Symbol:
Dnali1
Name:
dynein, axonemal, light intermediate chain 1
RGD ID:
1309260
Description:
Predicted to enable dynein heavy chain binding activity. Predicted to be involved in sperm flagellum assembly. Predicted to be located in several cellular components, including dynein axonemal particle; mitotic spindle; and sperm flagellum. Predicted to be part of dynein complex. Predicted to be active in axoneme and ciliary base. Human ortholog(s) of this gene implicated in spermatogenic failure 83. Orthologous to human DNALI1 (dynein axonemal light intermediate chain 1); PARTICIPATES IN Huntington's disease pathway; INTERACTS WITH 2,2',4,4'-Tetrabromodiphenyl ether; 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
axonemal dynein light intermediate polypeptide 1; dynein, axonemal, light intermediate polypeptide 1; inner dynein arm light chain, axonemal; LOC298524; MGC116176
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
DNALI1 (dynein axonemal light intermediate chain 1) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Dnali1 (dynein, axonemal, light intermediate polypeptide 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Dnali1 (dynein axonemal light intermediate chain 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
DNALI1 (dynein axonemal light intermediate chain 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
DNALI1 (dynein axonemal light intermediate chain 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Dnali1 (dynein axonemal light intermediate chain 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
DNALI1 (dynein axonemal light intermediate chain 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
DNALI1 (dynein axonemal light intermediate chain 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Dnali1 (dynein axonemal light intermediate chain 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
DNALI1 (dynein axonemal light intermediate chain 1)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Dnali1 (dynein, axonemal, light intermediate polypeptide 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
dnali1 (dynein, axonemal, light intermediate chain 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
CG6971
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
dyla-1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
dnali1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 5 142,603,132 - 142,611,970 (-) NCBI GRCr8 mRatBN7.2 5 137,318,475 - 137,327,313 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 5 137,318,477 - 137,327,336 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 5 140,022,611 - 140,031,455 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 5 141,792,629 - 141,801,473 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 5 141,799,795 - 141,808,639 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 5 143,053,365 - 143,062,203 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 5 143,053,367 - 143,062,226 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 5 146,821,949 - 146,830,787 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 5 144,399,182 - 144,408,020 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 5 144,410,295 - 144,418,035 (-) NCBI Celera 5 135,836,681 - 135,845,519 (-) NCBI Celera Cytogenetic Map 5 q36 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Dnali1 Rat 17beta-estradiol multiple interactions ISO DNALI1 (Homo sapiens) 6480464 [Estradiol co-treated with TGFB1 protein] results in decreased expression of DNALI1 mRNA CTD PMID:30165855 Dnali1 Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression EXP 6480464 2 more ... CTD PMID:27291303 Dnali1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of DNALI1 mRNA CTD PMID:32109520 Dnali1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of DNALI1 mRNA CTD PMID:33387578 Dnali1 Rat 4,4'-sulfonyldiphenol increases expression ISO Dnali1 (Mus musculus) 6480464 bisphenol S results in increased expression of DNALI1 mRNA CTD PMID:30951980 Dnali1 Rat 4-hydroxyphenyl retinamide increases expression ISO Dnali1 (Mus musculus) 6480464 Fenretinide results in increased expression of DNALI1 mRNA CTD