Symbol:
Rbm4
Name:
RNA binding motif protein 4
RGD ID:
1306891
Description:
Predicted to enable RNA binding activity and cyclin binding activity. Predicted to be involved in several processes, including IRES-dependent translational initiation of linear mRNA; entrainment of circadian clock by photoperiod; and regulation of translation. Predicted to act upstream of or within several processes, including insulin secretion involved in cellular response to glucose stimulus; regulation of gene expression; and regulation of insulin receptor signaling pathway. Predicted to be located in several cellular components, including cytoplasmic stress granule; nuclear lumen; and perinuclear region of cytoplasm. Predicted to be active in nucleus. Orthologous to human RBM4 (RNA binding motif protein 4); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; bisphenol A; chlorpyrifos.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC293663
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 211,507,845 - 211,516,907 (-) NCBI GRCr8 mRatBN7.2 1 202,078,442 - 202,087,506 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 202,085,279 - 202,105,380 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 210,431,563 - 210,440,647 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 217,523,875 - 217,532,939 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 210,214,899 - 210,223,962 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 220,038,403 - 220,049,756 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 220,039,734 - 220,048,966 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 226,903,520 - 226,913,901 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 207,394,470 - 207,403,393 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 207,547,786 - 207,556,823 (-) NCBI Celera 1 199,618,949 - 199,628,010 (-) NCBI Celera Cytogenetic Map 1 q43 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Rbm4 Rat (1->4)-beta-D-glucan multiple interactions ISO Rbm4 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of RBM4 mRNA CTD PMID:36331819 Rbm4 Rat 1,2-dimethylhydrazine multiple interactions ISO Rbm4 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of RBM4 mRNA CTD PMID:22206623 Rbm4 Rat 17alpha-ethynylestradiol increases expression ISO Rbm4 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of RBM4 mRNA CTD PMID:17942748 Rbm4 Rat 17alpha-ethynylestradiol multiple interactions ISO Rbm4 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of RBM4 mRNA CTD PMID:17942748 Rbm4 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Rbm4 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of RBM4 mRNA and Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to RBM4 gene] CTD PMID:17942748 and PMID:21762485 Rbm4 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of RBM4 mRNA CTD PMID:33387578 Rbm4 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Rbm4 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of RBM4 mRNA CTD PMID:21570461 Rbm4 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Rbm4 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of RBM4 mRNA CTD PMID:19465110 Rbm4 Rat 2-methylcholine affects expression ISO RBM4 (Homo sapiens) 6480464 beta-methylcholine affects the expression of RBM4 mRNA CTD PMID:21179406 Rbm4 Rat 4,4'-diaminodiphenylmethane decreases expression ISO Rbm4 (Mus musculus) 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of RBM4 mRNA CTD PMID:18648102 Rbm4 Rat 4,4'-sulfonyldiphenol decreases methylation ISO Rbm4 (Mus musculus) 6480464 bisphenol S results in decreased methylation of RBM4 exon CTD PMID:33297965 Rbm4 Rat 5-aza-2'-deoxycytidine multiple interactions ISO RBM4 (Homo sapiens) 6480464 Decitabine inhibits the reaction [Smoke results in decreased expression of RBM4 mRNA] CTD PMID:21095227 Rbm4 Rat acrylamide increases expression ISO RBM4 (Homo sapiens) 6480464 Acrylamide results in increased expression of RBM4 mRNA CTD PMID:32763439 Rbm4 Rat aflatoxin B1 