Symbol:
Alms1
Name:
ALMS1, centrosome and basal body associated protein
RGD ID:
1311590
Description:
Predicted to enable alpha-actinin binding activity. Involved in positive regulation of endocytosis. Located in centriole and ciliary basal body. Human ortholog(s) of this gene implicated in Alstrom syndrome. Orthologous to human ALMS1 (ALMS1 centrosome and basal body associated protein); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 2,6-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
Alstrom syndrome 1 homolog; Alstrom syndrome protein 1; centrosome-associated protein ALMS1; LOC297408
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Allele / Splice:
Alms1em1Mcwi
Genetic Models:
SS-Alms1em1Mcwi-/-
SS-Alms1em1Mcwi
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 119,683,085 - 119,783,471 (+) NCBI GRCr8 mRatBN7.2 4 118,125,581 - 118,226,005 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 118,125,607 - 118,226,005 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 123,606,944 - 123,707,620 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 119,382,049 - 119,482,408 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 117,995,664 - 118,095,939 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 117,371,544 - 117,472,310 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 117,371,659 - 117,472,198 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 181,947,469 - 182,048,235 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 119,846,037 - 119,946,085 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 120,087,754 - 120,190,647 (+) NCBI Celera 4 107,106,971 - 107,206,695 (+) NCBI Celera Cytogenetic Map 4 q34 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Alms1 Rat (-)-demecolcine decreases expression ISO ALMS1 (Homo sapiens) 6480464 Demecolcine results in decreased expression of ALMS1 mRNA CTD PMID:23649840 Alms1 Rat 1,1-dichloroethene increases expression ISO Alms1 (Mus musculus) 6480464 vinylidene chloride results in increased expression of ALMS1 mRNA CTD PMID:26682919 Alms1 Rat 1,2-dichloroethane decreases expression ISO Alms1 (Mus musculus) 6480464 ethylene dichloride results in decreased expression of ALMS1 mRNA CTD PMID:28960355 Alms1 Rat 1,2-dimethylhydrazine increases expression ISO Alms1 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of ALMS1 mRNA CTD PMID:22206623 Alms1 Rat 17beta-estradiol decreases expression ISO Alms1 (Mus musculus) 6480464 Estradiol results in decreased expression of ALMS1 mRNA CTD PMID:25210133 Alms1 Rat 17beta-estradiol increases expression ISO ALMS1 (Homo sapiens) 6480464 Estradiol results in increased expression of ALMS1 mRNA CTD PMID:31614463 Alms1 Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO ALMS1 (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Alms1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO ALMS1 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of ALMS1 mRNA CTD PMID:20106945 and PMID:21632981 Alms1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of ALMS1 mRNA CTD PMID:33387578 Alms1 Rat 2,4,6-tribromophenol decreases expression ISO ALMS1 (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Alms1 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of ALMS1 mRNA CTD PMID:21346803 Alms1 Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of ALMS1 mRNA CTD PMID:21346803 Alms1 Rat 2-amino-4,6-dinitrotoluene affects expression EXP 6480464 2-amino-4 and 6-dinitrotoluene affects the expression of ALMS1 mRNA CTD PMID:21346803 Alms1 Rat 3,3',5,5'-tetrabromobisphenol A decreases expression ISO ALMS1 (Homo sapiens) 6480464 tetrabromobisphenol A results in decreased expression of ALMS1 protein CTD PMID:31675489 Alms1 Rat aflatoxin B1 decreases expression ISO ALMS1 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased expression of ALMS1 mRNA CTD PMID:21632981 more ... Alms1 Rat aflatoxin M1 decreases expression ISO ALMS1 (Homo sapiens) 6480464 Aflatoxin M1 results in decreased expression of ALMS1 mRNA CTD PMID:30928695 Alms1 Rat all-trans-retinoic acid decreases expression ISO ALMS1 (Homo sapiens) 6480464 Tretinoin results in decreased expression of ALMS1 mRNA CTD PMID:15498508 and PMID:33167477 Alms1 Rat amphetamine decreases expression EXP 6480464 Amphetamine results in decreased expression of ALMS1 mRNA CTD PMID:30779732 Alms1 Rat aristolochic acid A decreases expression ISO ALMS1 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of ALMS1 mRNA CTD PMID:33212167 Alms1 Rat arsane multiple interactions ISO ALMS1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of ALMS1 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of ALMS1 mRNA CTD PMID:39836092 Alms1 Rat arsenic atom multiple interactions ISO ALMS1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of