Symbol:
Chchd3
Name:
coiled-coil-helix-coiled-coil-helix domain containing 3
RGD ID:
1310325
Description:
Predicted to enable molecular adaptor activity and phosphatase binding activity. Predicted to be involved in cristae formation and mitochondrial fusion. Predicted to be located in mitochondrial inner membrane. Predicted to be part of MICOS complex. Orthologous to human CHCHD3 (coiled-coil-helix-coiled-coil-helix domain containing 3); PARTICIPATES IN mitochondrial protein import pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; acrylamide.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
coiled-coil-helix-coiled-coil-helix domain-containing protein 3, mitochondrial; LOC296966; MICOS complex subunit MIC19
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 62,327,574 - 62,584,085 (-) NCBI GRCr8 mRatBN7.2 4 61,360,352 - 61,616,850 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 61,360,353 - 61,616,847 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 66,339,067 - 66,595,541 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 62,254,817 - 62,511,283 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 60,657,202 - 60,913,660 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 60,080,536 - 60,358,592 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 60,080,538 - 60,358,562 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 59,822,342 - 60,099,177 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 59,891,615 - 60,170,903 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 60,167,728 - 60,453,221 (-) NCBI Celera 4 56,445,848 - 56,700,814 (-) NCBI Celera Cytogenetic Map 4 q22 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Chchd3 Rat 1,2-dichloroethane increases expression ISO Chchd3 (Mus musculus) 6480464 ethylene dichloride results in increased expression of CHCHD3 mRNA CTD PMID:28960355 Chchd3 Rat 1,2-dimethylhydrazine multiple interactions ISO Chchd3 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of CHCHD3 mRNA CTD PMID:22206623 Chchd3 Rat 1,2-dimethylhydrazine decreases expression ISO Chchd3 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of CHCHD3 mRNA CTD PMID:22206623 Chchd3 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of CHCHD3 mRNA CTD PMID:33387578 Chchd3 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of CHCHD3 mRNA CTD PMID:21346803 Chchd3 Rat 2-methylcholine affects expression ISO CHCHD3 (Homo sapiens) 6480464 beta-methylcholine affects the expression of CHCHD3 mRNA CTD PMID:21179406 Chchd3 Rat 4,4'-sulfonyldiphenol increases expression ISO Chchd3 (Mus musculus) 6480464 bisphenol S results in increased expression of CHCHD3 mRNA CTD PMID:39298647 Chchd3 Rat 4,4'-sulfonyldiphenol increases expression ISO CHCHD3 (Homo sapiens) 6480464 bisphenol S results in increased expression of CHCHD3 protein CTD PMID:34186270 Chchd3 Rat 4,4'-sulfonyldiphenol affects expression ISO CHCHD3 (Homo sapiens) 6480464 bisphenol S affects the expression of CHCHD3 protein CTD PMID:31945527 Chchd3 Rat 5-aza-2'-deoxycytidine affects expression ISO CHCHD3 (Homo sapiens) 6480464 Decitabine affects the expression of CHCHD3 mRNA CTD PMID:23300844 Chchd3 Rat acrolein multiple interactions ISO CHCHD3 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of CHCHD3 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of CHCHD3 mRNA CTD PMID:32699268 Chchd3 Rat acrylamide increases expression EXP 6480464 Acrylamide results in increased expression of CHCHD3 mRNA CTD PMID:28959563 Chchd3 Rat aflatoxin B1 decreases expression ISO Chchd3 (Mus musculus) 6480464 Aflatoxin B1 results in decreased expression of CHCHD3 mRNA CTD PMID:19770486 Chchd3 Rat