Symbol:
Dsp
Name:
desmoplakin
RGD ID:
1305794
Description:
Predicted to enable protein kinase C binding activity; scaffold protein binding activity; and structural molecule activity. Predicted to be involved in several processes, including intermediate filament organization; regulation of heart contraction; and ventricular compact myocardium morphogenesis. Predicted to act upstream of or within adherens junction organization; desmosome organization; and epithelial cell-cell adhesion. Located in desmosome and fascia adherens. Human ortholog(s) of this gene implicated in Carvajal syndrome; arrhythmogenic right ventricular cardiomyopathy; arrhythmogenic right ventricular dysplasia 8; dilated cardiomyopathy; and keratosis palmoplantaris striata 2. Orthologous to human DSP (desmoplakin); PARTICIPATES IN arrhythmogenic right ventricular cardiomyopathy pathway; INTERACTS WITH 17alpha-ethynylestradiol; 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
DP; LOC306871
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
DSP (desmoplakin) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Mus musculus (house mouse):
Dsp (desmoplakin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Dsp (desmoplakin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
DSP (desmoplakin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
DSP (desmoplakin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Dsp (desmoplakin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
DSP (desmoplakin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
DSP (desmoplakin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Dsp (desmoplakin) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
COPS4 (COP9 signalosome subunit 4) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
DSP (desmoplakin)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Dsp (desmoplakin)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
dspa (desmoplakin a)
Alliance
DIOPT (Ensembl Compara|Hieranoid|OMA|OrthoFinder|PANTHER|PhylomeDB)
Danio rerio (zebrafish):
wu:fi04e12
Alliance
DIOPT (Ensembl Compara|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
wu:fi04e12
Alliance
DIOPT (Ensembl Compara|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
dsp
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 17 26,829,153 - 26,877,419 (-) NCBI GRCr8 mRatBN7.2 17 26,623,602 - 26,671,692 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 17 26,623,588 - 26,671,800 (-) Ensembl mRatBN7.2 Ensembl Rnor_6.0 17 27,286,811 - 27,334,453 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 17 27,286,796 - 27,334,379 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 17 29,201,872 - 29,249,490 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 17 32,848,313 - 32,896,044 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 17 32,851,800 - 32,898,885 (-) NCBI Celera 17 26,257,726 - 26,305,766 (-) NCBI Celera Cytogenetic Map 17 p12 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Dsp Rat 1,2-dimethylhydrazine affects expression ISO Dsp (Mus musculus) 6480464 1 and 2-Dimethylhydrazine affects the expression of DSP mRNA CTD PMID:22206623 Dsp Rat 1,2-dimethylhydrazine multiple interactions ISO Dsp (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of DSP mRNA CTD PMID:22206623 Dsp Rat 17alpha-ethynylestradiol increases expression EXP 6480464 Ethinyl Estradiol results in increased expression of DSP mRNA CTD PMID:17557909 Dsp Rat 17beta-estradiol increases expression ISO Dsp (Mus musculus) 6480464 Estradiol results in increased expression of DSP mRNA CTD PMID:39298647 Dsp Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO DSP (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of DSP mRNA and Tetrachlorodibenzodioxin results in increased expression of DSP protein CTD PMID:21632981 and PMID:37788135 Dsp Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of DSP mRNA CTD PMID:33387578 Dsp Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Dsp (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of DSP mRNA CTD PMID:21570461 Dsp Rat 2,3-dimethoxynaphthalene-1,4-dione increases expression ISO DSP (Homo sapiens) 6480464 2 more ... CTD PMID:37788135 Dsp Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Dsp (Mus