PMID:28973697 Dnali1 Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of DNALI1 mRNA CTD PMID:22504374 and PMID:24780913 Dnali1 Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of DNALI1 mRNA CTD PMID:25825206 Dnali1 Rat acrylamide decreases expression ISO Dnali1 (Mus musculus) 6480464 Acrylamide results in decreased expression of DNALI1 mRNA CTD PMID:35032568 Dnali1 Rat aristolochic acid A increases expression ISO DNALI1 (Homo sapiens) 6480464 aristolochic acid I results in increased expression of DNALI1 mRNA CTD PMID:33212167 Dnali1 Rat benzo[a]pyrene multiple interactions ISO Dnali1 (Mus musculus) 6480464 Benzo(a)pyrene promotes the reaction [AHR protein binds to DNALI1 promoter] CTD PMID:19654925 Dnali1 Rat benzo[a]pyrene increases expression ISO DNALI1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of DNALI1 mRNA CTD PMID:32234424 Dnali1 Rat benzo[a]pyrene affects methylation ISO DNALI1 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of DNALI1 exon and Benzo(a)pyrene affects the methylation of DNALI1 promoter CTD PMID:27901495 and PMID:30157460 Dnali1 Rat benzo[a]pyrene increases methylation ISO DNALI1 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of DNALI1 5' UTR and Benzo(a)pyrene results in increased methylation of DNALI1 exon CTD PMID:27901495 Dnali1 Rat benzo[a]pyrene decreases expression ISO Dnali1 (Mus musculus) 6480464 Benzo(a)pyrene results in decreased expression of DNALI1 mRNA CTD PMID:22228805 Dnali1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of DNALI1 mRNA CTD PMID:29097150 more ... Dnali1 Rat bisphenol A increases methylation ISO DNALI1 (Homo sapiens) 6480464 bisphenol A results in increased methylation of DNALI1 gene CTD PMID:31601247 Dnali1 Rat bisphenol A increases expression ISO Dnali1 (Mus musculus) 6480464 bisphenol A results in increased expression of DNALI1 mRNA CTD PMID:30951980 Dnali1 Rat bisphenol A affects methylation EXP 6480464 bisphenol A affects the methylation of DNALI1 promoter CTD PMID:27415467 Dnali1 Rat bisphenol F increases expression ISO Dnali1 (Mus musculus) 6480464 bisphenol F results in increased expression of DNALI1 mRNA CTD PMID:30951980 Dnali1 Rat bisphenol F decreases expression ISO Dnali1 (Mus musculus) 6480464 bisphenol F results in decreased expression of DNALI1 mRNA CTD PMID:38685157 Dnali1 Rat cadmium atom decreases expression ISO DNALI1 (Homo sapiens) 6480464 Cadmium results in decreased expression of DNALI1 mRNA CTD PMID:21120746 Dnali1 Rat carbon nanotube decreases expression ISO Dnali1 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Dnali1 Rat CGP 52608 multiple interactions ISO DNALI1 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to DNALI1 gene] CTD PMID:28238834 Dnali1 Rat chloroprene increases expression ISO Dnali1 (Mus musculus) 6480464 Chloroprene results in increased expression of DNALI1 mRNA CTD PMID:23125180 Dnali1 Rat copper(II) sulfate increases expression ISO DNALI1 (Homo sapiens) 6480464 Copper Sulfate results in increased expression of DNALI1 mRNA CTD PMID:19549813 Dnali1 Rat Cuprizon increases expression EXP 6480464 Cuprizone results in increased expression of DNALI1 mRNA CTD PMID:26577399 Dnali1 Rat cyclosporin A decreases expression ISO DNALI1 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of DNALI1 mRNA CTD PMID:27989131 Dnali1 Rat decabromodiphenyl ether decreases expression EXP 6480464 decabromobiphenyl ether results in decreased expression of DNALI1 mRNA CTD PMID:23640034 Dnali1 Rat dorsomorphin multiple interactions ISO DNALI1 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Dnali1 Rat doxorubicin decreases expression ISO DNALI1 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of DNALI1 mRNA CTD PMID:29803840 Dnali1 Rat furan decreases expression EXP 6480464 furan results in decreased expression of DNALI1 mRNA CTD PMID:25539665 Dnali1 Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of DNALI1 mRNA CTD PMID:33387578 Dnali1 Rat lead(0) decreases expression ISO DNALI1 (Homo sapiens) 6480464 Lead results in decreased expression of DNALI1 mRNA CTD PMID:19921347 Dnali1 Rat methimazole increases expression EXP 6480464 Methimazole