all-trans-retinoic acid decreases expression ISO CHCHD3 (Homo sapiens) 6480464 Tretinoin results in decreased expression of CHCHD3 mRNA CTD PMID:33167477 Chchd3 Rat alpha-pinene multiple interactions ISO CHCHD3 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of CHCHD3 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of CHCHD3 mRNA CTD PMID:32699268 Chchd3 Rat antirheumatic drug increases expression ISO CHCHD3 (Homo sapiens) 6480464 Antirheumatic Agents results in increased expression of CHCHD3 mRNA CTD PMID:24449571 Chchd3 Rat arsane multiple interactions ISO CHCHD3 (Homo sapiens) 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in increased expression of CHCHD3 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of CHCHD3 mRNA CTD PMID:32525701 and PMID:39836092 Chchd3 Rat arsenic atom multiple interactions ISO CHCHD3 (Homo sapiens) 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in increased expression of CHCHD3 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of CHCHD3 mRNA CTD PMID:32525701 and PMID:39836092 Chchd3 Rat arsenite(3-) multiple interactions ISO CHCHD3 (Homo sapiens) 6480464 arsenite promotes the reaction [G3BP1 protein binds to CHCHD3 mRNA] CTD PMID:32406909 Chchd3 Rat atrazine decreases expression ISO CHCHD3 (Homo sapiens) 6480464 Atrazine results in decreased expression of CHCHD3 mRNA CTD PMID:22378314 Chchd3 Rat benzo[a]pyrene decreases expression ISO Chchd3 (Mus musculus) 6480464 Benzo(a)pyrene results in decreased expression of CHCHD3 mRNA CTD PMID:21715664 Chchd3 Rat benzo[a]pyrene increases methylation ISO Chchd3 (Mus musculus) 6480464 Benzo(a)pyrene results in increased methylation of CHCHD3 intron CTD PMID:27901495 Chchd3 Rat benzo[a]pyrene decreases expression ISO CHCHD3 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of CHCHD3 mRNA CTD PMID:20064835 more ... Chchd3 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of CHCHD3 mRNA CTD PMID:25181051 Chchd3 Rat bisphenol A increases expression ISO CHCHD3 (Homo sapiens) 6480464 bisphenol A results in increased expression of CHCHD3 protein CTD PMID:37567409 Chchd3 Rat bisphenol A decreases expression ISO CHCHD3 (Homo sapiens) 6480464 bisphenol A results in decreased expression of CHCHD3 protein CTD PMID:34186270 Chchd3 Rat bisphenol A increases methylation ISO CHCHD3 (Homo sapiens) 6480464 bisphenol A results in increased methylation of CHCHD3 gene CTD PMID:31601247 Chchd3 Rat bisphenol A decreases expression ISO Chchd3 (Mus musculus) 6480464 bisphenol A results in decreased expression of CHCHD3 mRNA CTD PMID:33221593 Chchd3 Rat bisphenol AF increases expression ISO CHCHD3 (Homo sapiens) 6480464 bisphenol AF results in increased expression of CHCHD3 protein CTD PMID:34186270 Chchd3 Rat Bisphenol B increases expression ISO CHCHD3 (Homo sapiens) 6480464 bisphenol B results in increased expression of CHCHD3 protein CTD PMID:34186270 Chchd3 Rat bisphenol F increases expression ISO CHCHD3 (Homo sapiens) 6480464 bisphenol F results in increased expression of CHCHD3 protein CTD PMID:34186270 Chchd3 Rat cisplatin decreases expression ISO CHCHD3 (Homo sapiens) 6480464 Cisplatin results in decreased expression of CHCHD3 mRNA CTD PMID:19561079 more ... Chchd3 Rat cisplatin affects expression ISO CHCHD3 (Homo sapiens) 6480464 Cisplatin affects the expression of CHCHD3 mRNA CTD PMID:23300844 Chchd3 Rat cisplatin decreases expression ISO Chchd3 (Mus musculus) 6480464 Cisplatin results in decreased expression of CHCHD3 mRNA CTD PMID:24280081 Chchd3 Rat clofibrate multiple interactions ISO Chchd3 (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of CHCHD3 mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of