ALMS1 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of ALMS1 mRNA CTD PMID:39836092 Alms1 Rat arsenite(3-) multiple interactions ISO ALMS1 (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to ALMS1 mRNA] CTD PMID:32406909 Alms1 Rat benzo[a]pyrene decreases expression ISO ALMS1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of ALMS1 mRNA CTD PMID:20064835 more ... Alms1 Rat benzo[a]pyrene diol epoxide I decreases expression ISO ALMS1 (Homo sapiens) 6480464 7 more ... CTD PMID:26238291 Alms1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of ALMS1 mRNA CTD PMID:25181051 and PMID:30816183 Alms1 Rat bisphenol A decreases expression ISO ALMS1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of ALMS1 protein CTD PMID:31675489 Alms1 Rat caffeine decreases expression EXP 6480464 Caffeine results in decreased expression of ALMS1 mRNA CTD PMID:25868845 Alms1 Rat caffeine affects phosphorylation ISO ALMS1 (Homo sapiens) 6480464 Caffeine affects the phosphorylation of ALMS1 protein CTD PMID:35688186 Alms1 Rat calcitriol increases expression ISO ALMS1 (Homo sapiens) 6480464 Calcitriol results in increased expression of ALMS1 mRNA CTD PMID:16002434 Alms1 Rat camptothecin decreases methylation ISO ALMS1 (Homo sapiens) 6480464 Camptothecin results in decreased methylation of ALMS1 gene CTD PMID:30720231 Alms1 Rat chlorpyrifos decreases expression ISO Alms1 (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of ALMS1 mRNA CTD PMID:37019170 Alms1 Rat cisplatin decreases expression ISO ALMS1 (Homo sapiens) 6480464 Cisplatin results in decreased expression of ALMS1 mRNA CTD PMID:27392435 Alms1 Rat cisplatin multiple interactions ISO ALMS1 (Homo sapiens) 6480464 Cisplatin promotes the reaction [jinfukang results in decreased expression of ALMS1 mRNA] and jinfukang promotes the reaction [Cisplatin results in decreased expression of ALMS1 mRNA] CTD PMID:27392435 Alms1 Rat clobetasol decreases expression ISO Alms1 (Mus musculus) 6480464 Clobetasol results in decreased expression of ALMS1 mRNA CTD PMID:27462272 Alms1 Rat copper(II) sulfate decreases expression ISO ALMS1 (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of ALMS1 mRNA CTD PMID:19549813 Alms1 Rat cyclosporin A increases expression ISO ALMS1 (Homo sapiens) 6480464 Cyclosporine results in increased expression of ALMS1 mRNA CTD PMID:20106945 Alms1 Rat decabromodiphenyl ether decreases expression ISO ALMS1 (Homo sapiens) 6480464 decabromobiphenyl ether results in decreased expression of ALMS1 protein CTD PMID:31675489 Alms1 Rat Dibutyl phosphate affects expression ISO ALMS1 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of ALMS1 mRNA CTD PMID:37042841 Alms1 Rat diethylstilbestrol increases expression EXP 6480464 Diethylstilbestrol results in increased expression of ALMS1 mRNA CTD PMID:21658437 Alms1 Rat formaldehyde increases expression ISO ALMS1 (Homo sapiens) 6480464 Formaldehyde results in increased expression of ALMS1 mRNA CTD PMID:23649840 Alms1 Rat FR900359 decreases phosphorylation ISO ALMS1 (Homo sapiens) 6480464 FR900359 results in decreased phosphorylation of ALMS1 protein CTD PMID:37730182 Alms1 Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of ALMS1 mRNA CTD PMID:33387578 Alms1 Rat hydrogen peroxide affects expression ISO ALMS1 (Homo sapiens) 6480464 Hydrogen Peroxide affects the expression of ALMS1 mRNA CTD PMID:20044591 Alms1 Rat hydrogen peroxide multiple interactions ISO Alms1 (Mus musculus) 6480464 [Hydrogen Peroxide co-treated with N-(oxo-5 more ... CTD PMID:31494107 Alms1 Rat ketamine decreases expression EXP 6480464 Ketamine results in decreased expression of ALMS1 mRNA CTD PMID:20080153 Alms1 Rat lead diacetate multiple interactions ISO ALMS1 (Homo sapiens) 6480464 [lead acetate co-treated with zinc protoporphyrin] results in increased expression of ALMS1 mRNA CTD PMID:22839698 Alms1 Rat levonorgestrel multiple interactions ISO ALMS1 (Homo sapiens) 6480464 [testosterone undecanoate co-treated with Levonorgestrel] results in decreased expression of ALMS1 mRNA CTD PMID:19074003 Alms1 Rat manganese atom multiple interactions ISO ALMS1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of ALMS1 mRNA and [manganese chloride results in increased abundance of Manganese] which results in decreased expression of ALMS1 mRNA CTD PMID:39836092 Alms1 Rat manganese(0) multiple interactions ISO ALMS1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of ALMS1 mRNA and [manganese chloride results in increased abundance of Manganese] which results in decreased expression of ALMS1 mRNA CTD PMID:39836092 Alms1 Rat manganese(II) chloride multiple interactions ISO ALMS1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of ALMS1 mRNA and [manganese chloride results in increased abundance of Manganese] which