acid increases expression ISO TCF7L1 (Homo sapiens) 6480464 Valproic Acid results in increased expression of TCF7L1 mRNA CTD PMID:19101580 Tcf7l1 Rat valproic acid affects expression ISO TCF7L1 (Homo sapiens) 6480464 Valproic Acid affects the expression of TCF7L1 mRNA CTD PMID:25979313 Tcf7l1 Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of TCF7L1 mRNA CTD PMID:23034163 Tcf7l1 Rat vinclozolin increases methylation EXP 6480464 vinclozolin results in increased methylation of TCF7L1 gene CTD PMID:31682807 Tcf7l1 Rat vitamin E increases expression ISO TCF7L1 (Homo sapiens) 6480464 Vitamin E results in increased expression of TCF7L1 mRNA CTD PMID:19244175
1,2-dimethylhydrazine (EXP) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (ISO) acrylamide (EXP) aflatoxin B1 (ISO) Aflatoxin B2 alpha (ISO) alpha-Zearalanol (EXP) antirheumatic drug (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) arsenous acid (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) buta-1,3-diene (ISO) cadmium atom (ISO) cadmium dichloride (ISO) calcitriol (ISO) cannabidiol (EXP) carbamazepine (ISO) chromium(6+) (ISO) cisplatin (ISO) clofibrate (ISO) coumestrol (ISO) cyclosporin A (ISO) dexamethasone (ISO) diarsenic trioxide (ISO) Dibutyl phosphate (ISO) dicrotophos (ISO) dorsomorphin (ISO) endosulfan (EXP) Enterolactone (ISO) entinostat (ISO) ethanol (ISO) folic acid (ISO) formaldehyde (ISO) fulvestrant (ISO) gentamycin (EXP) indometacin (ISO) lead diacetate (ISO) malathion (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) methylmercury chloride (ISO) nickel atom (ISO) nickel subsulfide (EXP) nickel sulfate (ISO) Nor-9-carboxy-delta9-THC (ISO) paracetamol (ISO) paraquat (ISO) penconazole (ISO) perfluorooctanoic acid (EXP) resveratrol (ISO) SB 431542 (ISO) silicon dioxide (ISO) silver atom (ISO) silver(0) (ISO) sodium arsenite (ISO) sulforaphane (ISO) sunitinib (ISO) tetrachloromethane (EXP) thimerosal (ISO) thioacetamide (EXP) titanium dioxide (ISO) triphenyl phosphate (EXP,ISO) troglitazone (ISO) urethane (ISO) valproic acid (ISO) vinclozolin (EXP) vitamin E (ISO)
Tcf7l1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 106,238,892 - 106,404,012 (-) NCBI GRCr8 mRatBN7.2 4 104,680,734 - 104,846,086 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 104,680,739 - 104,845,287 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 110,059,625 - 110,224,156 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 105,834,747 - 105,999,257 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 104,448,498 - 104,613,031 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 100,492,796 - 100,660,401 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 100,491,798 - 100,660,140 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 165,263,179 - 165,427,206 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 106,128,203 - 106,149,229 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 106,372,784 - 106,393,874 (-) NCBI Celera 4 93,833,646 - 93,998,059 (-) NCBI Celera Cytogenetic Map 4 q32 NCBI
TCF7L1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 85,133,392 - 85,310,387 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 85,133,392 - 85,310,387 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 85,360,515 - 85,537,510 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 85,214,245 - 85,391,016 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 2 85,272,391 - 85,449,162 NCBI Celera 2 85,189,038 - 85,365,500 (+) NCBI Celera Cytogenetic Map 2 p11.2 NCBI HuRef 2 85,257,850 - 85,434,099 (+) NCBI HuRef CHM1_1 2 85,290,354 - 85,467,245 (+) NCBI CHM1_1 T2T-CHM13v2.0 2 85,135,301 - 85,312,378 (+) NCBI T2T-CHM13v2.0
Tcf7l1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 72,603,354 - 72,766,028 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 72,603,361 - 72,766,237 (-) Ensembl GRCm39 Ensembl GRCm38 6 72,626,371 - 72,789,045 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 72,626,378 - 72,789,254 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 72,576,374 - 72,738,950 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 72,555,889 - 72,718,465 (-) NCBI MGSCv36 mm8 Celera 6 74,727,941 - 74,893,703 (-) NCBI Celera Cytogenetic Map 6 C1 NCBI cM Map 6 32.27 NCBI
Tcf7l1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955424 2,137,865 - 2,286,181 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955424 2,139,576 - 2,286,183 (-) NCBI ChiLan1.0 ChiLan1.0
TCF7L1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 12 41,072,932 - 41,249,313 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2A 41,075,694 - 41,252,075 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2A 85,186,660 - 85,363,033 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2A 86,739,422 - 86,914,829 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2A 86,739,417 - 86,913,905 (+) Ensembl panpan1.1 panPan2
TCF7L1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 17 39,699,958 - 39,859,167 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 17 39,699,958 - 39,858,182 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 17 39,371,581 - 39,530,084 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 17 40,509,531 - 40,668,072 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 17 40,509,321 - 40,668,674 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 17 39,576,919 - 39,735,480 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 17 39,648,692 - 39,807,230 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 17 40,048,459 - 40,208,222 (-) NCBI UU_Cfam_GSD_1.0
Tcf7l1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024406292 78,895,196 - 79,009,978 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936712 1,848,464 - 1,962,650 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936712 1,848,478 - 1,962,644 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
TCF7L1
TCF7L1
Tcf7l1
.