musculus) 6480464 2 more ... CTD PMID:38648751 Dsp Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of DSP mRNA CTD PMID:21346803 Dsp Rat 2,6-dimethoxyphenol multiple interactions ISO DSP (Homo sapiens) 6480464 [pyrogallol 1 more ... CTD PMID:38598786 Dsp Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of DSP mRNA CTD PMID:21346803 Dsp Rat 2-bromohexadecanoic acid multiple interactions ISO DSP (Homo sapiens) 6480464 2-bromopalmitate inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in increased palmitoylation of DSP protein] CTD PMID:38195004 Dsp Rat 2-palmitoylglycerol increases expression ISO DSP (Homo sapiens) 6480464 2-palmitoylglycerol results in increased expression of DSP mRNA CTD PMID:37199045 Dsp Rat 3-chloropropane-1,2-diol increases expression EXP 6480464 alpha-Chlorohydrin results in increased expression of DSP protein CTD PMID:34915118 Dsp Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO DSP (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin] results in decreased expression of DSP mRNA CTD PMID:28628672 Dsp Rat 4,4'-sulfonyldiphenol increases expression ISO DSP (Homo sapiens) 6480464 bisphenol S results in increased expression of DSP mRNA CTD PMID:25912373 Dsp Rat 4,4'-sulfonyldiphenol increases methylation ISO Dsp (Mus musculus) 6480464 bisphenol S results in increased methylation of DSP exon CTD PMID:33297965 Dsp Rat 4,4'-sulfonyldiphenol decreases expression ISO Dsp (Mus musculus) 6480464 bisphenol S results in decreased expression of DSP mRNA CTD PMID:39298647 Dsp Rat 4-hydroxyphenyl retinamide increases expression ISO Dsp (Mus musculus) 6480464 Fenretinide results in increased expression of DSP mRNA CTD PMID:28973697 Dsp Rat 5-aza-2'-deoxycytidine multiple interactions ISO DSP (Homo sapiens) 6480464 Decitabine inhibits the reaction [Smoke results in decreased expression of DSP mRNA] CTD PMID:21095227 Dsp Rat acrylamide increases expression EXP 6480464 Acrylamide results in increased expression of DSP mRNA CTD PMID:28959563 Dsp Rat aflatoxin B1 increases expression ISO Dsp (Mus musculus) 6480464 Aflatoxin B1 results in increased expression of DSP mRNA CTD PMID:19770486 Dsp Rat aflatoxin B1 increases methylation ISO DSP (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of DSP gene CTD PMID:27153756 Dsp Rat all-trans-retinoic acid increases expression ISO Dsp (Mus musculus) 6480464 Tretinoin results in increased expression of DSP mRNA CTD PMID:16604517 Dsp Rat all-trans-retinoic acid increases expression ISO DSP (Homo sapiens) 6480464 Tretinoin results in increased expression of DSP mRNA CTD PMID:21934132 Dsp Rat alpha-Zearalanol multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of DSP mRNA CTD PMID:35163327 Dsp Rat amphetamine increases expression EXP 6480464 Amphetamine results in increased expression of DSP mRNA CTD PMID:30779732 Dsp Rat Aroclor 1254 decreases expression ISO Dsp (Mus musculus) 6480464 Chlorodiphenyl (54% Chlorine) results in decreased expression of DSP mRNA CTD PMID:23650126 Dsp Rat arsenous acid increases expression ISO DSP (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of DSP protein CTD PMID:25419056 Dsp Rat benzo[a]pyrene decreases expression ISO DSP (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of DSP mRNA and Benzo(a)pyrene results in decreased expression of DSP protein CTD PMID:31255691 and PMID:32717239 Dsp Rat benzo[a]pyrene increases methylation ISO DSP (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of DSP 3' UTR CTD PMID:27901495 Dsp Rat benzo[a]pyrene affects methylation ISO DSP (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of DSP promoter CTD PMID:27901495 Dsp Rat benzo[a]pyrene increases expression ISO Dsp (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of DSP mRNA CTD PMID:22228805 and PMID:27195522 Dsp Rat benzo[a]pyrene increases expression ISO DSP (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of DSP mRNA CTD PMID:22316170 Dsp Rat bis(2-ethylhexyl) phthalate increases expression ISO Dsp (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of DSP mRNA CTD PMID:34319233 Dsp Rat bisphenol A decreases expression ISO Dsp (Mus musculus) 6480464 bisphenol A results in decreased expression of DSP mRNA CTD PMID:26063408 and PMID:33221593 Dsp