increases expression ISO Rbm4 (Mus musculus) 6480464 Aflatoxin B1 results in increased expression of RBM4 mRNA CTD PMID:19770486 Rbm4 Rat aflatoxin B1 decreases methylation ISO RBM4 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of RBM4 promoter CTD PMID:30157460 Rbm4 Rat aflatoxin B1 increases methylation ISO RBM4 (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of RBM4 gene CTD PMID:27153756 Rbm4 Rat Aflatoxin B2 alpha decreases methylation ISO RBM4 (Homo sapiens) 6480464 aflatoxin B2 results in decreased methylation of RBM4 intron CTD PMID:30157460 Rbm4 Rat arsenite(3-) increases methylation ISO RBM4 (Homo sapiens) 6480464 arsenite results in increased methylation of RBM4 promoter CTD PMID:23974009 Rbm4 Rat benzo[a]pyrene increases expression ISO Rbm4 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of RBM4 mRNA CTD PMID:19770486 Rbm4 Rat benzo[a]pyrene increases methylation ISO RBM4 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of RBM4 promoter CTD PMID:27901495 Rbm4 Rat benzo[a]pyrene decreases methylation ISO RBM4 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of RBM4 3' UTR CTD PMID:27901495 Rbm4 Rat benzo[a]pyrene affects methylation ISO RBM4 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of RBM4 intron CTD PMID:30157460 Rbm4 Rat benzo[e]pyrene increases methylation ISO RBM4 (Homo sapiens) 6480464 benzo(e)pyrene results in increased methylation of RBM4 promoter CTD PMID:30157460 Rbm4 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of RBM4 mRNA CTD PMID:25181051 Rbm4 Rat bisphenol A decreases expression ISO RBM4 (Homo sapiens) 6480464 bisphenol A results in decreased expression of RBM4 protein CTD PMID:37567409 Rbm4 Rat bisphenol A increases expression ISO Rbm4 (Mus musculus) 6480464 bisphenol A results in increased expression of RBM4 mRNA CTD PMID:33221593 and PMID:38074096 Rbm4 Rat caffeine increases phosphorylation ISO RBM4 (Homo sapiens) 6480464 Caffeine results in increased phosphorylation of RBM4 protein CTD PMID:35688186 Rbm4 Rat carbon nanotube increases expression ISO Rbm4 (Mus musculus) 6480464 Nanotubes and Carbon results in increased expression of RBM4 mRNA CTD PMID:25620056 Rbm4 Rat CGP 52608 multiple interactions ISO RBM4 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to RBM4 gene] CTD PMID:28238834 Rbm4 Rat chlorpyrifos increases expression EXP 6480464 Chlorpyrifos results in increased expression of RBM4 mRNA CTD PMID:18668222 Rbm4 Rat cisplatin multiple interactions ISO RBM4 (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in decreased expression of RBM4 mRNA CTD PMID:27392435 Rbm4 Rat copper(II) sulfate decreases expression ISO RBM4 (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of RBM4 mRNA CTD PMID:19549813 Rbm4 Rat Cuprizon increases expression EXP 6480464 Cuprizone results in increased expression of RBM4 mRNA CTD PMID:26577399 Rbm4 Rat cyclosporin A decreases expression ISO RBM4 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of RBM4 mRNA CTD PMID:21163907 Rbm4 Rat Dibutyl phosphate affects expression ISO RBM4 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of RBM4 mRNA CTD PMID:37042841 Rbm4 Rat doxorubicin increases expression ISO RBM4 (Homo sapiens) 6480464 Doxorubicin results in increased expression of RBM4 mRNA CTD PMID:29803840 Rbm4 Rat elemental selenium decreases expression ISO RBM4 (Homo sapiens) 6480464 Selenium results in decreased expression of RBM4 mRNA CTD PMID:19244175 Rbm4 Rat enzyme inhibitor multiple interactions ISO RBM4 (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of RBM4 protein CTD PMID:23301498 Rbm4 Rat epoxiconazole decreases expression ISO Rbm4 (Mus musculus) 6480464 epoxiconazole results in decreased expression of RBM4 mRNA CTD PMID:35436446 Rbm4 Rat folic acid multiple interactions ISO Rbm4 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of RBM4 mRNA CTD PMID:22206623 Rbm4 Rat FR900359 increases phosphorylation ISO RBM4 (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of