results in increased expression of DNALI1 mRNA CTD PMID:22504374 Dnali1 Rat nickel sulfate decreases expression ISO DNALI1 (Homo sapiens) 6480464 nickel sulfate results in decreased expression of DNALI1 mRNA CTD PMID:22714537 Dnali1 Rat ozone decreases expression ISO Dnali1 (Mus musculus) 6480464 Ozone results in decreased expression of DNALI1 mRNA CTD PMID:17095637 Dnali1 Rat ozone multiple interactions ISO Dnali1 (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in increased expression of DNALI1 mRNA CTD PMID:34911549 Dnali1 Rat paracetamol decreases expression ISO DNALI1 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of DNALI1 mRNA CTD PMID:29067470 Dnali1 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of DNALI1 mRNA CTD PMID:33387578 Dnali1 Rat phenylmercury acetate multiple interactions ISO DNALI1 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of DNALI1 mRNA CTD PMID:27188386 Dnali1 Rat rotenone decreases expression ISO DNALI1 (Homo sapiens) 6480464 Rotenone results in decreased expression of DNALI1 mRNA CTD PMID:29955902 Dnali1 Rat SB 431542 multiple interactions ISO DNALI1 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Dnali1 Rat sodium arsenite decreases expression ISO DNALI1 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of DNALI1 mRNA CTD PMID:22714537 Dnali1 Rat sodium fluoride increases expression ISO Dnali1 (Mus musculus) 6480464 Sodium Fluoride results in increased expression of DNALI1 protein CTD PMID:28918527 Dnali1 Rat Soman increases expression EXP 6480464 Soman results in increased expression of DNALI1 mRNA CTD PMID:19281266 Dnali1 Rat sunitinib decreases expression ISO DNALI1 (Homo sapiens) 6480464 Sunitinib results in decreased expression of DNALI1 mRNA CTD PMID:31533062 Dnali1 Rat titanium dioxide decreases expression ISO Dnali1 (Mus musculus) 6480464 titanium dioxide results in decreased expression of DNALI1 mRNA CTD PMID:23557971 Dnali1 Rat trichloroethene decreases expression EXP 6480464 Trichloroethylene results in decreased expression of DNALI1 mRNA CTD PMID:33387578 Dnali1 Rat trichostatin A decreases expression ISO DNALI1 (Homo sapiens) 6480464 trichostatin A results in decreased expression of DNALI1 mRNA CTD PMID:24935251 and PMID:26272509 Dnali1 Rat trichostatin A multiple interactions ISO DNALI1 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of DNALI1 mRNA CTD PMID:27188386 Dnali1 Rat valproic acid affects expression ISO DNALI1 (Homo sapiens) 6480464 Valproic Acid affects the expression of DNALI1 mRNA CTD PMID:25979313 Dnali1 Rat valproic acid decreases expression ISO DNALI1 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of DNALI1 mRNA CTD PMID:23179753 more ... Dnali1 Rat valproic acid multiple interactions ISO DNALI1 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of DNALI1 mRNA CTD PMID:27188386
Imported Annotations - KEGG (archival)
Cellular Component
9+2 motile cilium (IEA,ISO) axoneme (IBA,IEA,ISO,ISS) cell projection (IEA) ciliary base (IBA,ISO) cilium (IEA,ISO) cytoplasm (IEA,ISO) dynein axonemal particle (IEA,ISS) dynein complex (IEA) filopodium (IEA,ISO) glial cell projection (ISO) intercellular bridge (IEA,ISO) microtubule cytoskeleton (IEA,ISO) mitotic spindle (IEA,ISO) motile cilium (IEA,ISO,ISS) nucleoplasm (IEA,ISO) sperm flagellum (IEA,ISO,ISS)
Dnali1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 5 142,603,132 - 142,611,970 (-) NCBI GRCr8 mRatBN7.2 5 137,318,475 - 137,327,313 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 5 137,318,477 - 137,327,336 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 5 140,022,611 - 140,031,455 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 5 141,792,629 - 141,801,473 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 5 141,799,795 - 141,808,639 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 5 143,053,365 - 143,062,203 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 5 143,053,367 - 143,062,226 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 5 146,821,949 - 146,830,787 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 5 144,399,182 - 144,408,020 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 5 144,410,295 - 144,418,035 (-) NCBI Celera 5 135,836,681 - 135,845,519 (-) NCBI Celera Cytogenetic Map 5 q36 NCBI
