Advanced Search (OLGA)

Gene: Ccnt1 (cyclin T1) Rattus norvegicus

Analyze

Symbol:

Ccnt1

Name:

cyclin T1

RGD ID:

1311151

Description:

Predicted to enable several functions, including 7SK snRNA binding activity; cyclin-dependent protein serine/threonine kinase activator activity; and enzyme binding activity. Involved in response to xenobiotic stimulus. Predicted to be located in cytosol and nucleoplasm. Predicted to be part of P-TEFb complex. Predicted to be active in nucleus. Orthologous to human CCNT1 (cyclin T1); PARTICIPATES IN RNA polymerase II transcription elongation pathway; INTERACTS WITH berberine; bisphenol A; fenofibrate.

Type:

protein-coding

RefSeq Status:

VALIDATED

Previously known as:

cyclin-T1; cyclin-T1-like; LOC103692976; LOC315291

RGD Orthologs

Alliance Orthologs

More Info

more info ...

More Info

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	CCNT1 (cyclin T1)	HGNC	Ensembl, HomoloGene, Inparanoid, NCBI, Panther
Mus musculus (house mouse):	Ccnt1 (cyclin T1)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):	Ccnt1 (cyclin T1)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):	CCNT1 (cyclin T1)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Canis lupus familiaris (dog):	CCNT1 (cyclin T1)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):	Ccnt1 (cyclin T1)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Sus scrofa (pig):	CCNT1 (cyclin T1)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):	CCNT1 (cyclin T1)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):	Ccnt1 (cyclin T1)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Rattus rattus (black rat):	Ccnt1 (cyclin T1)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Alliance orthologs ³
Homo sapiens (human):	CCNT1 (cyclin T1)	Alliance	DIOPT (Ensembl Compara\|HGNC\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB)
Homo sapiens (human):	CCNT1 (cyclin T1)	Alliance	DIOPT (Ensembl Compara\|HGNC\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Mus musculus (house mouse):	Ccnt1 (cyclin T1)	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Mus musculus (house mouse):	Ccnt1 (cyclin T1)	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|PANTHER\|PhylomeDB)
Danio rerio (zebrafish):	ccnt1 (cyclin T1)	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):	CTK2	Alliance	DIOPT (Ensembl Compara\|PANTHER)
Drosophila melanogaster (fruit fly):	CycT	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OrthoFinder\|PANTHER)
Drosophila melanogaster (fruit fly):	CycT	Alliance	DIOPT (Ensembl Compara\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Caenorhabditis elegans (roundworm):	cit-1.2	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OrthoFinder\|OrthoInspector\|PANTHER\|SonicParanoid)
Caenorhabditis elegans (roundworm):	cit-1.2	Alliance	DIOPT (Ensembl Compara\|InParanoid\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB)
Caenorhabditis elegans (roundworm):	cit-1.1	Alliance	DIOPT (Ensembl Compara\|InParanoid\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB)
Caenorhabditis elegans (roundworm):	cit-1.1	Alliance	DIOPT (Ensembl Compara\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):	ccnt1	Alliance	DIOPT (Ensembl Compara\|Hieranoid\|InParanoid\|OMA\|OrthoFinder\|OrthoInspector\|PANTHER\|PhylomeDB\|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):	ccnt1	Alliance	DIOPT (Ensembl Compara\|OMA\|OrthoFinder\|PANTHER)

Latest Assembly:

GRCr8 - GRCr8 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	7	131,566,176 - 131,596,988 (-)	NCBI	GRCr8	GRCr8		GRCr8
GRCr8 Ensembl	7	131,566,176 - 131,596,938 (-)	Ensembl				GRCr8
mRatBN7.2	7	129,687,146 - 129,718,080 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	7	129,691,209 - 129,717,871 (-)	Ensembl				mRatBN7.2
UTH_Rnor_SHR_Utx	7	131,499,023 - 131,525,200 (-)	NCBI	UTH_Rnor_SHR_Utx	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	7	133,724,573 - 133,750,750 (-)	NCBI	UTH_Rnor_SHRSP_BbbUtx_1.0	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	7	133,637,075 - 133,663,250 (-)	NCBI	UTH_Rnor_WKY_Bbb_1.0	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	7	140,215,052 - 140,245,958 (-)	NCBI	Rnor_6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	7	140,219,551 - 140,245,723 (-)	Ensembl			rn6	Rnor6.0
Rnor_5.0	X	114,723,098 - 114,752,376 (-)	NCBI	Rnor_5.0	Rnor_5.0	rn5
RGSC_v3.4	7	137,288,635 - 137,314,809 (-)	NCBI	RGSC_v3.4	RGSC_v3.4	rn4
Celera	7	126,182,570 - 126,208,635 (-)	NCBI		Celera
RGSC_v3.1	7	137,365,064 - 137,391,433 (-)	NCBI
Cytogenetic Map	7	q36	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

congestive heart failure (ISO)

Experimental Diabetes Mellitus (IEP)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

(1->4)-beta-D-glucan (ISO)

(S)-amphetamine (ISO)

1,2-dimethylhydrazine (ISO)

17beta-estradiol (ISO)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

4,4'-sulfonyldiphenol (ISO)

4-hydroxynon-2-enal (ISO)

aflatoxin B1 (ISO)

all-trans-retinoic acid (ISO)

amiodarone (ISO)

benzo[a]pyrene (ISO)

benzo[a]pyrene diol epoxide I (ISO)

berberine (EXP)

beryllium sulfate (ISO)

bis(2-chloroethyl) sulfide (ISO)

bisphenol A (EXP,ISO)

cadmium atom (ISO)

cadmium dichloride (ISO)

carbon nanotube (ISO)

chlorpyrifos (ISO)

cisplatin (ISO)

coumarin (ISO)

cyclosporin A (ISO)

deferasirox (ISO)

Dibutyl phosphate (ISO)

dimethyl sulfoxide (ISO)

doxorubicin (ISO)

entinostat (ISO)

epoxiconazole (ISO)

fenofibrate (EXP)

folic acid (ISO)

hydrogen peroxide (ISO)

lipopolysaccharide (ISO)

mercury dichloride (ISO)

methylmercury chloride (ISO)

ozone (ISO)

perfluorooctane-1-sulfonic acid (ISO)

phenobarbital (ISO)

phenylephrine (EXP)

pirinixic acid (ISO)

resveratrol (ISO)

streptozocin (EXP)

tetrachloromethane (EXP)

thimerosal (ISO)

thiram (ISO)

titanium dioxide (ISO)

trichostatin A (ISO)

triptonide (ISO)

urethane (ISO)

valproic acid (ISO)

vorinostat (ISO)

zinc atom (ISO)

zinc(0) (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

host-mediated activation of viral transcription (ISO)

positive regulation of transcription by RNA polymerase II (ISO)

positive regulation of transcription elongation by RNA polymerase II (ISO)

regulation of transcription by RNA polymerase II (IEA)

response to xenobiotic stimulus (IEP)

Cellular Component

cyclin/CDK positive transcription elongation factor complex (ISO)

nucleolus (ISO)

nucleoplasm (ISO)

nucleus (ISO)

P-TEFb complex (ISO)

Molecular Function

7SK snRNA binding (ISO)

chromatin binding (ISO)

cyclin-dependent protein serine/threonine kinase activator activity (ISO)

cyclin-dependent protein serine/threonine kinase regulator activity (IEA)

DNA binding (ISO)

DNA-binding transcription factor binding (ISO)

molecular condensate scaffold activity (ISO)

protein binding (ISO)

protein kinase binding (ISO)

RNA polymerase binding (ISO)

snRNA binding (ISO)

transcription cis-regulatory region binding (ISO)