CHCHD3 mRNA] CTD PMID:17585979 Chchd3 Rat clofibric acid multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of CHCHD3 mRNA CTD PMID:17602206 Chchd3 Rat coumarin increases phosphorylation ISO CHCHD3 (Homo sapiens) 6480464 coumarin results in increased phosphorylation of CHCHD3 protein CTD PMID:35688186 Chchd3 Rat cyclosporin A increases expression ISO CHCHD3 (Homo sapiens) 6480464 Cyclosporine results in increased expression of CHCHD3 mRNA CTD PMID:20106945 Chchd3 Rat Dibutyl phosphate affects expression ISO CHCHD3 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of CHCHD3 mRNA CTD PMID:37042841 Chchd3 Rat dibutyl phthalate decreases expression ISO Chchd3 (Mus musculus) 6480464 Dibutyl Phthalate results in decreased expression of CHCHD3 mRNA CTD PMID:21266533 Chchd3 Rat doxorubicin decreases expression ISO CHCHD3 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of CHCHD3 mRNA CTD PMID:29803840 Chchd3 Rat enzyme inhibitor multiple interactions ISO CHCHD3 (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of CHCHD3 protein CTD PMID:23301498 Chchd3 Rat finasteride increases expression EXP 6480464 Finasteride results in increased expression of CHCHD3 mRNA CTD PMID:24136188 Chchd3 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of CHCHD3 mRNA CTD PMID:24136188 Chchd3 Rat folic acid multiple interactions ISO Chchd3 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of CHCHD3 mRNA CTD PMID:22206623 Chchd3 Rat folic acid decreases expression ISO Chchd3 (Mus musculus) 6480464 Folic Acid results in decreased expression of CHCHD3 mRNA CTD PMID:25629700 Chchd3 Rat FR900359 increases phosphorylation ISO CHCHD3 (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of CHCHD3 protein CTD PMID:37730182 Chchd3 Rat hexadecanoic acid increases phosphorylation ISO CHCHD3 (Homo sapiens) 6480464 Palmitic Acid results in increased phosphorylation of CHCHD3 protein CTD PMID:28073184 Chchd3 Rat hydroxyurea decreases expression ISO Chchd3 (Mus musculus) 6480464 Hydroxyurea results in decreased expression of CHCHD3 mRNA CTD PMID:12929121 Chchd3 Rat ivermectin decreases expression ISO CHCHD3 (Homo sapiens) 6480464 Ivermectin results in decreased expression of CHCHD3 protein CTD PMID:32959892 Chchd3 Rat leflunomide increases expression EXP 6480464 leflunomide results in increased expression of CHCHD3 mRNA CTD PMID:24136188 Chchd3 Rat methidathion increases expression ISO Chchd3 (Mus musculus) 6480464 methidathion results in increased expression of CHCHD3 mRNA CTD PMID:34813904 Chchd3 Rat N-nitrosodiethylamine multiple interactions EXP 6480464 [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of CHCHD3 mRNA CTD PMID:17602206 Chchd3 Rat okadaic acid decreases expression ISO CHCHD3 (Homo sapiens) 6480464 Okadaic Acid results in decreased expression of CHCHD3 protein CTD PMID:19397276 Chchd3 Rat oxaliplatin multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in decreased expression of CHCHD3 mRNA CTD PMID:25729387 Chchd3 Rat ozone multiple interactions ISO CHCHD3 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of CHCHD3 mRNA more ... CTD PMID:32699268 Chchd3 Rat p-anisidine decreases expression ISO Chchd3 (Mus musculus) 6480464 4-anisidine results in decreased expression of CHCHD3 mRNA CTD PMID:12929121 Chchd3 Rat paclitaxel decreases expression ISO Chchd3 (Mus musculus) 6480464 Paclitaxel results in decreased expression of CHCHD3 mRNA CTD PMID:12929121 Chchd3 Rat paracetamol multiple interactions ISO Chchd3 (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of CHCHD3 mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of CHCHD3 mRNA] CTD PMID:17585979 Chchd3 Rat paracetamol affects