DNALI1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 1 37,556,940 - 37,566,857 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 1 37,556,919 - 37,566,857 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 1 38,022,541 - 38,032,458 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 1 37,795,107 - 37,805,045 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 1 37,691,612 - 37,701,550 NCBI Celera 1 36,300,508 - 36,310,446 (+) NCBI Celera Cytogenetic Map 1 p34.3 NCBI HuRef 1 36,139,366 - 36,149,953 (+) NCBI HuRef CHM1_1 1 38,138,699 - 38,148,637 (+) NCBI CHM1_1 T2T-CHM13v2.0 1 37,421,691 - 37,431,608 (+) NCBI T2T-CHM13v2.0
Dnali1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 4 124,949,131 - 124,959,443 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 4 124,949,131 - 124,959,496 (-) Ensembl GRCm39 Ensembl GRCm38 4 125,055,339 - 125,065,657 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 4 125,055,338 - 125,065,703 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 4 124,732,583 - 124,742,901 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 4 124,557,643 - 124,567,961 (-) NCBI MGSCv36 mm8 Celera 4 123,376,730 - 123,386,900 (-) NCBI Celera Cytogenetic Map 4 D2.2 NCBI cM Map 4 57.99 NCBI
Dnali1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955452 15,367,443 - 15,377,105 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955452 15,367,443 - 15,375,001 (+) NCBI ChiLan1.0 ChiLan1.0
DNALI1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 1 189,272,339 - 189,282,309 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 1 188,401,393 - 188,411,362 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 1 36,829,963 - 36,839,898 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 1 38,179,381 - 38,189,313 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 1 38,179,381 - 38,189,378 (+) Ensembl panpan1.1 panPan2
DNALI1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 15 4,916,747 - 4,922,893 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 15 4,916,756 - 4,922,813 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 15 5,163,676 - 5,169,819 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 15 5,050,890 - 5,057,040 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 15 5,050,899 - 5,057,041 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 15 4,910,078 - 4,916,219 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 15 4,976,437 - 4,982,578 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 15 4,993,129 - 4,999,271 (-) NCBI UU_Cfam_GSD_1.0
Dnali1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405058 53,954,876 - 53,963,030 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936474 19,779,671 - 19,787,093 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936474 19,779,731 - 19,787,860 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
DNALI1
DNALI1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 20 95,301,879 - 95,312,885 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 20 95,299,311 - 95,312,651 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666033 21,499,202 - 21,509,694 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Dnali1
.
Predicted Target Of
Count of predictions: 241 Count of miRNA genes: 177 Interacting mature miRNAs: 206 Transcripts: ENSRNOT00000029388 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1331796 Thshl2 Thyroid stimulating hormone level QTL 2 2.3 blood thyroid-stimulating hormone amount (VT:0005119) serum thyroid stimulating hormone level (CMO:0001248) 5 97059760 147465714 Rat 10053720 Scort26 Serum corticosterone level QTL 26 2.06 0.0147 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 5 124965598 166875058 Rat 1549845 Scl44 Serum cholesterol level QTL 44 6 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 5 40128307 148607290 Rat 8552960 Pigfal15 Plasma insulin-like growth factor 1 level QTL 15 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 5 111416838 156416838 Rat 631562 Apr2 Acute phase