Predicted Target Of
Count of predictions: 178 Count of miRNA genes: 123 Interacting mature miRNAs: 152 Transcripts: ENSRNOT00000020005 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1582232 Gluco25 Glucose level QTL 25 3.6 0.0023 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 85253748 148090731 Rat 631689 Scl4 Serum cholesterol level QTL 4 1.9 0.008 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 4 95174120 140174120 Rat 1358352 Srcrt3 Stress Responsive Cort QTL 3 2.29 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 38465774 146803430 Rat 1578655 Bmd11 Bone mineral density QTL 11 11 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 4 90850165 135850165 Rat 10755501 Bp390 Blood pressure QTL 390 2.5 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 4 26775591 168368347 Rat 1357342 Bw40 Body weight QTL 40 0.001 body mass (VT:0001259) body weight (CMO:0000012) 4 76647384 117676292 Rat 631556 Bp135 Blood pressure QTL 135 0.017 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 78881294 117676292 Rat 61330 Eau1 Experimental allergic uveoretinitis QTL 1 0.0003 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 4 70362013 132642728 Rat 70167 Bw22 Body weight QTL 22 3.1 body mass (VT:0001259) body weight (CMO:0000012) 4 76647384 117676292 Rat 1549839 Bw52 Body weight QTL 52 0.0001 body mass (VT:0001259) body weight gain (CMO:0000420) 4 61697658 115089733 Rat 70177 Xhs1 X-ray hypersensitivity QTL 1 25.1 intestine integrity trait (VT:0010554) post-insult time to onset of moribundity (CMO:0001896) 4 82798864 152731274 Rat 724522 Bp146 Blood pressure QTL 146 2.2 0.0021 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 73630210 118630210 Rat 61476 Aia3 Adjuvant induced arthritis QTL 3 3.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 86730991 131730991 Rat 1641919 Alc22 Alcohol consumption QTL 22 0.0005 drinking behavior trait (VT:0001422) ethanol drink intake rate (CMO:0001407) 4 81192555 126192555 Rat 1354660 Salc1 Saline consumption QTL 1 11.26 drinking behavior trait (VT:0001422) saline drink intake rate (CMO:0001627) 4 44463908 148090542 Rat 2300179 Bmd50 Bone mineral density QTL 50 5.9 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 4 60928534 105928534 Rat 1298082 Stresp4 Stress response QTL 4 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 50119848 146803430 Rat 70192 BpQTLcluster5 Blood pressure QTL cluster 5 4.183 arterial blood pressure trait (VT:2000000) absolute change in mean arterial blood pressure (CMO:0000533) 4 62933508 114921294 Rat 1578670 Bss14 Bone structure and strength QTL 14 16.4 femur morphology trait (VT:0000559) bone trabecular cross-sectional area (CMO:0002311) 4 87327165 132327165 Rat 2317588 Eae27 Experimental allergic encephalomyelitis QTL 27 nervous system integrity trait (VT:0010566) percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047) 4 103194805 112478794 Rat 1300139 Hrtrt6 Heart rate QTL 6 2.85 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 39524264 116179656 Rat 70200 Alc18 Alcohol consumption QTL 18 9.2 drinking behavior trait (VT:0001422) ethanol intake volume to total fluid intake volume ratio (CMO:0001591) 4 56647873 149491524 Rat 1578657 Bss12 Bone structure and strength QTL 12 8.9 femur morphology trait (VT:0000559) femoral neck cross-sectional area (CMO:0001697) 4 60220938 105220938 Rat 1578658 Bss13 Bone structure and strength QTL 13 8 femur strength trait (VT:0010010) femoral neck polar moment of inertia (CMO:0001670) 4 60220938 105220938 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 6478684 Anxrr30 Anxiety related response QTL 30 0.00087 defecation