expression ISO Chchd3 (Mus musculus) 6480464 Acetaminophen affects the expression of CHCHD3 mRNA CTD PMID:17562736 Chchd3 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Chchd3 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Pectins] results in increased expression of CHCHD3 mRNA CTD PMID:36331819 Chchd3 Rat pirinixic acid increases expression ISO Chchd3 (Mus musculus) 6480464 pirinixic acid results in increased expression of CHCHD3 mRNA CTD PMID:18301758 Chchd3 Rat resveratrol increases expression ISO Chchd3 (Mus musculus) 6480464 resveratrol results in increased expression of CHCHD3 protein CTD PMID:25505154 Chchd3 Rat sodium arsenate multiple interactions ISO CHCHD3 (Homo sapiens) 6480464 [sodium arsenate results in increased abundance of Arsenic] which results in increased expression of CHCHD3 mRNA CTD PMID:32525701 Chchd3 Rat sodium arsenite multiple interactions ISO CHCHD3 (Homo sapiens) 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of CHCHD3 mRNA and sodium arsenite promotes the reaction [CHCHD3 protein binds to CAPRIN1 protein] CTD PMID:33939924 and PMID:39836092 Chchd3 Rat sodium dichromate decreases expression ISO CHCHD3 (Homo sapiens) 6480464 sodium bichromate results in decreased expression of CHCHD3 mRNA CTD PMID:17685462 Chchd3 Rat sulindac decreases expression EXP 6480464 Sulindac results in decreased expression of CHCHD3 mRNA CTD PMID:24136188 Chchd3 Rat temozolomide decreases expression ISO CHCHD3 (Homo sapiens) 6480464 Temozolomide results in decreased expression of CHCHD3 mRNA CTD PMID:31758290 Chchd3 Rat titanium dioxide decreases methylation ISO Chchd3 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of CHCHD3 gene CTD PMID:35295148 Chchd3 Rat topotecan multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in decreased expression of CHCHD3 mRNA CTD PMID:25729387 Chchd3 Rat trimellitic anhydride increases expression ISO Chchd3 (Mus musculus) 6480464 trimellitic anhydride results in increased expression of CHCHD3 mRNA CTD PMID:19042947 Chchd3 Rat Triptolide increases expression EXP 6480464 triptolide results in increased expression of CHCHD3 protein CTD PMID:32519852 Chchd3 Rat triptonide increases expression ISO Chchd3 (Mus musculus) 6480464 triptonide results in increased expression of CHCHD3 mRNA CTD PMID:33045310 Chchd3 Rat valproic acid increases expression ISO CHCHD3 (Homo sapiens) 6480464 Valproic Acid results in increased expression of CHCHD3 mRNA CTD PMID:23179753 and PMID:29154799 Chchd3 Rat valproic acid affects expression ISO CHCHD3 (Homo sapiens) 6480464 Valproic Acid affects the expression of CHCHD3 mRNA CTD PMID:25979313 Chchd3 Rat zearalenone increases expression ISO Chchd3 (Mus musculus) 6480464 Zearalenone results in increased expression of CHCHD3 protein CTD PMID:25058043
Chchd3 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 62,327,574 - 62,584,085 (-) NCBI GRCr8 mRatBN7.2 4 61,360,352 - 61,616,850 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 61,360,353 - 61,616,847 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 66,339,067 - 66,595,541 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 62,254,817 - 62,511,283 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 60,657,202 - 60,913,660 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 60,080,536 - 60,358,592 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 60,080,538 - 60,358,562 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 59,822,342 - 60,099,177 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 59,891,615 - 60,170,903 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 60,167,728 - 60,453,221 (-) NCBI Celera 4 56,445,848 - 56,700,814 (-) NCBI Celera Cytogenetic Map 4 q22 NCBI