Rat bisphenol A increases expression ISO DSP (Homo sapiens) 6480464 bisphenol A results in increased expression of DSP mRNA and bisphenol A results in increased expression of DSP protein CTD PMID:36232920 and PMID:37567409 Dsp Rat bisphenol A increases expression ISO Dsp (Mus musculus) 6480464 bisphenol A results in increased expression of DSP mRNA CTD PMID:35598803 Dsp Rat bisphenol A decreases expression ISO DSP (Homo sapiens) 6480464 bisphenol A results in decreased expression of DSP protein CTD PMID:31675489 Dsp Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of DSP mRNA CTD PMID:25181051 and PMID:32145629 Dsp Rat bisphenol F decreases expression ISO Dsp (Mus musculus) 6480464 bisphenol F results in decreased expression of DSP mRNA CTD PMID:36706583 Dsp Rat bisphenol F increases expression ISO Dsp (Mus musculus) 6480464 bisphenol F results in increased expression of DSP mRNA CTD PMID:38685157 Dsp Rat butanal decreases expression ISO DSP (Homo sapiens) 6480464 butyraldehyde results in decreased expression of DSP mRNA CTD PMID:26079696 Dsp Rat butane-2,3-dione decreases expression ISO DSP (Homo sapiens) 6480464 Diacetyl results in decreased expression of DSP protein CTD PMID:34031698 Dsp Rat butyric acid increases expression ISO DSP (Homo sapiens) 6480464 Butyric Acid results in increased expression of DSP mRNA CTD PMID:34581912 Dsp Rat cadmium atom affects binding ISO DSP (Homo sapiens) 6480464 DSP protein binds to Cadmium CTD PMID:23896426 Dsp Rat cadmium atom multiple interactions ISO DSP (Homo sapiens) 6480464 2-bromopalmitate inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in increased palmitoylation of DSP protein] and [Cadmium Chloride results in increased abundance of Cadmium] which results in increased palmitoylation of DSP protein CTD PMID:38195004 Dsp Rat cadmium dichloride decreases expression ISO DSP (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of DSP mRNA CTD PMID:38568856 Dsp Rat cadmium dichloride multiple interactions ISO DSP (Homo sapiens) 6480464 2-bromopalmitate inhibits the reaction [[Cadmium Chloride results in increased abundance of Cadmium] which results in increased palmitoylation of DSP protein] and [Cadmium Chloride results in increased abundance of Cadmium] which results in increased palmitoylation of DSP protein CTD PMID:38195004 Dsp Rat caffeine affects phosphorylation ISO DSP (Homo sapiens) 6480464 Caffeine affects the phosphorylation of DSP protein CTD PMID:35688186 Dsp Rat calcitriol increases expression ISO DSP (Homo sapiens) 6480464 Calcitriol results in increased expression of DSP mRNA CTD PMID:26485663 Dsp Rat cantharidin decreases expression ISO Dsp (Mus musculus) 6480464 Cantharidin results in decreased expression of DSP mRNA CTD PMID:36907384 Dsp Rat carbon nanotube decreases expression ISO Dsp (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 and PMID:25620056 Dsp Rat CGP 52608 multiple interactions ISO DSP (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to DSP gene] CTD PMID:28238834 Dsp Rat chlorpyrifos decreases expression ISO Dsp (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of DSP mRNA CTD PMID:37019170 Dsp Rat cocaine increases expression ISO DSP (Homo sapiens) 6480464 Cocaine results in increased expression of DSP protein CTD PMID:17075605 Dsp Rat copper(II) chloride decreases expression ISO DSP (Homo sapiens) 6480464 cupric chloride results in decreased expression of DSP mRNA CTD PMID:38568856 Dsp Rat copper(II) sulfate increases expression ISO DSP (Homo sapiens) 6480464 Copper Sulfate results in increased expression of DSP mRNA CTD PMID:19549813 Dsp Rat coumarin decreases phosphorylation ISO DSP (Homo sapiens) 6480464 coumarin results in decreased phosphorylation of DSP protein CTD PMID:35688186 Dsp Rat DDE decreases expression ISO DSP (Homo sapiens) 6480464 Dichlorodiphenyl Dichloroethylene results in decreased expression of DSP mRNA CTD PMID:38568856 Dsp Rat dexamethasone multiple interactions ISO DSP (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin] results in decreased expression of DSP mRNA CTD PMID:28628672 Dsp Rat diarsenic trioxide increases expression ISO DSP (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of DSP protein CTD PMID:25419056 Dsp Rat