RBM4 protein CTD PMID:37730182 Rbm4 Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of RBM4 mRNA CTD PMID:33387578 Rbm4 Rat hydralazine multiple interactions ISO RBM4 (Homo sapiens) 6480464 [Hydralazine co-treated with Valproic Acid] results in increased expression of RBM4 mRNA CTD PMID:17183730 Rbm4 Rat hydroxyurea increases mutagenesis ISO Rbm4 (Mus musculus) 6480464 Hydroxyurea results in increased mutagenesis of RBM4 gene CTD PMID:16868089 Rbm4 Rat ivermectin decreases expression ISO RBM4 (Homo sapiens) 6480464 Ivermectin results in decreased expression of RBM4 protein CTD PMID:32959892 Rbm4 Rat ketamine decreases expression EXP 6480464 Ketamine results in decreased expression of RBM4 mRNA CTD PMID:20080153 Rbm4 Rat lead diacetate increases expression ISO Rbm4 (Mus musculus) 6480464 lead acetate results in increased expression of RBM4 mRNA CTD PMID:21829687 Rbm4 Rat methapyrilene increases methylation ISO RBM4 (Homo sapiens) 6480464 Methapyrilene results in increased methylation of RBM4 promoter CTD PMID:30157460 Rbm4 Rat methylmercury chloride increases expression ISO RBM4 (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of RBM4 mRNA CTD PMID:23179753 Rbm4 Rat methylmercury chloride decreases expression ISO RBM4 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of RBM4 mRNA CTD PMID:28001369 Rbm4 Rat monosodium L-glutamate increases expression ISO Rbm4 (Mus musculus) 6480464 Sodium Glutamate results in increased expression of RBM4 mRNA CTD PMID:22078008 Rbm4 Rat N-methyl-N-nitrosourea increases mutagenesis ISO Rbm4 (Mus musculus) 6480464 Methylnitrosourea results in increased mutagenesis of RBM4 gene CTD PMID:16868089 Rbm4 Rat paracetamol affects expression ISO Rbm4 (Mus musculus) 6480464 Acetaminophen affects the expression of RBM4 mRNA CTD PMID:17562736 Rbm4 Rat perfluorohexanesulfonic acid decreases expression ISO Rbm4 (Mus musculus) 6480464 perfluorohexanesulfonic acid results in decreased expression of RBM4 mRNA CTD PMID:37995155 Rbm4 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Rbm4 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of RBM4 mRNA CTD PMID:36331819 Rbm4 Rat quartz increases expression ISO RBM4 (Homo sapiens) 6480464 Quartz results in increased expression of RBM4 protein CTD PMID:27917503 Rbm4 Rat quercetin decreases expression ISO RBM4 (Homo sapiens) 6480464 Quercetin results in decreased expression of RBM4 protein CTD PMID:15221776 Rbm4 Rat SB 203580 multiple interactions ISO RBM4 (Homo sapiens) 6480464 SB 203580 inhibits the reaction [sodium arsenite affects the localization of RBM4 protein] CTD PMID:17284590 Rbm4 Rat selenium atom decreases expression ISO RBM4 (Homo sapiens) 6480464 Selenium results in decreased expression of RBM4 mRNA CTD PMID:19244175 Rbm4 Rat silicon dioxide increases expression ISO RBM4 (Homo sapiens) 6480464 Silicon Dioxide results in increased expression of RBM4 protein CTD PMID:27917503 Rbm4 Rat sodium arsenite multiple interactions ISO RBM4 (Homo sapiens) 6480464 SB 203580 inhibits the reaction [sodium arsenite affects the localization of RBM4 protein] more ... CTD PMID:17284590 Rbm4 Rat sodium arsenite increases phosphorylation ISO RBM4 (Homo sapiens) 6480464 sodium arsenite results in increased phosphorylation of RBM4 protein CTD PMID:17284590 Rbm4 Rat sodium arsenite affects localization ISO RBM4 (Homo sapiens) 6480464 sodium arsenite affects the localization of RBM4 protein CTD PMID:17284590 Rbm4 Rat testosterone decreases expression ISO RBM4 (Homo sapiens) 6480464 Testosterone results in decreased expression of RBM4 mRNA CTD PMID:33359661 Rbm4 Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of RBM4 mRNA CTD PMID:33387578 Rbm4 Rat titanium dioxide decreases methylation ISO Rbm4 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of RBM4 gene CTD PMID:35295148 Rbm4 Rat trichloroethene decreases expression EXP 6480464 Trichloroethylene results in decreased expression of RBM4 mRNA CTD PMID:33387578 Rbm4 Rat