response QTL 2 3.7 blood murinoglobulin 1 amount (VT:0010597) plasma murinoglobulin 1 level (CMO:0001931) 5 135927956 166875058 Rat 61444 Strs2 Sensitivity to stroke QTL 2 4.7 cerebrum integrity trait (VT:0010549) post-insult time to onset of cerebrovascular lesion (CMO:0002343) 5 135929696 166875058 Rat 1300122 Wbc1 White blood cell count QTL 1 2.75 leukocyte quantity (VT:0000217) total white blood cell count (CMO:0000365) 5 125392826 139989768 Rat 61452 Ciaa5 CIA Autoantibody QTL 5 3.5 blood autoantibody amount (VT:0003725) calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281) 5 94858972 143070159 Rat 70156 Niddm30 Non-insulin dependent diabetes mellitus QTL 30 3.98 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 5 129132447 151006154 Rat 8552908 Pigfal4 Plasma insulin-like growth factor 1 level QTL 4 6.6 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 5 128506074 166875058 Rat 1331803 Rf32 Renal function QTL 32 2.798 kidney blood vessel physiology trait (VT:0100012) absolute change in renal vascular resistance (CMO:0001900) 5 129132428 143070159 Rat 61393 Bp7 Blood pressure QTL 7 4.5 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 5 60293434 161481680 Rat 7794791 Mcs33 Mammary carcinoma susceptibility QTL 33 1.93 mammary gland integrity trait (VT:0010552) mammary tumor incidence/prevalence measurement (CMO:0000946) 5 131345754 166875058 Rat 7207486 Bss109 Bone structure and strength QTL 109 femur strength trait (VT:0010010) femur total energy absorbed before break (CMO:0001677) 5 106906205 151906205 Rat 7207481 Bss106 Bone structure and strength QTL 106 7.9 femur strength trait (VT:0010010) femur ultimate force (CMO:0001675) 5 106906205 151906205 Rat 1302790 Scl20 Serum cholesterol level QTL 20 6.4 0.0001 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 5 82394392 166664054 Rat 1598861 Cm64 Cardiac mass QTL 64 2.9 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 5 127798274 166875058 Rat 1578766 Tcas11 Tongue tumor susceptibility QTL 11 4.12 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 5 46711509 161317411 Rat 631505 Bp103 Blood pressure QTL 103 3.2 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 5 132717196 165560427 Rat 1549838 Bss4 Bone structure and strength QTL 4 9.2 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 5 106906205 151906205 Rat 1641920 Colcs1 Colorectal carcinoma susceptibility QTL 1 2.99 0.0055 intestine integrity trait (VT:0010554) benign colorectal tumor surface area measurement (CMO:0001799) 5 121846814 166846814 Rat 8694169 Bw148 Body weight QTL 148 5 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 5 128506074 166875058 Rat 8657050 Bw146 Body weight QTL 146 19.84 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 5 108938288 153938288 Rat 1581510 Cm54 Cardiac mass QTL 54 3.4 0.05 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 5 120740824 143608494 Rat 1576312 Emca8 Estrogen-induced mammary cancer QTL 8 4.1 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 5 50328551 141643988 Rat 1641912 Alcrsp18 Alcohol response QTL 18 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 5 35189153 141643988 Rat 1576314 Eutr1 Estrogen induced uterine response QTL 1 uterus integrity trait (VT:0010575) pyometritis severity score (CMO:0002009) 5 2138965 166875058 Rat 2317056 Wbc3 White blood cell count QTL 3 2.51 0.01 leukocyte quantity (VT:0000217) white blood cell count (CMO:0000027) 5 105999803 150999803 Rat 634349 Bp139 Blood pressure QTL 139 0.001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 5 128924607 166875058 Rat 724525 Bp147 Blood pressure QTL 147 4.3 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 5 126424772 166875058 Rat 1598847 Cm62 Cardiac mass QTL 62 3.4 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 5 108845856 153845856 Rat 2293642 Bss37 Bone structure and strength QTL 37 4.64 0.0001 femur strength trait (VT:0010010) femur ultimate force (CMO:0001675) 5 120740824 151018848 Rat 1578673 Bmd13 Bone mineral density QTL 13 4.9 femur mineral mass (VT:0010011) trabecular volumetric bone mineral density (CMO:0001729) 5 103689353 148689353 Rat 738018 