CHCHD3 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 7 132,784,870 - 133,082,090 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 7 132,784,870 - 133,082,090 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 7 132,469,631 - 132,766,850 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 7 132,120,163 - 132,417,373 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 7 131,926,878 - 132,224,083 NCBI Celera 7 127,221,897 - 127,518,382 (-) NCBI Celera Cytogenetic Map 7 q32.3-q33 NCBI HuRef 7 126,786,105 - 127,082,694 (-) NCBI HuRef CHM1_1 7 132,405,107 - 132,701,867 (-) NCBI CHM1_1 T2T-CHM13v2.0 7 134,106,386 - 134,403,617 (-) NCBI T2T-CHM13v2.0 CRA_TCAGchr7v2 7 131,809,095 - 132,106,393 (-) NCBI
Chchd3 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 32,769,142 - 33,037,206 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 32,767,911 - 33,037,195 (-) Ensembl GRCm39 Ensembl GRCm38 6 32,792,207 - 33,060,273 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 32,790,976 - 33,060,260 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 32,742,227 - 33,010,152 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 32,722,385 - 32,990,310 (-) NCBI MGSCv36 mm8 Celera 6 32,774,244 - 33,045,665 (-) NCBI Celera Cytogenetic Map 6 A3.3 NCBI cM Map 6 13.97 NCBI
Chchd3 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955410 34,818,649 - 35,093,398 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955410 34,818,660 - 35,093,398 (+) NCBI ChiLan1.0 ChiLan1.0
CHCHD3 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 6 169,616,069 - 169,914,545 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 7 21,626,315 - 21,924,770 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 7 124,758,547 - 125,056,898 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 7 137,268,178 - 137,566,431 (-) NCBI panpan1.1 PanPan1.1 panPan2
CHCHD3 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 14 4,229,860 - 4,507,987 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 14 4,229,870 - 4,612,884 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 14 3,891,447 - 4,169,469 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 14 3,967,947 - 4,245,811 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 14 3,967,948 - 4,275,036 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 14 4,170,426 - 4,448,557 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 14 3,916,616 - 4,194,720 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 14 4,057,569 - 4,335,764 (+) NCBI UU_Cfam_GSD_1.0
Chchd3 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405118 22,433,794 - 22,707,772 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936579 2,566,330 - 2,840,870 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936579 2,566,353 - 2,840,364 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
CHCHD3 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 18 16,052,627 - 16,350,974 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 18 16,052,611 - 16,348,998 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 18 17,408,462 - 17,410,929 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3 Sscrofa10.2 18 17,086,333 - 17,353,549 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
CHCHD3
Chchd3
.
Predicted Target Of
Count of predictions: 220 Count of miRNA genes: 143 Interacting mature miRNAs: 171 Transcripts: ENSRNOT00000018001 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