trichostatin A decreases expression ISO RBM4 (Homo sapiens) 6480464 trichostatin A results in decreased expression of RBM4 mRNA CTD PMID:26272509 Rbm4 Rat troglitazone increases expression ISO Rbm4 (Mus musculus) 6480464 troglitazone results in increased expression of RBM4 mRNA CTD PMID:28973697 Rbm4 Rat urethane increases expression ISO RBM4 (Homo sapiens) 6480464 Urethane results in increased expression of RBM4 mRNA CTD PMID:28818685 Rbm4 Rat valproic acid multiple interactions ISO RBM4 (Homo sapiens) 6480464 [Hydralazine co-treated with Valproic Acid] results in increased expression of RBM4 mRNA CTD PMID:17183730 Rbm4 Rat valproic acid affects expression ISO RBM4 (Homo sapiens) 6480464 Valproic Acid affects the expression of RBM4 mRNA CTD PMID:25979313 Rbm4 Rat valproic acid decreases expression ISO RBM4 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of RBM4 mRNA CTD PMID:23179753 more ... Rbm4 Rat vitamin E decreases expression ISO RBM4 (Homo sapiens) 6480464 Vitamin E results in decreased expression of RBM4 mRNA CTD PMID:19244175
Rbm4 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 211,507,845 - 211,516,907 (-) NCBI GRCr8 mRatBN7.2 1 202,078,442 - 202,087,506 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 202,085,279 - 202,105,380 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 210,431,563 - 210,440,647 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 217,523,875 - 217,532,939 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 210,214,899 - 210,223,962 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 220,038,403 - 220,049,756 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 220,039,734 - 220,048,966 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 226,903,520 - 226,913,901 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 207,394,470 - 207,403,393 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 207,547,786 - 207,556,823 (-) NCBI Celera 1 199,618,949 - 199,628,010 (-) NCBI Celera Cytogenetic Map 1 q43 NCBI
RBM4 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 11 66,638,703 - 66,668,380 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 11 66,638,667 - 66,668,374 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 11 66,406,174 - 66,435,851 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 11 66,162,714 - 66,170,516 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 11 66,162,777 - 66,170,514 NCBI Celera 11 63,731,742 - 63,740,539 (+) NCBI Celera Cytogenetic Map 11 q13.2 NCBI HuRef 11 62,734,477 - 62,764,214 (+) NCBI HuRef CHM1_1 11 66,289,814 - 66,319,584 (+) NCBI CHM1_1 T2T-CHM13v2.0 11 66,634,947 - 66,664,627 (+) NCBI T2T-CHM13v2.0
Rbm4 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 19 4,834,321 - 4,844,037 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 19 4,834,321 - 4,843,929 (-) Ensembl GRCm39 Ensembl GRCm38 19 4,784,293 - 4,794,009 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 19 4,784,293 - 4,793,901 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 19 4,784,293 - 4,793,877 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 19 4,784,293 - 4,793,877 (-) NCBI MGSCv36 mm8 Celera 19 4,655,503 - 4,665,087 (-) NCBI Celera Cytogenetic Map 19 A NCBI cM Map 19 4.11 NCBI
RBM4 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 9 67,864,630 - 67,894,452 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 11 68,884,652 - 68,953,231 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 11 61,996,221 - 62,026,007 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 11 65,319,464 - 65,349,183 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 11 65,298,404 - 65,349,183 (+) Ensembl panpan1.1 panPan2
RBM14
LOC103221203
.
Predicted Target Of