dibenz[a,h]anthracene increases expression ISO Dsp (Mus musculus) 6480464 1 more ... CTD PMID:26377693 Dsp Rat dibenzo[a,l]pyrene increases expression ISO Dsp (Mus musculus) 6480464 dibenzo(a and l)pyrene results in increased expression of DSP mRNA CTD PMID:25908611 Dsp Rat dibenzo[a,l]pyrene decreases expression ISO DSP (Homo sapiens) 6480464 dibenzo(a and l)pyrene results in decreased expression of DSP mRNA CTD PMID:31255691 Dsp Rat dibutyl phthalate increases expression EXP 6480464 Dibutyl Phthalate results in increased expression of DSP mRNA CTD PMID:21266533 Dsp Rat dibutyl phthalate decreases expression EXP 6480464 Dibutyl Phthalate results in decreased expression of DSP mRNA CTD PMID:24893172 Dsp Rat dicrotophos increases expression ISO DSP (Homo sapiens) 6480464 dicrotophos results in increased expression of DSP mRNA CTD PMID:28302478 Dsp Rat dihydroartemisinin affects binding ISO DSP (Homo sapiens) 6480464 artenimol analog binds to DSP protein CTD PMID:26340163 Dsp Rat dioxygen increases expression ISO Dsp (Mus musculus) 6480464 Oxygen deficiency results in increased expression of DSP mRNA CTD PMID:20880076 Dsp Rat dorsomorphin multiple interactions ISO DSP (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Dsp Rat doxorubicin affects response to substance ISO DSP (Homo sapiens) 6480464 DSP protein affects the susceptibility to Doxorubicin CTD PMID:16217747 Dsp Rat doxorubicin increases expression ISO DSP (Homo sapiens) 6480464 Doxorubicin results in increased expression of DSP mRNA CTD PMID:29803840 Dsp Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of DSP mRNA CTD PMID:29391264 Dsp Rat enzyme inhibitor multiple interactions ISO DSP (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of DSP protein CTD PMID:23301498 Dsp Rat ethanol multiple interactions EXP 6480464 Ethanol inhibits the reaction [Dietary Fats results in increased expression of DSP mRNA] CTD PMID:21051528 Dsp Rat ethanol multiple interactions ISO DSP (Homo sapiens) 6480464 [[Gasoline co-treated with Ethanol] results in increased abundance of [Particulate Matter co-treated with Polycyclic Aromatic Hydrocarbons]] which results in increased expression of DSP mRNA CTD PMID:29432896 Dsp Rat fipronil increases expression EXP 6480464 fipronil results in increased expression of DSP mRNA CTD PMID:34044035 Dsp Rat folic acid multiple interactions ISO Dsp (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of DSP mRNA CTD PMID:22206623 Dsp Rat FR900359 increases phosphorylation ISO DSP (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of DSP protein CTD PMID:37730182 Dsp Rat furfural multiple interactions ISO DSP (Homo sapiens) 6480464 [pyrogallol 1 more ... CTD PMID:38598786 Dsp Rat glafenine decreases expression EXP 6480464 Glafenine results in decreased expression of DSP mRNA CTD PMID:24136188 Dsp Rat indometacin multiple interactions ISO DSP (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin] results in decreased expression of DSP mRNA CTD PMID:28628672 Dsp Rat lasalocid increases expression ISO DSP (Homo sapiens) 6480464 Lasalocid results in increased expression of DSP protein CTD PMID:37788135 Dsp Rat lead diacetate decreases expression EXP 6480464 lead acetate results in decreased expression of DSP mRNA CTD PMID:22641619 Dsp Rat lead diacetate decreases expression ISO DSP (Homo sapiens) 6480464 lead acetate results in decreased expression of DSP mRNA CTD PMID:38568856 Dsp Rat lead(0) affects binding ISO DSP (Homo sapiens) 6480464 DSP protein binds to Lead CTD PMID:23896426 Dsp Rat leflunomide increases expression ISO DSP (Homo sapiens) 6480464 leflunomide results in increased expression of DSP mRNA CTD PMID:28988120 Dsp Rat lipopolysaccharide increases expression ISO DSP (Homo sapiens) 6480464 Lipopolysaccharides results in increased expression of DSP mRNA CTD PMID:35811015 Dsp Rat lipopolysaccharide multiple interactions ISO DSP (Homo sapiens) 6480464 S-(1 and 2-dichlorovinyl)cysteine inhibits the reaction [Lipopolysaccharides results in increased expression of DSP mRNA] CTD PMID:35811015 Dsp Rat malathion increases expression ISO DSP (Homo sapiens) 6480464 Malathion results in increased expression of DSP mRNA CTD PMID:37047231 Dsp Rat mercury dibromide increases