behavior trait (VT:0010462) defecation rate (CMO:0000998) 4 62753847 107753847 Rat 1578662 Bss15 Bone structure and strength QTL 15 19.6 femur width (VT:1000666) femoral neck width (CMO:0001695) 4 87327165 132327165 Rat 2302051 Pia28 Pristane induced arthritis QTL 28 5.3 0.001 blood autoantibody amount (VT:0003725) serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112) 4 73630210 118630210 Rat 738009 Sach4 Saccharine consumption QTL 4 4.9 0.000016 consumption behavior trait (VT:0002069) saccharin intake volume to total fluid intake volume ratio (CMO:0001601) 4 59948935 154902892 Rat 2312567 Glom19 Glomerulus QTL 19 1.9 0.006 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 4 45456990 146803430 Rat 738015 Pia9 Pristane induced arthritis QTL 9 4.5 0.048 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 80694870 125694870 Rat 6478772 Anxrr49 Anxiety related response QTL 49 0.15488 defecation behavior trait (VT:0010462) defecation rate (CMO:0000998) 4 62753847 107753847 Rat 634335 Anxrr16 Anxiety related response QTL 16 7.22 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 93308457 167139447 Rat 631646 Stl4 Serum triglyceride level QTL 4 6.5 0.0001 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 4 73169846 132642728 Rat 634334 Xhs3 X-ray hypersensitivity QTL 3 10 intestine integrity trait (VT:0010554) post-insult time to onset of moribundity (CMO:0001896) 4 84728680 129854654 Rat 1354612 Foco1 Food consumption QTL 1 8.87 eating behavior trait (VT:0001431) food intake rate (CMO:0000427) 4 44463908 148090542 Rat 634344 Hcar7 Hepatocarcinoma resistance QTL 7 7.8 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 4 70808386 115808386 Rat 2303168 Bp330 Blood pressure QTL 330 4.25 0.017 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 5214602 146446691 Rat 738031 Alc14 Alcohol consumption QTL 14 7.6 0.00003 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1576316 Ept5 Estrogen-induced pituitary tumorigenesis QTL 5 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 4 83428419 177635233 Rat 631662 Hcar2 Hepatocarcinoma resistance QTL 2 3.1 0.0003 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 78878504 123878504 Rat 1576305 Emca6 Estrogen-induced mammary cancer QTL 6 5.8 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 4 44463720 155883716 Rat 61418 Pia5 Pristane induced arthritis QTL 5 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 62277855 128289560 Rat 631651 Bp124 Blood pressure QTL 124 3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 62879517 107879517 Rat 738016 Alc16 Alcohol consumption QTL 16 3.6 0.00015 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1358202 Gluco11 Glucose level QTL 11 2.4 0.02 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 85379421 167139601 Rat 1641833 Alc21 Alcohol consumption QTL 21 8.6 0.0001 drinking behavior trait (VT:0001422) ethanol drink intake rate (CMO:0001407) 4 56698790 126192555 Rat 2306899 Bp338 Blood pressure QTL 338 0.071 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 81006124 120102625 Rat 631674 Iddm14 Insulin dependent diabetes mellitus QTL 14 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 4 64528739 157573521 Rat 6478743 Anxrr40 Anxiety related response QTL 40 0.83076 defecation behavior trait (VT:0010462) defecation rate (CMO:0000998) 4 62753847 107753847 Rat 12798523 Anxrr56 Anxiety related response QTL 56 2.83 0.05 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 85253748 150276390 Rat 61434 Cia3 Collagen induced arthritis QTL 3 4.8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 103194656 148194656 Rat 12798520 Anxrr55 Anxiety related response QTL 55 4.45 0.01 locomotor behavior trait (VT:0001392) number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715) 4 32583980 114627242 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000020005 ⟹ ENSRNOP00000020005