Count of predictions: 252 Count of miRNA genes: 173 Interacting mature miRNAs: 210 Transcripts: ENSRNOT00000026611 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1578778 Pur4 Proteinuria QTL 4 3.3 0.003 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 1 150700247 252085048 Rat 1354646 Kidm18 Kidney mass QTL 18 5.7 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 1 151162512 256448636 Rat 1357335 Bw39 Body weight QTL 39 3.3 body mass (VT:0001259) body weight (CMO:0000012) 1 197814409 242814409 Rat 1578780 Cm52 Cardiac mass QTL 52 3.3 0.0001 heart mass (VT:0007028) heart wet weight (CMO:0000069) 1 81591954 219808434 Rat 2302375 Bw83 Body weight QTL 83 4.87 0.0002 body mass (VT:0001259) body weight (CMO:0000012) 1 197697768 242697768 Rat 1354652 Kidm20 Kidney mass QTL 20 4.3 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 1 177227632 256448636 Rat 2293674 Bss39 Bone structure and strength QTL 39 7.1 0.0001 femur strength trait (VT:0010010) femur total energy absorbed before break (CMO:0001677) 1 201554356 246554356 Rat 2302378 Insul11 Insulin level QTL 11 3.25 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 1 144267353 251128347 Rat 1354653 Despr9 Despair related QTL 9 0.00019 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 1 167909849 212909849 Rat 2293673 Bss27 Bone structure and strength QTL 27 18.63 0.0001 femur morphology trait (VT:0000559) femur midshaft cortical cross-sectional area (CMO:0001663) 1 171629477 216629477 Rat 2293677 Bss41 Bone structure and strength QTL 41 9.38 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra cross-sectional area (CMO:0001689) 1 171629477 216629477 Rat 1302787 Stl25 Serum triglyceride level QTL 25 2.7 0.0073 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 1 180359209 210702199 Rat 1549830 Bss1 Bone structure and strength QTL 1 4.8 femur strength trait (VT:0010010) femur ultimate force (CMO:0001675) 1 172609619 217609619 Rat 7794788 Mcs32 Mammary carcinoma susceptibility QTL 32 2.61 mammary gland integrity trait (VT:0010552) mammary tumor incidence/prevalence measurement (CMO:0000946) 1 115540693 238914717 Rat 70163 Bw20 Body weight QTL 20 5.1 body mass (VT:0001259) body weight (CMO:0000012) 1 174133260 219133260 Rat 1578763 Kidm29 Kidney mass QTL 29 3.3 0.0001 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 1 179567751 260522016 Rat 1600395 Niddm69 Non-insulin dependent diabetes mellitus QTL 69 4.14 0.0002 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 1 195804352 257091168 Rat 1354624 Cm35 Cardiac mass QTL35 5.7 heart left ventricle mass (VT:0007031) calculated heart weight (CMO:0000073) 1 177227632 256448636 Rat 1600396 Niddm68 Non-insulin dependent diabetes mellitus QTL 68 4.97 0.0003 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 195804352 257091168 Rat 1558658 Bw59 Body weight QTL 59 3.5 0.0003 body mass (VT:0001259) body weight (CMO:0000012) 1 178784622 223784622 Rat 631838 Niddm36 Non-insulin dependent diabetes mellitus QTL 36 0.01 insulin secretion trait (VT:0003564) calculated pancreatic islet insulin release measurement (CMO:0001217) 1 184550676 229550676 Rat 1549837 Hcar15 Hepatocarcinoma resistance QTL 15 0.05 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 153136852 260522016 Rat 2293689 Bss47 Bone structure and strength QTL 47 7.25 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra trabecular cross-sectional area (CMO:0001692) 1 171629477 216629477 Rat 152025235 Bw194 Body weight QTL 194 4.86 body mass (VT:0001259) 1 123556856 242907031 Rat 1600388 Niddm67 Non-insulin dependent diabetes mellitus QTL 67 5.84 0.000004 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 195804352 257091168 Rat 2293694 Bss38 Bone structure and strength QTL 38 7.05 0.0001 femur strength trait (VT:0010010) femur stiffness (CMO:0001674) 1 201554356 246554356 Rat 1598853 Memor3 Memory QTL 3 4.5 exploratory behavior trait (VT:0010471) total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443) 1 143506580 212458660 Rat 61341 Bp26 Blood pressure QTL 26 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 169537671 214537671 Rat 1578759 Uae30 Urinary albumin excretion QTL 30 3.3 0.003 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 150700247 