results in decreased expression of ALMS1 mRNA CTD PMID:39836092 Alms1 Rat methylmercury chloride decreases expression ISO ALMS1 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of ALMS1 mRNA CTD PMID:28001369 Alms1 Rat N-ethyl-N-nitrosourea increases mutagenesis ISO Alms1 (Mus musculus) 6480464 Ethylnitrosourea results in increased mutagenesis of ALMS1 mRNA CTD PMID:27776689 Alms1 Rat ozone multiple interactions ISO Alms1 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in increased expression of ALMS1 mRNA and [Air Pollutants results in increased abundance of Ozone] which results in increased expression of ALMS1 mRNA CTD PMID:34911549 Alms1 Rat phenobarbital decreases expression ISO ALMS1 (Homo sapiens) 6480464 Phenobarbital results in decreased expression of ALMS1 protein CTD PMID:35881160 Alms1 Rat phenobarbital decreases expression ISO Alms1 (Mus musculus) 6480464 Phenobarbital results in decreased expression of ALMS1 protein CTD PMID:35881160 Alms1 Rat quercetin decreases expression ISO ALMS1 (Homo sapiens) 6480464 Quercetin results in decreased expression of ALMS1 mRNA CTD PMID:21632981 Alms1 Rat sodium arsenate increases expression ISO Alms1 (Mus musculus) 6480464 sodium arsenate results in increased expression of ALMS1 mRNA CTD PMID:30953684 Alms1 Rat sodium arsenite multiple interactions ISO ALMS1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in decreased expression of ALMS1 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in decreased expression of ALMS1 mRNA CTD PMID:39836092 Alms1 Rat sunitinib decreases expression ISO ALMS1 (Homo sapiens) 6480464 Sunitinib results in decreased expression of ALMS1 mRNA CTD PMID:31533062 Alms1 Rat tamibarotene decreases expression ISO ALMS1 (Homo sapiens) 6480464 tamibarotene results in decreased expression of ALMS1 mRNA CTD PMID:15498508 Alms1 Rat testosterone undecanoate multiple interactions ISO ALMS1 (Homo sapiens) 6480464 [testosterone undecanoate co-treated with Levonorgestrel] results in decreased expression of ALMS1 mRNA CTD PMID:19074003 Alms1 Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of ALMS1 mRNA CTD PMID:31150632 Alms1 Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of ALMS1 mRNA CTD PMID:34492290 Alms1 Rat titanium dioxide increases expression ISO Alms1 (Mus musculus) 6480464 titanium dioxide results in increased expression of ALMS1 mRNA CTD PMID:29264374 and PMID:35295148 Alms1 Rat triphenyl phosphate affects expression ISO ALMS1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of ALMS1 mRNA CTD PMID:37042841 Alms1 Rat triptonide decreases expression ISO Alms1 (Mus musculus) 6480464 triptonide results in decreased expression of ALMS1 mRNA CTD PMID:33045310 Alms1 Rat trovafloxacin decreases expression ISO Alms1 (Mus musculus) 6480464 trovafloxacin results in decreased expression of ALMS1 mRNA CTD PMID:35537566 Alms1 Rat valproic acid decreases expression ISO ALMS1 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of ALMS1 mRNA CTD PMID:28001369 Alms1 Rat valproic acid affects splicing EXP 6480464 Valproic Acid affects the splicing of ALMS1 mRNA CTD PMID:29427782 Alms1 Rat vincristine decreases expression ISO ALMS1 (Homo sapiens) 6480464 Vincristine results in decreased expression of ALMS1 mRNA CTD PMID:23649840 Alms1 Rat zinc protoporphyrin multiple interactions ISO ALMS1 (Homo sapiens) 6480464 [lead acetate co-treated with zinc protoporphyrin] results in increased expression of ALMS1 mRNA CTD PMID:22839698
(-)-demecolcine (ISO) 1,1-dichloroethene (ISO) 1,2-dichloroethane (ISO) 1,2-dimethylhydrazine (ISO) 17beta-estradiol (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4,6-tribromophenol (ISO) 2,4-dinitrotoluene (EXP) 2,6-dinitrotoluene (EXP) 2-amino-4,6-dinitrotoluene (EXP) 3,3',5,5'-tetrabromobisphenol A (ISO) aflatoxin B1 (ISO) aflatoxin M1 (ISO) all-trans-retinoic acid (ISO) amphetamine (EXP) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) bisphenol A (EXP,ISO) caffeine (EXP,ISO) calcitriol (ISO) camptothecin (ISO) chlorpyrifos (ISO) cisplatin (ISO) clobetasol (ISO) copper(II) sulfate (ISO) cyclosporin A (ISO) decabromodiphenyl ether (ISO) Dibutyl phosphate (ISO) diethylstilbestrol (EXP) formaldehyde (ISO) FR900359 (ISO) gentamycin (EXP) hydrogen peroxide (ISO) ketamine (EXP) lead diacetate (ISO) levonorgestrel (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) methylmercury chloride (ISO) N-ethyl-N-nitrosourea (ISO) ozone (ISO) phenobarbital (ISO) quercetin (ISO) sodium arsenate (ISO) sodium arsenite (ISO) sunitinib (ISO) tamibarotene (ISO) testosterone undecanoate (ISO) tetrachloromethane (EXP) thioacetamide (EXP) titanium dioxide (ISO) triphenyl phosphate (ISO) triptonide (ISO) trovafloxacin (ISO) valproic acid (EXP,ISO) vincristine (ISO) zinc protoporphyrin (ISO)
1.