expression ISO DSP (Homo sapiens) 6480464 mercuric bromide results in increased expression of DSP mRNA CTD PMID:26272509 Dsp Rat mercury dibromide multiple interactions ISO DSP (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of DSP mRNA CTD PMID:27188386 Dsp Rat methamphetamine increases expression ISO Dsp (Mus musculus) 6480464 Methamphetamine results in increased expression of DSP mRNA CTD PMID:26307267 Dsp Rat methidathion increases expression ISO Dsp (Mus musculus) 6480464 methidathion results in increased expression of DSP mRNA CTD PMID:34813904 Dsp Rat methylmercury chloride decreases expression ISO DSP (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of DSP mRNA CTD PMID:23179753 and PMID:27188386 Dsp Rat monosodium L-glutamate increases expression ISO Dsp (Mus musculus) 6480464 Sodium Glutamate results in increased expression of DSP mRNA CTD PMID:19001666 Dsp Rat monosodium L-glutamate multiple interactions ISO Dsp (Mus musculus) 6480464 [Sodium Glutamate co-treated with Trans Fatty Acids] results in decreased expression of DSP mRNA CTD PMID:19001666 Dsp Rat N-acetyl-L-cysteine multiple interactions EXP 6480464 Acetylcysteine inhibits the reaction [Dietary Fats results in increased expression of DSP mRNA] CTD PMID:21051528 Dsp Rat nitrofen increases expression EXP 6480464 nitrofen results in increased expression of DSP mRNA CTD PMID:33484710 Dsp Rat Nonylphenol increases expression EXP 6480464 nonylphenol results in increased expression of DSP protein CTD PMID:19260726 Dsp Rat okadaic acid increases expression ISO Dsp (Mus musculus) 6480464 Okadaic Acid results in increased expression of DSP mRNA CTD PMID:25270620 Dsp Rat paclitaxel affects response to substance ISO DSP (Homo sapiens) 6480464 DSP protein affects the susceptibility to Paclitaxel CTD PMID:16217747 Dsp Rat paracetamol affects expression ISO Dsp (Mus musculus) 6480464 Acetaminophen affects the expression of DSP mRNA CTD PMID:17562736 Dsp Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of DSP mRNA CTD PMID:33387578 Dsp Rat pentachlorophenol increases expression ISO Dsp (Mus musculus) 6480464 Pentachlorophenol results in increased expression of DSP mRNA CTD PMID:23892564 Dsp Rat perfluorooctane-1-sulfonic acid affects expression ISO Dsp (Mus musculus) 6480464 perfluorooctane sulfonic acid affects the expression of DSP mRNA CTD PMID:19429403 Dsp Rat perfluorooctanoic acid affects expression ISO Dsp (Mus musculus) 6480464 perfluorooctanoic acid affects the expression of DSP mRNA CTD PMID:19429403 Dsp Rat perfluorooctanoic acid multiple interactions EXP 6480464 [Zeranol co-treated with perfluorooctanoic acid] results in decreased expression of DSP mRNA CTD PMID:35163327 Dsp Rat permethrin increases expression ISO DSP (Homo sapiens) 6480464 Permethrin results in increased expression of DSP mRNA CTD PMID:37047231 Dsp Rat phenobarbital decreases expression ISO Dsp (Mus musculus) 6480464 Phenobarbital results in decreased expression of DSP mRNA CTD PMID:19363144 Dsp Rat phenobarbital affects expression ISO Dsp (Mus musculus) 6480464 Phenobarbital affects the expression of DSP mRNA CTD PMID:23091169 Dsp Rat phenylmercury acetate increases expression ISO DSP (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of DSP mRNA CTD PMID:26272509 Dsp Rat phenylmercury acetate multiple interactions ISO DSP (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of DSP mRNA CTD PMID:27188386 Dsp Rat pirinixic acid decreases expression ISO Dsp (Mus musculus) 6480464 pirinixic acid results in decreased expression of DSP mRNA CTD PMID:18445702 Dsp Rat potassium chromate decreases expression ISO DSP (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of DSP mRNA CTD PMID:22714537 Dsp Rat pregnenolone 16alpha-carbonitrile decreases expression ISO Dsp (Mus musculus) 6480464 Pregnenolone Carbonitrile results in decreased expression of DSP mRNA CTD PMID:28903501 Dsp Rat progesterone multiple interactions ISO Dsp (Mus musculus) 6480464 NCOA2 protein affects the reaction [Progesterone results in decreased expression of DSP mRNA] CTD PMID:17556502 Dsp Rat progesterone decreases expression ISO Dsp (Mus musculus) 6480464 Progesterone results in decreased expression of DSP mRNA CTD PMID:17556502 and