Molecular Pathway Annotations Click to see Annotation Detail View

RNA polymerase II transcription elongation pathway (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.	Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.	Rat ISS GO annotations from GOA human gene data--August 2006	GOA data from the GO Consortium
3.	Control of transcriptional elongation.	Kwak H and Lis JT, Annu Rev Genet. 2013;47:483-508. doi: 10.1146/annurev-genet-110711-155440. Epub 2013 Sep 11.
4.	Rat ISS GO annotations from MGI mouse gene data--August 2006	MGD data from the GO Consortium
5.	ClinVar Automated Import and Annotation Pipeline	RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
6.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
7.	Comprehensive gene review and curation	RGD comprehensive gene curation
8.	Activation of cardiac Cdk9 represses PGC-1 and confers a predisposition to heart failure.	Sano M, etal., EMBO J 2004 Sep 1;23(17):3559-69. Epub 2004 Aug 5.
9.	Protective effect of berberine on antioxidant enzymes and positive transcription elongation factor b expression in diabetic rat liver.	Zhou JY and Zhou SW, Fitoterapia. 2011 Mar;82(2):184-9. doi: 10.1016/j.fitote.2010.08.019. Epub 2010 Sep 7.

Additional References at PubMed

PMID:9499409	PMID:11713533	PMID:12944466	PMID:15563843	PMID:15905409	PMID:16109376	PMID:18662700	PMID:19575011	PMID:20570862	PMID:22547058	PMID:25116364

Genomics

Comparative Map Data

Ccnt1
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	7	131,566,176 - 131,596,988 (-)	NCBI	GRCr8	GRCr8		GRCr8
GRCr8 Ensembl	7	131,566,176 - 131,596,938 (-)	Ensembl				GRCr8
mRatBN7.2	7	129,687,146 - 129,718,080 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	7	129,691,209 - 129,717,871 (-)	Ensembl				mRatBN7.2
UTH_Rnor_SHR_Utx	7	131,499,023 - 131,525,200 (-)	NCBI	UTH_Rnor_SHR_Utx	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	7	133,724,573 - 133,750,750 (-)	NCBI	UTH_Rnor_SHRSP_BbbUtx_1.0	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	7	133,637,075 - 133,663,250 (-)	NCBI	UTH_Rnor_WKY_Bbb_1.0	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	7	140,215,052 - 140,245,958 (-)	NCBI	Rnor_6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	7	140,219,551 - 140,245,723 (-)	Ensembl			rn6	Rnor6.0
Rnor_5.0	X	114,723,098 - 114,752,376 (-)	NCBI	Rnor_5.0	Rnor_5.0	rn5
RGSC_v3.4	7	137,288,635 - 137,314,809 (-)	NCBI	RGSC_v3.4	RGSC_v3.4	rn4
Celera	7	126,182,570 - 126,208,635 (-)	NCBI		Celera
RGSC_v3.1	7	137,365,064 - 137,391,433 (-)	NCBI
Cytogenetic Map	7	q36	NCBI

CCNT1
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	12	48,688,458 - 48,716,707 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	12	48,688,458 - 48,716,998 (-)	Ensembl			hg38	GRCh38
GRCh37	12	49,082,241 - 49,110,490 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	12	47,373,019 - 47,397,048 (-)	NCBI	Build 36	Build 36	hg18	NCBI36
Build 34	12	47,373,018 - 47,397,048	NCBI
Celera	12	47,882,748 - 47,906,759 (-)	NCBI		Celera
Cytogenetic Map	12	q13.11-q13.12	NCBI
HuRef	12	46,116,314 - 46,144,840 (-)	NCBI		HuRef
CHM1_1	12	49,048,056 - 49,076,621 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	12	48,650,484 - 48,678,733 (-)	NCBI		T2T-CHM13v2.0