Fat aussie--a new Alstrom syndrome mouse showing a critical role for ALMS1 in obesity, diabetes, and spermatogenesis.
Arsov T, etal., Mol Endocrinol. 2006 Jul;20(7):1610-22. Epub 2006 Mar 2.
2.
Alms1-disrupted mice recapitulate human Alstrom syndrome.
Collin GB, etal., Hum Mol Genet. 2005 Aug 15;14(16):2323-33. Epub 2005 Jul 6.
3.
Mutations in ALMS1 cause obesity, type 2 diabetes and neurosensory degeneration in Alstrom syndrome.
Collin GB, etal., Nat Genet. 2002 May;31(1):74-8. Epub 2002 Apr 8.
4.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
5.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
6.
Subcellular localization of ALMS1 supports involvement of centrosome and basal body dysfunction in the pathogenesis of obesity, insulin resistance, and type 2 diabetes.
Hearn T, etal., Diabetes. 2005 May;54(5):1581-7.
7.
Alstrom Syndrome protein ALMS1 localizes to basal bodies of cochlear hair cells and regulates cilium-dependent planar cell polarity.
Jagger D, etal., Hum Mol Genet. 2011 Feb 1;20(3):466-81. doi: 10.1093/hmg/ddq493. Epub 2010 Nov 11.
8.
Role of Alström syndrome 1 in the regulation of blood pressure and renal function.
Jaykumar AB, etal., JCI Insight. 2018 Nov 2;3(21). pii: 95076. doi: 10.1172/jci.insight.95076.
9.
Novel ALMS1 mutations in Chinese patients with Alstrom syndrome.
Liang X, etal., Mol Vis. 2013 Sep 7;19:1885-91. eCollection 2013.
10.
Syndromic obesity and diabetes: changes in body composition with age and mutation analysis of ALMS1 in 12 United Kingdom kindreds with Alstrom syndrome.
Minton JA, etal., J Clin Endocrinol Metab. 2006 Aug;91(8):3110-6. Epub 2006 May 23.
11.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
12.
Common variations in the ALMS1 gene do not contribute to susceptibility to type 2 diabetes in a large white UK population.
Patel S, etal., Diabetologia. 2006 Jun;49(6):1209-13. Epub 2006 Apr 7.
13.
Molecular approach in the study of Alstrom syndrome: analysis of ten Spanish families.
Pineiro-Gallego T, etal., Mol Vis. 2012;18:1794-802. Epub 2012 Jul 3.
14.
Defective adaptive thermogenesis contributes to metabolic syndrome and liver steatosis in obese mice.
Poekes L, etal., Clin Sci (Lond). 2017 Feb 1;131(4):285-296. doi: 10.1042/CS20160469. Epub 2016 Nov 1.
15.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
16.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
17.
Comprehensive gene review and curation
RGD comprehensive gene curation
Alms1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 119,683,085 - 119,783,471 (+) NCBI GRCr8 mRatBN7.2 4 118,125,581 - 118,226,005 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 118,125,607 - 118,226,005 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 123,606,944 - 123,707,620 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 119,382,049 - 119,482,408 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 117,995,664 - 118,095,939 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 117,371,544 - 117,472,310 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 117,371,659 - 117,472,198 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 181,947,469 - 182,048,235 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 119,846,037 - 119,946,085 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 120,087,754 - 120,190,647 (+) NCBI Celera 4 107,106,971 - 107,206,695 (+) NCBI Celera Cytogenetic Map 4 q34 NCBI
ALMS1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 73,385,758 - 73,609,919 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 73,385,758 - 73,625,166 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 73,612,886 - 73,837,046 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 73,466,394 - 73,690,554 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 2 73,524,540 - 73,748,701 NCBI Celera 2 73,463,729 - 73,687,908 (+) NCBI Celera Cytogenetic Map 2 p13.1 NCBI HuRef 2 73,348,377 - 73,572,081 (+) NCBI HuRef CHM1_1 2 73,543,709 - 73,767,862 (+) NCBI CHM1_1 T2T-CHM13v2.0 2 73,398,811 - 73,623,015 (+) NCBI T2T-CHM13v2.0