5685012 Bmd87 Bone mineral density QTL 87 5.1 tibia mineral mass (VT:1000283) bone mineral content (CMO:0001554) 4 56647776 78882945 Rat 1358352 Srcrt3 Stress Responsive Cort QTL 3 2.29 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 38465774 146803430 Rat 61445 Strs3 Sensitivity to stroke QTL 3 3 cerebrum integrity trait (VT:0010549) post-insult time to onset of cerebrovascular lesion (CMO:0002343) 4 40433388 85433388 Rat 6893678 Bw108 Body weight QTL 108 2.6 0.006 body mass (VT:0001259) body weight (CMO:0000012) 4 43457976 88457976 Rat 5685009 Bmd86 Bone mineral density QTL 86 3.7 tibia mineral mass (VT:1000283) bone mineral density (CMO:0001226) 4 56647776 78882945 Rat 10755501 Bp390 Blood pressure QTL 390 2.5 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 4 26775591 168368347 Rat 1331807 Rf31 Renal function QTL 31 2.988 urine potassium amount (VT:0010539) urine potassium level (CMO:0000128) 4 39524264 74726312 Rat 8552782 Vie1 Viral induced encephalitis QTL 1 26.4 brain integrity trait (VT:0010579) encephalitis incidence/prevalence measurement (CMO:0002361) 4 34430484 82490359 Rat 634311 Sach7 Saccharin preference QTL 7 taste sensitivity trait (VT:0001986) saccharin intake volume to total fluid intake volume ratio (CMO:0001601) 4 57114432 81266970 Rat 1358363 Sradr3 Stress Responsive Adrenal Weight QTL 3 6.19 adrenal gland mass (VT:0010420) both adrenal glands wet weight (CMO:0000164) 4 57486946 102486946 Rat 738009 Sach4 Saccharine consumption QTL 4 4.9 0.000016 consumption behavior trait (VT:0002069) saccharin intake volume to total fluid intake volume ratio (CMO:0001601) 4 59948935 154902892 Rat 631261 Tcas3 Tongue tumor susceptibility QTL 3 6.88 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 4 10814170 91360527 Rat 2312567 Glom19 Glomerulus QTL 19 1.9 0.006 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 4 45456990 146803430 Rat 61336 Bp21 Blood pressure QTL 21 4.6 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 57114705 78881294 Rat 2313401 Anxrr27 Anxiety related response QTL 27 aggression-related behavior trait (VT:0015014) tameness/aggressiveness composite score (CMO:0002136) 4 17933508 62933508 Rat 8655961 Kidm43 Kidney mass QTL 43 18 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 4 36303261 103194984 Rat 1354612 Foco1 Food consumption QTL 1 8.87 eating behavior trait (VT:0001431) food intake rate (CMO:0000427) 4 44463908 148090542 Rat 6909128 Pancm4 Pancreatic morphology QTL 4 11.35 pancreas mass (VT:0010144) pancreas wet weight (CMO:0000626) 4 26907285 75585128 Rat 2303168 Bp330 Blood pressure QTL 330 4.25 0.017 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 5214602 146446691 Rat 8552801 Bw143 Body weight QTL 143 7.3 body mass (VT:0001259) change in body weight to body weight ratio (CMO:0002216) 4 34430484 82490359 Rat 61475 Aia2 Adjuvant induced arthritis QTL 2 5.8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 39505275 73892441 Rat 8694439 Bw168 Body weight QTL 168 9.57 0.001 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 4 40433414 85433414 Rat 61412 Pia2 Pristane induced arthritis QTL 2 3.9 joint integrity trait (VT:0010548) post-insult time to onset of experimental arthritis (CMO:0001450) 4 21333343 62278020 Rat 738031 Alc14 Alcohol consumption QTL 14 7.6 0.00003 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 8655906 Rf60 Renal function QTL 60 3.8 blood creatinine amount (VT:0005328) creatinine clearance (CMO:0000765) 4 29494195 81006281 Rat 619616 Bp79 Blood pressure QTL 79 0.0292 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 5214602 78882945 Rat 1576305 Emca6 Estrogen-induced mammary cancer QTL 6 5.8 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 4 44463720 155883716 Rat 7387227 Uae40 Urinary albumin excretion QTL 40 2.9 0.0052 