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 104,680,739 - 104,845,287 (-) Ensembl Rnor_6.0 Ensembl 4 100,491,798 - 100,660,140 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000106765 ⟹ ENSRNOP00000081559
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 104,680,739 - 104,845,287 (-) Ensembl
RefSeq Acc Id:
NM_001107865 ⟹ NP_001101335
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 106,238,896 - 106,403,421 (-) NCBI mRatBN7.2 4 104,680,739 - 104,845,287 (-) NCBI Rnor_6.0 4 100,492,800 - 100,660,142 (-) NCBI Rnor_5.0 4 165,263,179 - 165,427,206 (-) NCBI Celera 4 93,833,646 - 93,998,059 (-) RGD
Sequence:
CCACCATGCCCCAGCTCGGTGGTGGCCGCGGTGGCGGCGCCGGCGGGGGAGGCGGTGGCTCCGGAGCCGGGGCAACCAGTGGAGGGGACGACCTCGGAGCGAACGACGAGCTGATCCCCTTCCAGGAC
hide sequence
RefSeq Acc Id:
XM_006236674 ⟹ XP_006236736
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 106,238,892 - 106,403,993 (-) NCBI mRatBN7.2 4 104,680,734 - 104,846,082 (-) NCBI Rnor_6.0 4 100,492,796 - 100,660,401 (-) NCBI Rnor_5.0 4 165,263,179 - 165,427,206 (-) NCBI
Sequence:
CCCGGCCGAGCAGGCAACGGCGGTGGCGGCGGCTAGTTGGGGAGCCCTAGGTTCCGTACTGCGG
hide sequence
RefSeq Acc Id:
XM_039107580 ⟹ XP_038963508
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 106,238,892 - 106,404,012 (-) NCBI mRatBN7.2 4 104,680,734 - 104,846,086 (-) NCBI
RefSeq Acc Id:
XM_039107582 ⟹ XP_038963510
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 106,238,892 - 106,403,993 (-) NCBI mRatBN7.2 4 104,680,734 - 104,846,082 (-) NCBI
RefSeq Acc Id:
NP_001101335 ⟸ NM_001107865
- UniProtKB:
A6IAD2 (UniProtKB/TrEMBL)
- Sequence:
MPQLGGGRGGGAGGGGGGSGAGATSGGDDLGANDELIPFQDEGGEEQEPSSDSASAQRDLDEVKSSLVNESENQSSSSDSEAERRPQPARDAFQKPRDYFAEVRRPQDGAFFKGPAYPGYPFLMIPDL
hide sequence
RefSeq Acc Id:
XP_006236736 ⟸ XM_006236674
- Peptide Label:
isoform X2
- UniProtKB:
A0A8I5ZT78 (UniProtKB/TrEMBL)
- Sequence:
MPQLGGGRGGGAGGGGGGSGAGATSGGDDLGANDELIPFQDEGGEEQEPSSDSASAQRDLDEVKSSLVNESENQSSSSDSEAERRPQPARDAFQKPRDYFAEVRRPQDGAFFKGPAYPGYPFLMIPDL
hide sequence
Ensembl Acc Id:
ENSRNOP00000020005 ⟸ ENSRNOT00000020005
RefSeq Acc Id:
XP_038963508 ⟸ XM_039107580
- Peptide Label:
isoform X1
RefSeq Acc Id:
XP_038963510 ⟸ XM_039107582
- Peptide Label:
isoform X3
- UniProtKB:
F1M1R9 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000081559 ⟸ ENSRNOT00000106765
RGD ID: 13693133 Promoter ID: EPDNEW_R3658 Type: multiple initiation site Name: Tcf7l1_1 Description: transcription factor 7 like 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 4 100,660,239 - 100,660,299 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-02-11
Tcf7l1
transcription factor 7 like 1
Tcf7l1
transcription factor 7-like 1 (T-cell specific, HMG-box)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2013-05-24
Tcf7l1
transcription factor 7-like 1 (T-cell specific, HMG-box)
LOC100361823
transcription factor 3
Data merged from RGD:2319352
1643240 APPROVED
2010-05-05
LOC100361823
transcription factor 3
Symbol and Name status set to provisional
70820 PROVISIONAL
2009-12-16
Tcf7l1
transcription factor 7-like 1 (T-cell specific, HMG-box)
Tcf3
transcription factor 3
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-04-30
Tcf3
transcription factor 3
Tcf3_predicted
transcription factor 3 (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Tcf3_predicted
transcription factor 3 (predicted)
Symbol and Name status set to approved
70820 APPROVED