252085048 Rat 2293693 Bss22 Bone structure and strength QTL 22 33.52 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 1 171629477 216629477 Rat 2300161 Bmd43 Bone mineral density QTL 43 8.4 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 1 171629477 216629477 Rat 1300145 Rf7 Renal function QTL 7 2.96 urine creatinine amount (VT:0010540) urine creatinine level (CMO:0000125) 1 185145134 221264292 Rat 61347 Bp197 Blood pressure QTL 197 4.2 arterial blood pressure trait (VT:2000000) blood pressure measurement (CMO:0000003) 1 158633083 203633083 Rat 8655655 Arrd2 Age-related retinal degeneration QTL 2 7.79 retinal layer morphology trait (VT:0003727) percentage of study population developing retinopathy during a period of time (CMO:0002453) 1 183970203 243914901 Rat 1358898 Bp255 Blood pressure QTL 255 3.6 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 191019702 246062233 Rat 631214 Bw61 Body weight QTL61 3.4 0.0001 intramuscular adipose amount (VT:0010044) intramuscular fat area (CMO:0001162) 1 173108781 218108781 Rat 7771612 Cm80 Cardiac mass QTL 80 8.4 heart left ventricle mass (VT:0007031) heart left ventricle weight (CMO:0000776) 1 149448574 221264292 Rat 731168 Bp154 Blood pressure QTL 154 3.4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 94642644 214537671 Rat 2300175 Bmd40 Bone mineral density QTL 40 15.4 0.0001 femur mineral mass (VT:0010011) bone mineral density (CMO:0001226) 1 201554356 246554356 Rat 2300174 Bmd42 Bone mineral density QTL 42 8.4 0.0001 lumbar vertebra mineral mass (VT:0010511) bone mineral density (CMO:0001226) 1 171629477 216629477 Rat 737828 Hcas3 Hepatocarcinoma susceptibility QTL 3 4.9 liver integrity trait (VT:0010547) liver tumorous lesion volume to total liver volume ratio (CMO:0001082) 1 144267353 222987745 Rat 1354661 Bw33 Body weight QTL 33 5.2 body mass (VT:0001259) body weight (CMO:0000012) 1 151162512 256448636 Rat 1358886 Bp260 Blood pressure QTL 260 3.67 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 151162766 225824951 Rat 737977 Bp160 Blood pressure QTL 160 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 181133855 226133855 Rat 2293654 Bss30 Bone structure and strength QTL 30 32.65 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 1 171629477 216629477 Rat 2293655 Bss36 Bone structure and strength QTL 36 10.66 0.0001 femur strength trait (VT:0010010) femur ultimate force (CMO:0001675) 1 201554356 246554356 Rat 1298084 Thym4 Thymus enlargement QTL 4 10.68 thymus mass (VT:0004954) thymus weight to body weight ratio (CMO:0000612) 1 197814409 242814409 Rat 724531 Uae5 Urinary albumin excretion QTL 5 4 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 1 150700142 252085212 Rat 2300187 Bmd41 Bone mineral density QTL 41 8.9 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 1 171629477 216629477 Rat 2314011 Gluco56 Glucose level QTL 56 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 199773958 202166723 Rat 8552891 Epfw5 Epididymal fat weight QTL 5 4.4 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 1 193113876 238113876 Rat 1359018 Hrtrt20 Heart rate QTL 20 3.08 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 1 185356336 202902618 Rat 1354580 Scort1 Serum corticosterone level QTL 1 3.4 blood corticosterone amount (VT:0005345) blood corticosterone level (CMO:0001172) 1 156677124 256448636 Rat 1358292 Cm37 Cardiac mass QTL 37 6.2 8e-07 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 1 196248093 241248093 Rat 61376 Bp42 Blood pressure QTL 42 23.4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 197814409 242814409 Rat 634313 Niddm43 Non-insulin dependent diabetes mellitus QTL 43 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 199050459 259647894 Rat 634312 Bp143 Blood pressure QTL 143 3 0.0002 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 182623426 219932796 Rat 1358294 Bw37 Body weight QTL 37 5 0.000011 body mass (VT:0001259) body weight (CMO:0000012) 1 171310381 216310381 Rat 724559 