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 4 17946999 62946999 Rat 6909122 Insul22 Insulin level QTL 22 4.63 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 4 26907285 75585128 Rat 8552809 Vie5 Viral induced encephalitis QTL 5 25.3 brain integrity trait (VT:0010579) encephalitis incidence/prevalence measurement (CMO:0002361) 4 34430484 82490359 Rat 738016 Alc16 Alcohol consumption QTL 16 3.6 0.00015 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1558651 Swd3 Spike wave discharge measurement QTL 3 4.62 0.000024 brain electrophysiology trait (VT:0010557) brain spike-and-wave discharge frequency (CMO:0001742) 4 58432133 92991462 Rat 1358203 Stl19 Serum triglyceride level QTL 19 2.8 0.002 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 4 5218294 65958103 Rat 1354660 Salc1 Saline consumption QTL 1 11.26 drinking behavior trait (VT:0001422) saline drink intake rate (CMO:0001627) 4 44463908 148090542 Rat 1641833 Alc21 Alcohol consumption QTL 21 8.6 0.0001 drinking behavior trait (VT:0001422) ethanol drink intake rate (CMO:0001407) 4 56698790 126192555 Rat 2300179 Bmd50 Bone mineral density QTL 50 5.9 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 4 60928534 105928534 Rat 1298082 Stresp4 Stress response QTL 4 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 4 50119848 146803430 Rat 631546 Bp86 Blood pressure QTL 86 3.2 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 57114432 91360801 Rat 1300139 Hrtrt6 Heart rate QTL 6 2.85 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 39524264 116179656 Rat 70200 Alc18 Alcohol consumption QTL 18 9.2 drinking behavior trait (VT:0001422) ethanol intake volume to total fluid intake volume ratio (CMO:0001591) 4 56647873 149491524 Rat 1578657 Bss12 Bone structure and strength QTL 12 8.9 femur morphology trait (VT:0000559) femoral neck cross-sectional area (CMO:0001697) 4 60220938 105220938 Rat 1578658 Bss13 Bone structure and strength QTL 13 8 femur strength trait (VT:0010010) femoral neck polar moment of inertia (CMO:0001670) 4 60220938 105220938 Rat 12798520 Anxrr55 Anxiety related response QTL 55 4.45 0.01 locomotor behavior trait (VT:0001392) number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715) 4 32583980 114627242 Rat 4889969 Bss96 Bone structure and strength QTL 96 4.9 tibia size trait (VT:0100001) tibia cortical bone volume (CMO:0001725) 4 56647776 78882945 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 4889972 Bss97 Bone structure and strength QTL 97 5.6 tibia size trait (VT:0100001) tibia total bone volume (CMO:0001724) 4 56647776 78882945 Rat 631671 Iddm11 Insulin dependent diabetes mellitus QTL 11 3.6 0.0012 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 4 58635877 78886137 Rat
BF388181
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 61,606,246 - 61,606,453 (+) MAPPER mRatBN7.2 Rnor_6.0 4 60,347,988 - 60,348,194 NCBI Rnor6.0 Rnor_5.0 4 60,088,603 - 60,088,809 UniSTS Rnor5.0 RGSC_v3.4 4 60,160,356 - 60,160,562 UniSTS RGSC3.4 Celera 4 56,690,237 - 56,690,443 UniSTS RH 3.4 Map 4 366.6 UniSTS Cytogenetic Map 4 q22 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000018001 ⟹ ENSRNOP00000018001
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 61,360,353 - 61,616,826 (-) Ensembl Rnor_6.0 Ensembl 4 60,080,538 - 60,358,562 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000095741 ⟹ ENSRNOP00000085835
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 61,360,760 - 61,616,847 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000107504 ⟹ ENSRNOP00000093797
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 61,369,890 - 61,616,834 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000107634 ⟹ ENSRNOP00000092148