Ccnt1
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	15	98,436,570 - 98,468,340 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	15	98,436,570 - 98,468,804 (-)	Ensembl		GRCm39 Ensembl		GRCm39
GRCm38	15	98,538,690 - 98,567,736 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	15	98,538,689 - 98,570,923 (-)	Ensembl			mm10	GRCm38
MGSCv37	15	98,373,642 - 98,398,067 (-)	NCBI	MGSCv37	MGSCv37	mm9	NCBIm37
MGSCv36	15	98,371,245 - 98,395,670 (-)	NCBI		MGSCv36	mm8
Celera	15	100,690,667 - 100,714,825 (-)	NCBI		Celera
Cytogenetic Map	15	F1	NCBI
cM Map	15	54.54	NCBI

Ccnt1
(Chinchilla lanigera - long-tailed chinchilla)

Chinchilla Assembly	Chr	Position (strand)	Source	Genome Browsers
Chinchilla Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChiLan1.0 Ensembl	NW_004955500	7,580,625 - 7,606,913 (-)	Ensembl
ChiLan1.0	NW_004955500	7,580,625 - 7,606,913 (-)	NCBI	ChiLan1.0	ChiLan1.0

CCNT1
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	10	45,461,327 - 45,491,682 (+)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	12	45,458,086 - 45,492,618 (+)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	12	40,028,334 - 40,057,393 (+)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	12	40,906,907 - 40,935,392 (+)	NCBI	PanPan1.1	PanPan1.1	panPan2
PanPan1.1 Ensembl	12	40,906,907 - 40,935,392 (+)	Ensembl			panPan2	panpan1.1

CCNT1
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	27	5,788,426 - 5,817,518 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	27	5,788,785 - 5,817,043 (+)	Ensembl			canFam3	CanFam3.1
Dog10K_Boxer_Tasha	27	40,440,318 - 40,469,408 (-)	NCBI	Dog10K_Boxer_Tasha	Dog10K_Boxer_Tasha
ROS_Cfam_1.0	27	5,839,609 - 5,868,796 (+)	NCBI	ROS_Cfam_1.0	ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	27	5,839,914 - 5,868,686 (+)	Ensembl				ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	27	5,803,121 - 5,832,059 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	27	5,793,437 - 5,822,569 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	27	40,832,282 - 40,861,450 (-)	NCBI	UU_Cfam_GSD_1.0	UU_Cfam_GSD_1.0

Ccnt1
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)

Squirrel Assembly	Chr	Position (strand)	Source	Genome Browsers
Squirrel Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HiC_Itri_2	NW_024404945	66,576,723 - 66,597,193 (+)	NCBI		HiC_Itri_2
SpeTri2.0 Ensembl	NW_004936512	6,562,974 - 6,588,409 (-)	Ensembl		SpeTri2.0 Ensembl
SpeTri2.0	NW_004936512	6,567,663 - 6,588,107 (-)	NCBI	SpeTri2.0	SpeTri2.0		SpeTri2.0

CCNT1
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	5	14,768,426 - 14,807,001 (-)	Ensembl			susScr11	Sscrofa11.1
Sscrofa11.1	5	14,768,423 - 14,808,424 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	5	15,062,983 - 15,101,607 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

CCNT1
(Chlorocebus sabaeus - green monkey)

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	11	44,932,774 - 44,966,412 (-)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
ChlSab1.1 Ensembl	11	44,937,350 - 44,966,018 (-)	Ensembl		ChlSab1.1 Ensembl	chlSab2	Vervet-AGM
Vero_WHO_p1.0	NW_023666037	201,181,682 - 201,215,359 (+)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

Ccnt1
(Heterocephalus glaber - naked mole-rat)

Naked Mole-Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Naked Mole-Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HetGla_female_1.0 Ensembl	NW_004624816	3,421,709 - 3,442,170 (+)	Ensembl		HetGla_female_1.0 Ensembl	hetGla2	HetGla_female_1.0 Ensembl
HetGla 1.0	NW_004624816	3,396,740 - 3,445,976 (+)	NCBI	HetGla 1.0	HetGla 1.0	hetGla2

Ccnt1
(Rattus rattus - black rat)

Black Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Black Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Rrattus_CSIRO_v1	1	271,361,109 - 271,388,976 (-)	NCBI		Rrattus_CSIRO_v1