Pancm1 Pancreatic morphology QTL 1 7.1 islet of Langerhans morphology trait (VT:0005215) pancreatic islet damage composite score (CMO:0001156) 1 181759564 214537555 Rat 2312420 Pur17 Proteinuria QTL 17 7.1 0.0001 urine protein amount (VT:0005160) urine total protein excretion rate (CMO:0000756) 1 156677124 218753816 Rat 10059600 Bp378 Blood pressure QTL 378 3.08 0.05 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 176869060 221869060 Rat 7421630 Bp362 Blood pressure QTL 362 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 118608292 241799120 Rat 619613 Bp77 Blood pressure QTL 77 0.01 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 164747424 209747424 Rat 2312564 Glom18 Glomerulus QTL 18 2.4 0.003 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 1 185356336 231689108 Rat 634321 Hc1 Hypercalciuria QTL 1 2.91 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 1 178810256 240830002 Rat 2292218 Kidm35 Kidney mass QTL 35 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 1 199368955 224569684 Rat 724562 Rends1 Renal damage susceptibility QTL 1 0.05 kidney glomerulus integrity trait (VT:0010546) index of glomerular damage (CMO:0001135) 1 169537671 214537671 Rat 1331790 Bp201 Blood pressure QTL 201 3.127 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 198211513 225126682 Rat 10059587 Bw173 Body weight QTL 173 3.23 0.025 body mass (VT:0001259) body weight (CMO:0000012) 1 202069611 247069611 Rat 2292222 Bp307 Blood pressure QTL 307 3.06 0.0014 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 164310393 213533942 Rat 2292220 Bp306 Blood pressure QTL 306 3.47 0.00087 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 164310393 243914901 Rat 10059590 Kidm44 Kidney mass QTL 44 3.42 0.025 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 1 191033875 236033875 Rat 1641926 Teswt2 Testicular weight QTL 2 2.82 testis mass (VT:1000644) both testes wet weight (CMO:0000175) 1 197697768 238755659 Rat 631658 Cm7 Cardiac mass QTL 7 5.32 0.0001 aorta mass (VT:0002845) aorta weight (CMO:0000076) 1 196248093 241248093 Rat 1600380 Niddm70 Non-insulin dependent diabetes mellitus QTL 70 3.1 0.0008 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 1 176550523 221550523 Rat 1354610 Bw34 Body weight QTL 34 4.1 body mass (VT:0001259) body weight (CMO:0000012) 1 151162512 256448636 Rat 1582206 Kidm33 Kidney mass QTL 33 6.9 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 1 188377360 224054420 Rat 8655855 Arrd3 Age-related retinal degeneration QTL 3 3.07 lens clarity trait (VT:0001304) cataract incidence/prevalence measurement (CMO:0001585) 1 183970203 243914901 Rat 634338 Hcar4 Hepatocarcinoma resistance QTL 4 4.6 liver integrity trait (VT:0010547) liver tumorous lesion number to liver area ratio (CMO:0001210) 1 193422268 214537671 Rat 6903303 Scl34 Serum cholesterol QTL 34 2.5 0.0033 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 1 180359209 218108781 Rat 1600374 Mcs17 Mammary carcinoma susceptibility QTL 17 3 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 1 197670404 242670404 Rat 2293083 Iddm25 Insulin dependent diabetes mellitus QTL 25 4.18 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 181829673 224569684 Rat 1354606 Bp246 Blood pressure QTL 246 3.6 arterial blood pressure trait (VT:2000000) pulse pressure (CMO:0000292) 1 102813953 218753816 Rat 738032 Hcas5 Hepatocarcinoma susceptibility QTL 5 3.12 liver integrity trait (VT:0010547) liver tumorous lesion number (CMO:0001068) 1 176426412 257976495 Rat 1358191 Ept10 Estrogen-induced pituitary tumorigenesis QTL 10 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 1 192825253 243914732 Rat 7394701 Uae46 Urinary albumin excretion QTL 46 3.6 0.0056 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 201554356 246554356 Rat
BE099273