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 61,360,365 - 61,616,804 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000117489 ⟹ ENSRNOP00000081053
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 61,360,780 - 61,616,826 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000119480 ⟹ ENSRNOP00000077614
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 61,428,283 - 61,616,826 (-) Ensembl
RefSeq Acc Id:
NM_001106588 ⟹ NP_001100058
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 62,327,576 - 62,584,033 (-) NCBI mRatBN7.2 4 61,360,354 - 61,616,821 (-) NCBI Rnor_6.0 4 60,080,538 - 60,358,562 (-) NCBI Rnor_5.0 4 59,822,342 - 60,099,177 (-) NCBI RGSC_v3.4 4 59,891,615 - 60,170,903 (-) RGD Celera 4 56,445,848 - 56,700,814 (-) RGD
Sequence:
CGGCGCCTTCTCCTTGCTCTTTGGGGTCGTGGCCTTGCTCCTACCCGGCAAGGGAAGCGTCCTGGGCTTTCACGCGCAAGTGTGCGCGTGGGTCCTGACGTGCTCGTAGGTCCACGCTCAGGTCCACG
hide sequence
RefSeq Acc Id:
XM_017592525 ⟹ XP_017448014
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 62,327,574 - 62,584,085 (-) NCBI mRatBN7.2 4 61,360,352 - 61,616,850 (-) NCBI Rnor_6.0 4 60,080,536 - 60,358,592 (-) NCBI
Sequence:
ACGTGACCGGAGGAGGCGGGCTTTTGGGACCGGCGCCTTCTCCTTGCTCTTTGGGGTCGTGGCCTTGCTCCTACCCGGCAAGGGAAGCGTCCTGGGCTTTCACGCGCAAGTGTGCGCGTGGGTCCTGA
hide sequence
RefSeq Acc Id:
XM_017592526 ⟹ XP_017448015
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 62,327,574 - 62,584,085 (-) NCBI mRatBN7.2 4 61,360,352 - 61,616,850 (-) NCBI Rnor_6.0 4 60,080,536 - 60,358,592 (-) NCBI
Sequence:
ACGTGACCGGAGGAGGCGGGCTTTTGGGACCGGCGCCTTCTCCTTGCTCTTTGGGGTCGTGGCC
hide sequence
RefSeq Acc Id:
XM_039107283 ⟹ XP_038963211
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 62,327,574 - 62,431,346 (-) NCBI mRatBN7.2 4 61,360,352 - 61,464,116 (-) NCBI
RefSeq Acc Id:
NP_001100058 ⟸ NM_001106588
- UniProtKB:
D3ZUX5 (UniProtKB/TrEMBL), A6IEK5 (UniProtKB/TrEMBL)
- Sequence:
MGGTASTRRVTFEADENENITVVKGIRLSENVIDRMKESSPSGSKSQRYSSVYGASVSDEELKRRVAEELALEQAKMESENQRRLKHARDLEREKAVANEQLTRAILQERISSEENRTKVKHLARQLE
hide sequence
RefSeq Acc Id:
XP_017448015 ⟸ XM_017592526
- Peptide Label:
isoform X2
- UniProtKB:
D3ZUX5 (UniProtKB/TrEMBL)
- Sequence:
MGGTASTRRVTFEADENENITVVKGIRLSENVIDRMKESSPSGSKSQRYSSVYGASVSDEELKRRVAEELALEQAKMESENQRRLKHARDLEREKAVANEQLTRAILQERISSEENRTKVKHLSSEFY
hide sequence
RefSeq Acc Id:
XP_017448014 ⟸ XM_017592525
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I6AD55 (UniProtKB/TrEMBL), D3ZUX5 (UniProtKB/TrEMBL)
- Sequence:
MGGTASTRRVTFEADENENITVVKGIRLSENVIDRMKESSPSGSKSQRYSSVYGASVSDEELKRRVAEELALEQAKMESENQRRLKHARDLEREKAVANEQLTRAILQERISSEENRTKVKHLDIEDK
hide sequence
Ensembl Acc Id:
ENSRNOP00000018001 ⟸ ENSRNOT00000018001
RefSeq Acc Id:
XP_038963211 ⟸ XM_039107283
- Peptide Label:
isoform X3
Ensembl Acc Id:
ENSRNOP00000081053 ⟸ ENSRNOT00000117489
Ensembl Acc Id:
ENSRNOP00000077614 ⟸ ENSRNOT00000119480
Ensembl Acc Id:
ENSRNOP00000092148 ⟸ ENSRNOT00000107634
Ensembl Acc Id:
ENSRNOP00000093797 ⟸ ENSRNOT00000107504
Ensembl Acc Id:
ENSRNOP00000085835 ⟸ ENSRNOT00000095741
RGD ID: 13692947 Promoter ID: EPDNEW_R3472 Type: initiation region Name: Chchd3_1 Description: coiled-coil-helix-coiled-coil-helix domain containing 3 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 4 60,358,544 - 60,358,604 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-04-30
Chchd3
coiled-coil-helix-coiled-coil-helix domain containing 3
Chchd3_predicted
coiled-coil-helix-coiled-coil-helix domain containing 3 (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Chchd3_predicted
coiled-coil-helix-coiled-coil-helix domain containing 3 (predicted)
Symbol and Name status set to approved
70820 APPROVED