PMID:22238285 Dsp Rat propiconazole decreases expression ISO Dsp (Mus musculus) 6480464 propiconazole results in decreased expression of DSP mRNA CTD PMID:21278054 Dsp Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of DSP mRNA CTD PMID:28374803 Dsp Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO DSP (Homo sapiens) 6480464 S-(1 and 2-dichlorovinyl)cysteine inhibits the reaction [Lipopolysaccharides results in increased expression of DSP mRNA] CTD PMID:35811015 Dsp Rat SB 431542 increases expression ISO DSP (Homo sapiens) 6480464 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide results in increased expression of DSP protein CTD PMID:25670856 Dsp Rat SB 431542 multiple interactions ISO DSP (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Dsp Rat silicon dioxide decreases expression ISO DSP (Homo sapiens) 6480464 Silicon Dioxide analog results in decreased expression of DSP mRNA CTD PMID:25895662 Dsp Rat sodium arsenite decreases expression ISO DSP (Homo sapiens) 6480464 sodium arsenite results in decreased expression of DSP mRNA CTD PMID:12634122 and PMID:38568856 Dsp Rat sodium arsenite decreases expression EXP 6480464 sodium arsenite results in decreased expression of DSP protein CTD PMID:29459688 Dsp Rat sodium arsenite affects methylation ISO DSP (Homo sapiens) 6480464 sodium arsenite affects the methylation of DSP gene CTD PMID:28589171 Dsp Rat sodium arsenite multiple interactions ISO DSP (Homo sapiens) 6480464 sodium arsenite inhibits the reaction [H3-3A protein binds to DSP protein] CTD PMID:37734572 Dsp Rat sodium chloride multiple interactions ISO DSP (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in decreased expression of DSP protein more ... CTD PMID:38598786 Dsp Rat sodium fluoride decreases expression ISO Dsp (Mus musculus) 6480464 Sodium Fluoride results in decreased expression of DSP protein CTD PMID:28918527 Dsp Rat sulforaphane increases expression ISO Dsp (Mus musculus) 6480464 sulforaphane results in increased expression of DSP mRNA CTD PMID:30529165 Dsp Rat sunitinib decreases expression ISO DSP (Homo sapiens) 6480464 Sunitinib results in decreased expression of DSP mRNA CTD PMID:31533062 Dsp Rat tetrachloromethane affects expression ISO Dsp (Mus musculus) 6480464 Carbon Tetrachloride affects the expression of DSP mRNA CTD PMID:31919559 Dsp Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of DSP mRNA CTD PMID:23411599 Dsp Rat titanium dioxide increases expression ISO Dsp (Mus musculus) 6480464 titanium dioxide results in increased expression of DSP mRNA CTD PMID:35295148 Dsp Rat titanium dioxide decreases methylation ISO Dsp (Mus musculus) 6480464 titanium dioxide results in decreased methylation of DSP gene CTD PMID:35295148 Dsp Rat topotecan affects response to substance ISO DSP (Homo sapiens) 6480464 DSP protein affects the susceptibility to Topotecan CTD PMID:16217747 Dsp Rat triadimefon decreases expression ISO DSP (Homo sapiens) 6480464 triadimefon results in decreased expression of DSP mRNA CTD PMID:26705709 Dsp Rat trichloroethene decreases expression EXP 6480464 Trichloroethylene results in decreased expression of DSP mRNA CTD PMID:33387578 Dsp Rat trichostatin A increases expression ISO DSP (Homo sapiens) 6480464 trichostatin A results in increased expression of DSP mRNA CTD PMID:24935251 more ... Dsp Rat trichostatin A multiple interactions ISO DSP (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of DSP mRNA CTD PMID:27188386 Dsp Rat triptonide increases expression ISO Dsp (Mus musculus) 6480464 triptonide results in increased expression of DSP mRNA CTD PMID:33045310 Dsp Rat urethane increases expression ISO DSP (Homo sapiens) 6480464 Urethane results in increased expression of DSP mRNA CTD PMID:28818685 Dsp Rat valproic acid decreases expression ISO DSP (Homo sapiens) 6480464 Valproic Acid results in decreased expression of DSP mRNA CTD PMID:29154799 Dsp Rat valproic acid multiple interactions ISO DSP (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of DSP mRNA CTD PMID:27188386 Dsp Rat valproic acid increases expression ISO DSP (Homo sapiens) 6480464 Valproic Acid results in increased expression of DSP mRNA CTD PMID:23527032 more ... Dsp Rat vinclozolin affects expression EXP 6480464 vinclozolin affects the expression of DSP mRNA CTD PMID:19015723 Dsp Rat zinc atom affects binding ISO DSP (Homo sapiens) 6480464 DSP protein binds to Zinc CTD PMID:23896426 Dsp Rat zinc(0) affects binding ISO DSP (Homo sapiens) 6480464 DSP protein binds to Zinc CTD PMID:23896426