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 202,086,401 - 202,087,408 (+) MAPPER mRatBN7.2 Rnor_6.0 1 220,047,862 - 220,048,868 NCBI Rnor6.0 Rnor_5.0 1 226,978,858 - 226,979,864 UniSTS Rnor5.0 Rnor_5.0 1 226,912,710 - 226,913,716 UniSTS Rnor5.0 RGSC_v3.4 1 207,402,307 - 207,403,313 UniSTS RGSC3.4 Celera 1 199,626,906 - 199,627,912 UniSTS RH 3.4 Map 1 1557.3 UniSTS Cytogenetic Map 1 q42-q43 UniSTS
RH128421
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 202,088,459 - 202,088,642 (+) MAPPER mRatBN7.2 Rnor_6.0 1 220,049,920 - 220,050,102 NCBI Rnor6.0 Rnor_5.0 1 226,980,916 - 226,981,098 UniSTS Rnor5.0 Rnor_5.0 1 226,914,768 - 226,914,950 UniSTS Rnor5.0 RGSC_v3.4 1 207,404,365 - 207,404,547 UniSTS RGSC3.4 Celera 1 199,628,964 - 199,629,146 UniSTS RH 3.4 Map 1 1557.3 UniSTS Cytogenetic Map 1 q42-q43 UniSTS
RH133459
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 202,084,870 - 202,085,089 (+) MAPPER mRatBN7.2 Rnor_6.0 1 220,046,331 - 220,046,549 NCBI Rnor6.0 Rnor_5.0 1 226,977,327 - 226,977,545 UniSTS Rnor5.0 Rnor_5.0 1 226,911,179 - 226,911,397 UniSTS Rnor5.0 RGSC_v3.4 1 207,400,776 - 207,400,994 UniSTS RGSC3.4 Celera 1 199,625,375 - 199,625,593 UniSTS RH 3.4 Map 1 1555.9 UniSTS Cytogenetic Map 1 q42-q43 UniSTS
AA957251
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 202,078,281 - 202,078,472 (+) MAPPER mRatBN7.2 Rnor_6.0 1 220,039,745 - 220,039,935 NCBI Rnor6.0 Rnor_5.0 1 226,904,861 - 226,905,051 UniSTS Rnor5.0 Celera 1 199,618,789 - 199,618,979 UniSTS RH 3.4 Map 1 1555.9 UniSTS Cytogenetic Map 1 q42 UniSTS Cytogenetic Map 1 q42-q43 UniSTS
RH138350
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 202,077,005 - 202,077,236 (+) MAPPER mRatBN7.2 Rnor_6.0 1 220,038,469 - 220,038,699 NCBI Rnor6.0 Rnor_5.0 1 226,903,585 - 226,903,815 UniSTS Rnor5.0 RGSC_v3.4 1 207,393,131 - 207,393,361 UniSTS RGSC3.4 Celera 1 199,617,513 - 199,617,743 UniSTS RH 3.4 Map 1 1556.0 UniSTS Cytogenetic Map 1 q42-q43 UniSTS
BM389926
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 1 202,085,471 - 202,085,628 (+) MAPPER mRatBN7.2 Rnor_6.0 1 220,046,932 - 220,047,088 NCBI Rnor6.0 Rnor_5.0 1 226,977,928 - 226,978,084 UniSTS Rnor5.0 Rnor_5.0 1 226,911,780 - 226,911,936 UniSTS Rnor5.0 RGSC_v3.4 1 207,401,377 - 207,401,533 UniSTS RGSC3.4 Celera 1 199,625,976 - 199,626,132 UniSTS RH 3.4 Map 1 1557.0 UniSTS Cytogenetic Map 1 q42-q43 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000067093 ⟹ ENSRNOP00000059872
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 202,085,279 - 202,087,482 (-) Ensembl Rnor_6.0 Ensembl 1 220,039,734 - 220,048,950 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000087573 ⟹ ENSRNOP00000072133
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 202,085,310 - 202,105,380 (-) Ensembl Rnor_6.0 Ensembl 1 220,039,905 - 220,048,966 (-) Ensembl
RefSeq Acc Id:
NM_001170484 ⟹ NP_001163955
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 211,507,845 - 211,516,907 (-) NCBI mRatBN7.2 1 202,078,442 - 202,087,506 (-) NCBI Rnor_6.0 1 220,039,905 - 220,048,966 (-) NCBI Rnor_5.0 1 226,903,520 - 226,913,901 (-) NCBI Celera 1 199,618,949 - 199,628,010 (-) NCBI
Sequence:
GAGTCACTGCTGTGGCCGCCGCCATTTTAGCGTTTTGTCAGAGCCGTCTACGCTGCGAGGAGGAGGACCTGCAGATTTCCATGCGGCTGTGTGGAGATGGTGAAACTGTTCATCGGAAATCTGCCCCG
hide sequence
RefSeq Acc Id:
NP_001163955 ⟸ NM_001170484
- UniProtKB:
A6HYZ0 (UniProtKB/TrEMBL)
- Sequence:
MVKLFIGNLPREATEQEIRSLFEQYGKVLECDIIKNYGFVHIEDKTAAEDAIRNLHHYKLHGVNINVEASKNKSKASTKLHVGNISPTCTNQELRAKFEEYGPVIECDIVKDYAFVHMERAEDAVEAI
hide sequence
Ensembl Acc Id:
ENSRNOP00000059872 ⟸ ENSRNOT00000067093
Ensembl Acc Id:
ENSRNOP00000072133 ⟸ ENSRNOT00000087573
RGD ID: 13690632 Promoter ID: EPDNEW_R1154 Type: initiation region Name: Rbm4_1 Description: RNA binding motif protein 4 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 1 220,048,927 - 220,048,987 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-04-30
Rbm4
RNA binding motif protein 4
Rbm4_predicted
RNA binding motif protein 4 (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Rbm4_predicted
RNA binding motif protein 4 (predicted)
Symbol and Name status set to approved
70820 APPROVED