Alms1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 85,564,482 - 85,698,973 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 85,564,513 - 85,679,735 (+) Ensembl GRCm39 Ensembl GRCm38 6 85,587,498 - 85,726,611 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 85,587,531 - 85,702,753 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 85,537,525 - 85,652,745 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 85,553,189 - 85,668,300 (+) NCBI MGSCv36 mm8 Celera 6 87,559,405 - 87,708,447 (+) NCBI Celera Cytogenetic Map 6 C3 NCBI cM Map 6 37.48 NCBI
Alms1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955424 12,130,607 - 12,258,522 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955424 12,130,496 - 12,258,684 (-) NCBI ChiLan1.0 ChiLan1.0
ALMS1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 12 52,762,287 - 52,994,559 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2A 52,765,040 - 52,997,312 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2A 73,438,657 - 73,671,313 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2A 74,926,650 - 75,158,734 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2A 74,926,650 - 75,152,139 (+) Ensembl panpan1.1 panPan2
ALMS1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 17 49,301,397 - 49,513,729 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 17 49,301,606 - 49,513,625 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 17 48,945,100 - 49,160,487 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 17 50,163,595 - 50,379,703 (-) NCBI ROS_Cfam_1.0 UMICH_Zoey_3.1 17 49,179,726 - 49,395,827 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 17 49,247,116 - 49,462,601 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 17 49,806,151 - 50,021,717 (-) NCBI UU_Cfam_GSD_1.0
Alms1
ALMS1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 3 69,253,750 - 69,417,189 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 3 69,253,742 - 69,417,043 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 3 72,455,187 - 72,619,961 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
ALMS1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 14 33,571,894 - 33,795,404 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 14 33,573,296 - 33,789,549 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666045 78,295,878 - 78,526,188 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Alms1
.
Assembly: Rnor_5.0
Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Strain Variant Page
4
181967981
181967982
A
G
snv
FHH/EurMcwi (KNAW) , FHH/EurMcwi (MCW), FHL/EurMcwi (MCW), FHL/EurMcwi (KNAW) View more Information
4
181968502
181968503
A
T
snv
GK/Ox (KNAW) , WKY/NHsd (KNAW), WKY/NCrl (KNAW), WKY/N (KNAW), WKY/Gcrc (KNAW), SHRSP/Gcrc (KNAW), FHH/EurMcwi (KNAW), SHR/OlaIpcv (KNAW), SHR/NHsd (KNAW), SHR/NCrlPrin (KNAW), FHL/EurMcwi (MCW), FHL/EurMcwi (KNAW), FHH/EurMcwi (MCW), SHR/OlaIpcvPrin (KNAW) View more Information
4
181973794
181973795
C
G
snv
DA/BklArbNsi (KNAW) , BUF/N (KNAW), ACI/EurMcwi (KNAW), ACI/N (KNAW), SS/JrHsdMcwi (KNAW), SS/Jr (KNAW), SR/JrHsd (KNAW), LN/MavRrrc (KNAW), LL/MavRrrc (KNAW), LH/MavRrrc (KNAW), SS/JrHsdMcwi (MCW), SR/JrHsd (MCW), GH/OmrMcwi (MCW), KFRS3B/Kyo (KyushuU), ACI/EurMcwi (MCW), COP/CrCrl (MCW & UW), BDIX.Cg-Tal/NemOda (KyushuU), BDIX/NemOda (KyushuU), HWY/Slc (KyushuU), NIG-III/Hok (KyushuU), LEW/Crl (KNAW), LEW/NCrl (KNAW), M520/N (KNAW), MNS/Gib (KNAW), LE/OrlBarth (UDEL), BUF/MNa (KyushuU) View more Information
4
181980478
181980479
A
G
snv
LEC/Tj (KyushuU) , FHH/EurMcwi (MCW), FHL/EurMcwi (MCW), FHH/EurMcwi (KNAW), FHL/EurMcwi (KNAW) View more Information
4
181986770
181986771
C
T
snv
ACI/EurMcwi (MCW) , COP/CrCrl (MCW & UW), GH/OmrMcwi (MCW), SR/JrHsd (MCW), SS/JrHsdMcwi (MCW), LH/MavRrrc (KNAW), LL/MavRrrc (KNAW), LN/MavRrrc (KNAW), SR/JrHsd (KNAW), SS/Jr (KNAW), SS/JrHsdMcwi (KNAW), ACI/N (KNAW), ACI/EurMcwi (KNAW), WKY/NCrl (KNAW), BUF/N (KNAW), DA/BklArbNsi (KNAW), LEW/Crl (KNAW), LEW/NCrl (KNAW), M520/N (KNAW), MNS/Gib (KNAW), LE/OrlBarth (UDEL), BUF/MNa (KyushuU), NIG-III/Hok (KyushuU), HWY/Slc (KyushuU), BDIX/NemOda (KyushuU), BDIX.Cg-Tal/NemOda (KyushuU), KFRS3B/Kyo (KyushuU) View more Information
4
181986851
181986852
C
T
snv
FHH/EurMcwi (KNAW) , FHH/EurMcwi (MCW), FHL/EurMcwi (KNAW), FHL/EurMcwi (MCW), LEC/Tj (KyushuU), LE/Stm (SOLiD) (KNAW) View more Information
4
181987285
181987286
C
A
snv
FHH/EurMcwi (MCW) , FHL/EurMcwi (MCW), FHL/EurMcwi (KNAW), LEC/Tj (KyushuU), FHH/EurMcwi (KNAW) View more Information
4
181998705
181998706
T
C
snv