Imported Annotations - KEGG (archival)
1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (EXP) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,3-dimethoxynaphthalene-1,4-dione (ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 2,4-dinitrotoluene (EXP) 2,6-dimethoxyphenol (ISO) 2,6-dinitrotoluene (EXP) 2-bromohexadecanoic acid (ISO) 2-palmitoylglycerol (ISO) 3-chloropropane-1,2-diol (EXP) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (ISO) 4-hydroxyphenyl retinamide (ISO) 5-aza-2'-deoxycytidine (ISO) acrylamide (EXP) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) alpha-Zearalanol (EXP) amphetamine (EXP) Aroclor 1254 (ISO) arsenous acid (ISO) benzo[a]pyrene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) butanal (ISO) butane-2,3-dione (ISO) butyric acid (ISO) cadmium atom (ISO) cadmium dichloride (ISO) caffeine (ISO) calcitriol (ISO) cantharidin (ISO) carbon nanotube (ISO) CGP 52608 (ISO) chlorpyrifos (ISO) cocaine (ISO) copper(II) chloride (ISO) copper(II) sulfate (ISO) coumarin (ISO) DDE (ISO) dexamethasone (ISO) diarsenic trioxide (ISO) dibenz[a,h]anthracene (ISO) dibenzo[a,l]pyrene (ISO) dibutyl phthalate (EXP) dicrotophos (ISO) dihydroartemisinin (ISO) dioxygen (ISO) dorsomorphin (ISO) doxorubicin (ISO) endosulfan (EXP) enzyme inhibitor (ISO) ethanol (EXP,ISO) fipronil (EXP) folic acid (ISO) FR900359 (ISO) furfural (ISO) glafenine (EXP) indometacin (ISO) lasalocid (ISO) lead diacetate (EXP,ISO) lead(0) (ISO) leflunomide (ISO) lipopolysaccharide (ISO) malathion (ISO) mercury dibromide (ISO) methamphetamine (ISO) methidathion (ISO) methylmercury chloride (ISO) monosodium L-glutamate (ISO) N-acetyl-L-cysteine (EXP) nitrofen (EXP) Nonylphenol (EXP) okadaic acid (ISO) paclitaxel (ISO) paracetamol (EXP,ISO) pentachlorophenol (ISO) perfluorooctane-1-sulfonic acid (ISO) perfluorooctanoic acid (EXP,ISO) permethrin (ISO) phenobarbital (ISO) phenylmercury acetate (ISO) pirinixic acid (ISO) potassium chromate (ISO) pregnenolone 16alpha-carbonitrile (ISO) progesterone (ISO) propiconazole (ISO) rotenone (EXP) S-(1,2-dichlorovinyl)-L-cysteine (ISO) SB 431542 (ISO) silicon dioxide (ISO) sodium arsenite (EXP,ISO) sodium chloride (ISO) sodium fluoride (ISO) sulforaphane (ISO) sunitinib (ISO) tetrachloromethane (ISO) thioacetamide (EXP) titanium dioxide (ISO) topotecan (ISO) triadimefon (ISO) trichloroethene (EXP) trichostatin A (ISO) triptonide (ISO) urethane (ISO) valproic acid (ISO) vinclozolin (EXP) zinc atom (ISO) zinc(0) (ISO)
Biological Process
adherens junction organization (IEA,ISO) bundle of His cell-Purkinje myocyte adhesion involved in cell communication (IEA,ISO) cell-cell adhesion (IBA,IEA,ISO) desmosome organization (IEA,ISO) epithelial cell-cell adhesion (IEA,ISO) intermediate filament cytoskeleton organization (IBA,IEA,ISO) intermediate filament organization (IEA,ISO) keratinocyte differentiation (IEA,ISO) peptide cross-linking (ISO) protein localization to cell-cell junction (IEA,ISO) regulation of heart rate by cardiac conduction (IEA,ISO) regulation of ventricular cardiac muscle cell action potential (IEA,ISO) skin development (IBA,IEA,ISO) ventricular compact myocardium morphogenesis (IEA,ISO) wound healing (IBA)
Cellular Component
adherens junction (IDA,ISO) anchoring junction (IEA) basolateral plasma membrane (IEA,ISO) cell-cell junction (IEA,ISO) cornified envelope (IEA,ISO) cytoplasm (IEA,ISO,ISS) cytoskeleton (IEA) desmosome (IDA,IEA,ISO) fascia adherens (IDA) intercalated disc (IBA,IEA,ISO) intermediate filament (IBA,IEA,ISO) membrane (IEA) plasma membrane (IBA,IEA,ISO,ISS)
1.
A recessive mutation in desmoplakin causes arrhythmogenic right ventricular dysplasia, skin disorder, and woolly hair.
Alcalai R, etal., J Am Coll Cardiol. 2003 Jul 16;42(2):319-27.
2.
Dissociated spatial patterning of gap junctions and cell adhesion junctions during postnatal differentiation of ventricular myocardium.
Angst BD, etal., Circ Res. 1997 Jan;80(1):88-94.
3.