Anxrr4 Anxiety related response QTL 4 5.1 exploratory behavior trait (VT:0010471) percentage of entries into a discrete space in an experimental apparatus (CMO:0000961) 5 130130159 166875058 Rat 7207488 Bss110 Bone structure and strength QTL 1 8.4 femur strength trait (VT:0010010) femur stiffness (CMO:0001674) 5 106906205 151906205 Rat 8694441 Bw169 Body weight QTL 169 17.61 0.001 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 5 111416838 156416838 Rat 7207491 Bss112 Bone structure and strength QTL 112 7 femur morphology trait (VT:0000559) femur midshaft cortical cross-sectional area (CMO:0001663) 5 106906205 151906205 Rat 8694389 Bw160 Body weight QTL 160 6.17 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 5 111416838 156416838 Rat 61426 Scl2 Serum cholesterol level QTL 2 7.3 0.001 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 5 59793399 143070159 Rat 1354598 Srn6 Serum renin concentration QTL 6 3.8 blood renin amount (VT:0003349) plasma renin activity level (CMO:0000116) 5 69540295 151018848 Rat 8694198 Abfw3 Abdominal fat weight QTL 3 16.13 0.001 visceral adipose mass (VT:0010063) abdominal fat pad weight to body weight ratio (CMO:0000095) 5 111416838 156416838 Rat 1298089 Scl14 Serum cholesterol level QTL 14 5.8 0.0004 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 5 108845856 153845856 Rat 1598819 Bp292 Blood pressure QTL 292 4.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 5 127798274 166875058 Rat 7411722 Strs6 Sensitivity to stroke QTL 6 3.9 cerebrum integrity trait (VT:0010549) percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932) 5 134972980 138113556 Rat 1358187 Emca1 Estrogen-induced mammary cancer QTL 1 4.4 mammary gland integrity trait (VT:0010552) post-insult time to mammary tumor formation (CMO:0000345) 5 99216724 148607142 Rat
RH129662
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 5 137,318,528 - 137,318,720 (+) MAPPER mRatBN7.2 Rnor_6.0 5 143,053,419 - 143,053,610 NCBI Rnor6.0 Rnor_5.0 5 146,822,003 - 146,822,194 UniSTS Rnor5.0 RGSC_v3.4 5 144,399,236 - 144,399,427 UniSTS RGSC3.4 Celera 5 135,836,735 - 135,836,926 UniSTS RH 3.4 Map 5 891.9 UniSTS Cytogenetic Map 5 q36 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
8
3
14
106
51
57
30
15
30
6
118
40
93
38
60
27
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000029388 ⟹ ENSRNOP00000032193
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 5 137,318,477 - 137,327,336 (-) Ensembl Rnor_6.0 Ensembl 5 143,053,367 - 143,062,226 (-) Ensembl
RefSeq Acc Id:
NM_001031647 ⟹ NP_001026817
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 5 142,603,132 - 142,611,970 (-) NCBI mRatBN7.2 5 137,318,475 - 137,327,313 (-) NCBI Rnor_6.0 5 143,053,365 - 143,062,203 (-) NCBI Rnor_5.0 5 146,821,949 - 146,830,787 (-) NCBI RGSC_v3.4 5 144,399,182 - 144,408,020 (-) RGD Celera 5 135,836,681 - 135,845,519 (-) RGD
Sequence:
CCATGATACCCCCCGCAGACTCTCTGCTCAAATATGACACCCCGGTGTTGGTGAGCCGGAATACAGAAAAACGGAGCCCCAAGGCTCGGCCACTGAAAGTCACAGTTCAGCAGCCTGGACCCTCTGGT
hide sequence
RefSeq Acc Id:
NP_001026817 ⟸ NM_001031647
- UniProtKB:
Q4FZV3 (UniProtKB/Swiss-Prot), A6IS72 (UniProtKB/TrEMBL)
- Sequence:
MIPPADSLLKYDTPVLVSRNTEKRSPKARPLKVTVQQPGPSGAGPQPPKAKLPSTSCVPDPTKQAEEILNAILPPREWVEDTQLWIQQVSSTPSTRMDVVHLQEQLDLKLQQRQARETGICPVRRELY
hide sequence
Ensembl Acc Id:
ENSRNOP00000032193 ⟸ ENSRNOT00000029388
RGD ID: 13694022 Promoter ID: EPDNEW_R4545 Type: multiple initiation site Name: Dnali1_1 Description: dynein, axonemal, light intermediate chain 1 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 5 143,062,256 - 143,062,316 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-10-17
Dnali1
dynein, axonemal, light intermediate chain 1
Dnali1
dynein, axonemal, light intermediate polypeptide 1
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-12-06
Dnali1
dynein, axonemal, light intermediate polypeptide 1
Dnali1_predicted
dynein, axonemal, light intermediate polypeptide 1 (predicted)
Symbol and Name updated
1559027 APPROVED
2005-01-12
Dnali1_predicted
dynein, axonemal, light intermediate polypeptide 1 (predicted)
Symbol and Name status set to approved
70820 APPROVED