ACI/N (KNAW) , ACI/EurMcwi (KNAW), BUF/N (KNAW), DA/BklArbNsi (KNAW), LEW/Crl (KNAW), LEW/NCrl (KNAW), M520/N (KNAW), MNS/Gib (KNAW), LE/OrlBarth (UDEL), BUF/MNa (KyushuU), NIG-III/Hok (KyushuU), HWY/Slc (KyushuU), SS/JrHsdMcwi (KNAW), SS/Jr (KNAW), SR/JrHsd (KNAW), LN/MavRrrc (KNAW), LL/MavRrrc (KNAW), LH/MavRrrc (KNAW), SS/JrHsdMcwi (MCW), SR/JrHsd (MCW), GH/OmrMcwi (MCW), KFRS3B/Kyo (KyushuU), ACI/EurMcwi (MCW), COP/CrCrl (MCW & UW), BDIX.Cg-Tal/NemOda (KyushuU), BDIX/NemOda (KyushuU) View more Information
4
182022160
182022161
A
T
snv
IS/Kyo (KyushuU) , IS-Tlk/Kyo (KyushuU) View more Information
Predicted Target Of
Count of predictions: 136 Count of miRNA genes: 113 Interacting mature miRNAs: 124 Transcripts: ENSRNOT00000045735 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
2302051 Pia28 Pristane induced arthritis QTL 28 5.3 0.001 blood autoantibody amount (VT:0003725) serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112) 4 73630210 118630210 Rat 1582232 Gluco25 Glucose level QTL 25 3.6 0.0023 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 85253748 148090731 Rat 631689 Scl4 Serum cholesterol level QTL 4 1.9 0.008 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 4 95174120 140174120 Rat 2302049 Pia32 Pristane induced arthritis QTL 32 5.1 0.001 blood autoantibody amount (VT:0003725) serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112) 4 105789505 150789505 Rat 1358352 Srcrt3 Stress Responsive Cort QTL 3 2.29 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 38465774 146803430 Rat 1578655 Bmd11 Bone mineral density QTL 11 11 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 4 90850165 135850165 Rat 1300116 Hrtrt5 Heart rate QTL 5 3.76 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 116179486 151161268 Rat 10755501 Bp390 Blood pressure QTL 390 2.5 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 4 26775591 168368347 Rat 6478763 Anxrr46 Anxiety related response QTL 46 0.07428 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 110870972 155870972 Rat 6478760 Anxrr45 Anxiety related response QTL 45 0.06717 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 110870972 155870972 Rat 738009 Sach4 Saccharine consumption QTL 4 4.9 0.000016 consumption behavior trait (VT:0002069) saccharin intake volume to total fluid intake volume ratio (CMO:0001601) 4 59948935 154902892 Rat 61330 Eau1 Experimental allergic uveoretinitis QTL 1 0.0003 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 4 70362013 132642728 Rat 2312567 Glom19 Glomerulus QTL 19 1.9 0.006 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 4 45456990 146803430 Rat 738015 Pia9 Pristane induced arthritis QTL 9 4.5 0.048 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 80694870 125694870 Rat 7207480 Bss105 Bone structure and strength QTL 105 8.1 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 4 109827074 154827074 Rat 634335 Anxrr16 Anxiety related response QTL 16 7.22 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 93308457 167139447 Rat 731165 Uae21 Urinary albumin excretion QTL 21 2.4 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 4 106649412 151649412 Rat 737821 Hcar9 Hepatocarcinoma resistance QTL 9 3.7 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 109866907 167139601 Rat 631646 Stl4 Serum triglyceride level QTL 4 6.5 0.0001 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 4 73169846 132642728 Rat 634334 Xhs3 X-ray hypersensitivity QTL 3 10 intestine integrity trait (VT:0010554) post-insult time to onset of moribundity (CMO:0001896) 4 84728680 129854654 Rat 61406 Scwia1 Streptococcal cell wall induced arthritis QTL 1 2.3 joint integrity trait (VT:0010548) experimental arthritis severity measurement (CMO:0001459) 4 106805662 151805662 Rat 1549832 Bss3 Bone structure and strength QTL 3 11 femur morphology trait (VT:0000559) femur midshaft cortical cross-sectional area (CMO:0001663) 4 109827074 154827074 Rat 1354612 Foco1 Food consumption QTL 1 8.87 eating behavior trait (VT:0001431) food intake rate (CMO:0000427) 4 44463908 148090542 Rat 70177 Xhs1 X-ray hypersensitivity QTL 1 25.1 intestine integrity trait (VT:0010554) post-insult time to onset of moribundity (CMO:0001896) 4 82798864 152731274 Rat 724522 Bp146 Blood pressure QTL 146 2.2 0.0021 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 73630210 118630210 Rat 2303168 Bp330 Blood pressure QTL 330 4.25 0.017 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 5214602 146446691 Rat 738031 Alc14 Alcohol consumption QTL 14 7.6 0.00003 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1576316 Ept5 Estrogen-induced pituitary tumorigenesis QTL 5 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 4 83428419 177635233 Rat 61476 Aia3 Adjuvant induced arthritis QTL 3 3.