Variants

Variants in Ccnt1
216 total Variants

miRNA Target Status (No longer updated)

Predicted Target Of

	Summary Value
Count of predictions:	16
Count of miRNA genes:	11
Interacting mature miRNAs:	16
Transcripts:	ENSRNOT00000058606
Prediction methods:	Miranda, Pita, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
631529	Tls2	T-lymphoma susceptibility QTL 2	0	0.001	thymus integrity trait (VT:0010555)	percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)	7	82111382	132099989	Rat
1354582	Stl11	Serum triglyceride level QTL 11	3.42		blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	7	121393075	137014596	Rat
731176	Glom5	Glomerulus QTL 5	2.5	0.0035	kidney glomerulus morphology trait (VT:0005325)	count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)	7	98549867	137014596	Rat
1300112	Bp183	Blood pressure QTL 183	3.51		arterial blood pressure trait (VT:2000000)	blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)	7	119280025	135560836	Rat
1331731	Bp216	Blood pressure QTL 216	2.851		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	7	104186212	135371468	Rat
631687	Hcas1	Hepatocarcinoma susceptibility QTL 1	3.9	0.001	liver integrity trait (VT:0010547)	liver tumorous lesion volume to total liver volume ratio (CMO:0001082)	7	93302009	131686183	Rat
1331748	Bp215	Blood pressure QTL 215	4.043		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	7	110725024	135371468	Rat
61428	Scl3	Serum cholesterol level QTL 3	3.2		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	7	100548246	137014596	Rat
61397	Bw17	Body weight QTL 17	6.3		body mass (VT:0001259)	body weight (CMO:0000012)	7	95485047	137014596	Rat
1331746	Kidm9	Kidney mass QTL 9	3.934		kidney mass (VT:0002707)	right kidney wet weight (CMO:0000082)	7	82111245	134948181	Rat
1358914	Bp266	Blood pressure QTL 266			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	7	115313999	136544683	Rat
2299163	Iddm34	Insulin dependent diabetes mellitus QTL 34	2.71		blood glucose amount (VT:0000188)	age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)	7	116269196	132020414	Rat
1549899	Stresp8	Stress response QTL 8	4.37	0.0008	stress-related behavior trait (VT:0010451)	defensive burying duration (CMO:0001961)	7	92362341	137014596	Rat
1358891	Bp265	Blood pressure QTL 265	2.21		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	7	71827901	136544683	Rat

Markers in Region

BE111737

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	7	129,719,208 - 129,719,378 (+)	MAPPER	mRatBN7.2
Rnor_6.0	7	140,247,112 - 140,247,281	NCBI	Rnor6.0
Rnor_5.0	X	114,751,292 - 114,751,461	UniSTS	Rnor5.0
RGSC_v3.4	7	137,316,198 - 137,316,367	UniSTS	RGSC3.4
Celera	7	126,210,024 - 126,210,193	UniSTS
RH 3.4 Map	7	1077.7	UniSTS
Cytogenetic Map	7	q36	UniSTS

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Download All Expressed Objects for this Gene

alimentary part of gastrointestinal system	appendage	circulatory system	ectoderm	endocrine system	endoderm	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	mesenchyme	mesoderm	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	sensory system	visual system
16	11	67	165	91	90	59	92	59	6	355	191	11	144	81	92	31	17	17

Sequence

Nucleotide Sequences


RefSeq Transcripts	NM_001412623	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_063263670	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_063263671	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XR_593621	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC129405	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CH474035	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAXUCZ010000007	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSRNOT00000077672 ⟹ ENSRNOP00000070328

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	7	129,691,209 - 129,717,871 (-)	Ensembl
Rnor_6.0 Ensembl	7	140,154,490 - 140,172,448 (-)	Ensembl

Ensembl Acc Id:

ENSRNOT00000088999 ⟹ ENSRNOP00000073281

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	7	129,691,645 - 129,717,871 (-)	Ensembl
Rnor_6.0 Ensembl	7	140,219,551 - 140,245,723 (-)	Ensembl

Ensembl Acc Id:

ENSRNOT00000110064 ⟹ ENSRNOP00000081516

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8 Ensembl	7	131,578,398 - 131,596,938 (-)	Ensembl
mRatBN7.2 Ensembl	7	129,699,369 - 129,717,871 (-)	Ensembl

Ensembl Acc Id:

ENSRNOT00000129768 ⟹ ENSRNOP00000106394

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8 Ensembl	7	131,566,176 - 131,596,938 (-)	Ensembl

RefSeq Acc Id:

NM_001412623 ⟹ NP_001399552

RefSeq Status:

VALIDATED

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	7	131,566,176 - 131,596,938 (-)	NCBI
mRatBN7.2	7	129,687,146 - 129,717,910 (-)	NCBI

RefSeq Acc Id:

XM_063263670 ⟹ XP_063119740

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	7	131,566,176 - 131,596,717 (-)	NCBI

RefSeq Acc Id:

XM_063263671 ⟹ XP_063119741

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	7	131,566,176 - 131,575,669 (-)	NCBI

RefSeq Acc Id:

XR_593621

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	7	131,571,933 - 131,596,988 (-)	NCBI
mRatBN7.2	7	129,692,904 - 129,718,080 (-)	NCBI
Rnor_6.0	7	140,220,860 - 140,245,885 (-)	NCBI

Sequence:

show sequence

AATCTTCGGCTTCCTGAGCGGAAGTGTGTCACAACCTGGTGGTCGACCCTTGGAGGAAGTTCGT
CACGTCGCAGTTGTCTGGGCCCGGCGGATGTGTGTCGCCGCTTAGGTGACGCTGGGAAGTGCTT
GCAGCCCCCGCCGCTGCCTCTTGGTTGAAGCACTATGGAGGGAGAGAGGAAGAACAACAACAAA
CGGTGGTATTTTACTCGAGAACAACTGGAAAACAGCCCATCGCGTCGTTTTGGCGTGGACTCAG
ATAAAGAACTATCTTATCGCCAGCAGGCGGCCAATCTACTCCAGGACATGGGACAACGTCTTAA
CGTCTCACAACTGACGATCAATACTGCCATAGTATACATGCACCGGTTCTACATGATCCAGTCT
TTTACACAGTTCCATCGATACTCTATGGCTCCAGCGGCCTTGTTTCTAGCAGCAAAAGTAGAAG
AACAACCAAAAAAATTGGAACATGTCATCAAGGTGGCACACACTTGCCTCCATCCACAGGAGTC
GCTTCCTGACACGAGGAGTGAGGCCTACCTACAACAAGTTCAAGATCTGGTGATTTTAGAGAGC
ATAATTTTGCAGACCTTAGGGTTTGAACTTACAATTGATCACCCACACACACATGTGGTAAAGT
GCACCCAACTTGTTCGAGCAAGCAAGGACTTAGCACAGACATCTTACTTCATGGCAACCAACAG
AATTGACACATGAATTTCTACAGATTCTAGAGAAAACACCAAGCAGGCTGAAACGTATTCGGAA
TTGGAGGGCATACCAGGCTGCCATGAAAACCAAACCGGATGACCGGGGAGCGGATGAAAACACA
TCGGAGCAGACGATTCTCAATATGATTTCTCA

hide sequence

Protein Sequences


Protein RefSeqs	NP_001399552	(Get FASTA)	NCBI Sequence Viewer
	XP_063119740	(Get FASTA)	NCBI Sequence Viewer
	XP_063119741	(Get FASTA)	NCBI Sequence Viewer
GenBank Protein	EDL87053	(Get FASTA)	NCBI Sequence Viewer
Ensembl Protein	ENSRNOP00000081516.1
	ENSRNOP00000106394
	ENSRNOP00000106394.1

Ensembl Acc Id:

ENSRNOP00000073281 ⟸ ENSRNOT00000088999

Ensembl Acc Id:

ENSRNOP00000070328 ⟸ ENSRNOT00000077672

Ensembl Acc Id:

ENSRNOP00000081516 ⟸ ENSRNOT00000110064

RefSeq Acc Id:	NP_001399552 ⟸ NM_001412623
- UniProtKB:	A0A0G2JXM2 (UniProtKB/TrEMBL), A6KC89 (UniProtKB/TrEMBL), D3ZC98 (UniProtKB/TrEMBL)

RefSeq Acc Id:	XP_063119740 ⟸ XM_063263670
- Peptide Label:	isoform X1
- UniProtKB:	A6KC89 (UniProtKB/TrEMBL), D3ZC98 (UniProtKB/TrEMBL)

RefSeq Acc Id:	XP_063119741 ⟸ XM_063263671
- Peptide Label:	isoform X2

Ensembl Acc Id:

ENSRNOP00000106394 ⟸ ENSRNOT00000129768

Protein Domains

Cyclin-like

Protein Structures

Name	Modeler	Protein Id	AA Range	Protein Structure
AF-A0A0G2JXM2-F1-model_v2	AlphaFold	A0A0G2JXM2	1-647	view protein structure
AF-D3ZC98-F1-model_v2	AlphaFold	D3ZC98	1-663	view protein structure

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Promoters

RGD ID:

13695624

Promoter ID:

EPDNEW_R6149

Type:

initiation region

Name:

Ccnt1_1

Description:

cyclin T1

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0	7	140,245,761 - 140,245,821	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:1311151	AgrOrtholog
BioCyc Gene	G2FUF-32128	BioCyc
Ensembl Genes	ENSRNOG00000053054	Ensembl, ENTREZGENE, UniProtKB/TrEMBL
	ENSRNOG00000055738	Ensembl
Ensembl Transcript	ENSRNOT00000110064.2	UniProtKB/TrEMBL
	ENSRNOT00000129768	ENTREZGENE
	ENSRNOT00000129768.1	UniProtKB/TrEMBL
Gene3D-CATH	Cyclin-like	UniProtKB/TrEMBL
InterPro	Cyclin-like_sf	UniProtKB/TrEMBL
	Cyclin/Ssn8	UniProtKB/TrEMBL
	Cyclin_N	UniProtKB/TrEMBL
	Cyclin_related	UniProtKB/TrEMBL
NCBI Gene	315291	ENTREZGENE
PANTHER	PTHR10026	UniProtKB/TrEMBL
Pfam	Cyclin_N	UniProtKB/TrEMBL
	CycT2-like_C	UniProtKB/TrEMBL
PhenoGen	Ccnt1	PhenoGen
RatGTEx	ENSRNOG00000053054	RatGTEx
	ENSRNOG00000055738	RatGTEx
SMART	CYCLIN	UniProtKB/TrEMBL
Superfamily-SCOP	Cyclin_like	UniProtKB/TrEMBL
UniProt	A0A0G2JXM2	ENTREZGENE
	A0A8I6G622_RAT	UniProtKB/TrEMBL
	A0ABK0LWR1_RAT	UniProtKB/TrEMBL
	A6KC89	ENTREZGENE, UniProtKB/TrEMBL
	D3ZC98	ENTREZGENE

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2021-03-09	Ccnt1	cyclin T1	LOC103692976	cyclin-T1-like	Data merged from RGD:9297474	737654	PROVISIONAL
2014-08-25	LOC103692976	cyclin-T1-like			Symbol and Name status set to provisional	70820	PROVISIONAL
2008-04-30	Ccnt1	cyclin T1	Ccnt1_predicted	cyclin T1 (predicted)	'predicted' is removed	2292626	APPROVED
2005-01-12	Ccnt1_predicted	cyclin T1 (predicted)			Symbol and Name status set to approved	70820	APPROVED

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

RGD Manual Annotations