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 86730991 131730991 Rat 1641919 Alc22 Alcohol consumption QTL 22 0.0005 drinking behavior trait (VT:0001422) ethanol drink intake rate (CMO:0001407) 4 81192555 126192555 Rat 631662 Hcar2 Hepatocarcinoma resistance QTL 2 3.1 0.0003 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 78878504 123878504 Rat 1576305 Emca6 Estrogen-induced mammary cancer QTL 6 5.8 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 4 44463720 155883716 Rat 61418 Pia5 Pristane induced arthritis QTL 5 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 62277855 128289560 Rat 738016 Alc16 Alcohol consumption QTL 16 3.6 0.00015 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1358202 Gluco11 Glucose level QTL 11 2.4 0.02 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 85379421 167139601 Rat 1354660 Salc1 Saline consumption QTL 1 11.26 drinking behavior trait (VT:0001422) saline drink intake rate (CMO:0001627) 4 44463908 148090542 Rat 1641833 Alc21 Alcohol consumption QTL 21 8.6 0.0001 drinking behavior trait (VT:0001422) ethanol drink intake rate (CMO:0001407) 4 56698790 126192555 Rat 2306899 Bp338 Blood pressure QTL 338 0.071 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 81006124 120102625 Rat 1298082 Stresp4 Stress response QTL 4 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 50119848 146803430 Rat 631674 Iddm14 Insulin dependent diabetes mellitus QTL 14 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 4 64528739 157573521 Rat 12798519 Anxrr54 Anxiety related response QTL 54 2.54 0.05 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 114627026 159627026 Rat 1578670 Bss14 Bone structure and strength QTL 14 16.4 femur morphology trait (VT:0000559) bone trabecular cross-sectional area (CMO:0002311) 4 87327165 132327165 Rat 12798523 Anxrr56 Anxiety related response QTL 56 2.83 0.05 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 85253748 150276390 Rat 70200 Alc18 Alcohol consumption QTL 18 9.2 drinking behavior trait (VT:0001422) ethanol intake volume to total fluid intake volume ratio (CMO:0001591) 4 56647873 149491524 Rat 61434 Cia3 Collagen induced arthritis QTL 3 4.8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 103194656 148194656 Rat 1331759 Hrtrt13 Heart rate QTL 13 3.54628 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 110275411 168266883 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 1578662 Bss15 Bone structure and strength QTL 15 19.6 femur width (VT:1000666) femoral neck width (CMO:0001695) 4 87327165 132327165 Rat
RH136742
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 118,219,748 - 118,219,872 (+) MAPPER mRatBN7.2 Rnor_6.0 4 117,466,058 - 117,466,181 NCBI Rnor6.0 Rnor_5.0 4 182,041,983 - 182,042,106 UniSTS Rnor5.0 RGSC_v3.4 4 119,940,698 - 119,940,821 UniSTS RGSC3.4 Celera 4 107,200,443 - 107,200,566 UniSTS Cytogenetic Map 4 q34 UniSTS
This gene Alms1 is modified in the following models/strains:
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000045735 ⟹ ENSRNOP00000050674
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 118,125,607 - 118,226,005 (+) Ensembl Rnor_6.0 Ensembl 4 117,371,659 - 117,472,198 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000101178 ⟹ ENSRNOP00000079051
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 118,135,247 - 118,226,005 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000109581 ⟹ ENSRNOP00000076984
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 118,125,607 - 118,222,762 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000113260 ⟹ ENSRNOP00000080223
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 118,125,607 - 118,226,005 (+) Ensembl
RefSeq Acc Id:
NM_001106604 ⟹ NP_001100074
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 119,683,085 - 119,783,471 (+) NCBI mRatBN7.2 4 118,125,607 - 118,226,005 (+) NCBI Rnor_6.0 4 117,371,544 - 117,472,310 (+) NCBI Rnor_5.0 4 181,947,469 - 182,048,235 (+) NCBI RGSC_v3.4 4 119,846,037 - 119,946,085 (+) RGD Celera 4 107,106,971 - 107,206,695 (+) NCBI
Sequence:
GAGAGGGCAGGTGCGCCTGCGCACAGCCGCAACCGCCAGTCAACTCGCTTCCCCTCCCTTCCTCTCCCCTCCCCCTCTCCTCCTCTTCCACAGACGCTTGGAGCGCGACGCCAACATGGAGCCGGAGG
hide sequence
RefSeq Acc Id:
XM_039107348 ⟹ XP_038963276
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 119,683,136 - 119,783,462 (+) NCBI mRatBN7.2 4 118,125,581 - 118,226,005 (+) NCBI
RefSeq Acc Id:
XM_039107349 ⟹ XP_038963277
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 119,683,136 - 119,783,462 (+) NCBI mRatBN7.2 4 118,125,581 - 118,226,005 (+) NCBI
RefSeq Acc Id:
XM_039107350 ⟹ XP_038963278
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 119,683,136 - 119,783,462 (+) NCBI mRatBN7.2 4 118,125,581 - 118,226,005 (+) NCBI
RefSeq Acc Id:
XM_039107352 ⟹ XP_038963280
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 119,683,136 - 119,783,462 (+) NCBI mRatBN7.2 4 118,125,581 - 118,226,005 (+) NCBI
RefSeq Acc Id:
XM_039107353 ⟹ XP_038963281
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 119,683,136 - 119,783,462 (+) NCBI mRatBN7.2 4 118,125,581 - 118,226,005 (+) NCBI
RefSeq Acc Id:
XM_039107354 ⟹ XP_038963282
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 119,704,030 - 119,783,462 (+) NCBI mRatBN7.2 4 118,146,549 - 118,226,005 (+) NCBI
RefSeq Acc Id:
XM_039107355 ⟹ XP_038963283
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 119,683,136 - 119,734,435 (+) NCBI mRatBN7.2 4 118,125,581 - 118,176,973 (+) NCBI
RefSeq Acc Id:
XM_063285805 ⟹ XP_063141875
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 119,683,136 - 119,783,462 (+) NCBI
RefSeq Acc Id:
XM_063285806 ⟹ XP_063141876
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 119,683,136 - 119,783,462 (+) NCBI
RefSeq Acc Id:
XM_063285807 ⟹ XP_063141877
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 119,683,136 - 119,783,462 (+) NCBI
RefSeq Acc Id:
NP_001100074 ⟸ NM_001106604
- UniProtKB:
A0A8I5ZSK7 (UniProtKB/TrEMBL)
- Sequence:
MEPEDLPWPDELEEEEEEEEEEGKEEAENASAAATEEARTSEETGRLEEEELEGAGPEVDLDFNSESQLQESTDEEEDELAKAWLQAHPDRPGQGFSLTPPPTPPPSSRHQYRPVEHWGKREVIPLTY
hide sequence
Ensembl Acc Id:
ENSRNOP00000050674 ⟸ ENSRNOT00000045735
RefSeq Acc Id:
XP_038963276 ⟸ XM_039107348
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I5ZSK7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038963281 ⟸ XM_039107353
- Peptide Label:
isoform X7
- UniProtKB:
F1LVG9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038963277 ⟸ XM_039107349
- Peptide Label:
isoform X2
- UniProtKB:
A0A8I5ZSK7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038963280 ⟸ XM_039107352
- Peptide Label:
isoform X5
- UniProtKB:
A0A8I5ZSK7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038963278 ⟸ XM_039107350
- Peptide Label:
isoform X3
- UniProtKB:
A0A8I5ZSK7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038963283 ⟸ XM_039107355
- Peptide Label:
isoform X10
RefSeq Acc Id:
XP_038963282 ⟸ XM_039107354
- Peptide Label:
isoform X9
- UniProtKB:
A0A8I6G4M9 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSRNOP00000080223 ⟸ ENSRNOT00000113260
Ensembl Acc Id:
ENSRNOP00000079051 ⟸ ENSRNOT00000101178
Ensembl Acc Id:
ENSRNOP00000076984 ⟸ ENSRNOT00000109581
RefSeq Acc Id:
XP_063141877 ⟸ XM_063285807
- Peptide Label:
isoform X8
- UniProtKB:
F1LVG9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141875 ⟸ XM_063285805
- Peptide Label:
isoform X4
- UniProtKB:
A0A8I5ZSK7 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141876 ⟸ XM_063285806
- Peptide Label:
isoform X6
- UniProtKB:
A0A8I5ZSK7 (UniProtKB/TrEMBL)
RGD ID: 13693199 Promoter ID: EPDNEW_R3722 Type: multiple initiation site Name: Alms1_1 Description: ALMS1, centrosome and basal body associated protein SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 4 117,371,626 - 117,371,686 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-05-15
Alms1
Alstrom syndrome 1 homolog (human)
Alms1
Alstrom syndrome 1
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-02-26
Alms1
Alstrom syndrome 1
Alms1_predicted
Alstrom syndrome 1 (predicted)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-01-12
Alms1_predicted
Alstrom syndrome 1 (predicted)
Symbol and Name status set to approved
70820 APPROVED