Assembly and remodelling of myofibrils and intercalated discs in cultured neonatal rat heart cells.
Atherton BT, etal., J Cell Sci. 1986 Dec;86:233-48.
4.
Cell-cell and cell-matrix interactions differentially regulate the expression of hepatic and cytoskeletal genes in primary cultures of rat hepatocytes.
Ben-Ze'ev A, etal., Proc Natl Acad Sci U S A. 1988 Apr;85(7):2161-5.
5.
The area composita of adhering junctions connecting heart muscle cells of vertebrates. II. Colocalizations of desmosomal and fascia adhaerens molecules in the intercalated disk.
Borrmann CM, etal., Eur J Cell Biol. 2006 Jun;85(6):469-85. Epub 2006 Apr 4.
6.
The complement of desmosomal plaque proteins in different cell types.
Cowin P, etal., J Cell Biol. 1985 Oct;101(4):1442-54.
7.
Lumen formation and redistribution of inframembranous proteins during differentiation of ducts in the rat mammary gland.
Dulbecco R, etal., Proc Natl Acad Sci U S A. 1984 Sep;81(18):5763-6.
8.
The area composita of adhering junctions connecting heart muscle cells of vertebrates. I. Molecular definition in intercalated disks of cardiomyocytes by immunoelectron microscopy of desmosomal proteins.
Franke WW, etal., Eur J Cell Biol. 2006 Feb;85(2):69-82. Epub 2006 Jan 9.
9.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
10.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
11.
Desmoplakin expression and distribution in cultured rat bladder epithelial cells of varying tumorigenic potential.
Green KJ, etal., Exp Cell Res. 1991 Mar;193(1):134-43.
12.
Contact-inhibitory factor induces alterations in the distribution and content of specific cytoskeletal elements in an established line of rat hepatic tumor cells.
Higgins PJ, etal., Int J Cancer. 1987 Dec 15;40(6):792-801.
13.
Intermediate filament-co-localized molecules with myosin heavy chain epitopes define distinct cellular domains in hair follicles and epidermis.
Jazwinska A, etal., BMC Cell Biol. 2003 Aug 4;4:10.
14.
Specific attachment of desmin filaments to desmosomal plaques in cardiac myocytes.
Kartenbeck J, etal., EMBO J. 1983;2(5):735-42.
15.
Changes in cytokeratin, vimentin and desmoplakin distribution during the repair of irradiation-induced lung injury in adult rats.
Kasper M, etal., Virchows Arch B Cell Pathol Incl Mol Pathol. 1993;64(5):271-9.
16.
Spatiotemporal development and distribution of intercellular junctions in adult rat cardiomyocytes in culture.
Kostin S, etal., Circ Res. 1999 Jul 23;85(2):154-67.
17.
Remodeling of cell-cell and cell-extracellular matrix interactions at the border zone of rat myocardial infarcts.
Matsushita T, etal., Circ Res. 1999 Nov 26;85(11):1046-55.
18.
Formation of cell junctions between grafted and host cardiomyocytes at the border zone of rat myocardial infarction.
Matsushita T, etal., Circulation. 1999 Nov 9;100(19 Suppl):II262-8.
19.
Expression of desmosomal proteins in rat keratinocytes during in vitro differentiation.
Mochizuki R, etal., J Vet Med Sci. 2002 Feb;64(2):123-7.
20.
Formation of the tooth enamel rod pattern and the cytoskeletal organization in secretory ameloblasts of the rat incisor.
Nishikawa S, etal., Eur J Cell Biol. 1988 Dec;47(2):222-32.
21.
Recessive mutation in desmoplakin disrupts desmoplakin-intermediate filament interactions and causes dilated cardiomyopathy, woolly hair and keratoderma.
Norgett EE, etal., Hum Mol Genet. 2000 Nov 1;9(18):2761-6.
22.
Disappearance of desmosomal components in rat corneal epithelium during wound healing.
Okada Y, etal., Ophthalmologica. 2001 Jan-Feb;215(1):61-5.
23.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
24.
Cytoskeletons of retinal pigment epithelial cells: interspecies differences of expression patterns indicate independence of cell function from the specific complement of cytoskeletal proteins.
Owaribe K, etal., Cell Tissue Res. 1988 Nov;254(2):301-15.
25.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
26.
Progesterone treatment and the progress of early pregnancy reduce desmoglein 1&2 staining along the lateral plasma membrane in rat uterine epithelial cells.
Preston AM, etal., Acta Histochem. 2004;106(5):345-51.
27.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
28.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
29.
The zinc-finger protein slug causes desmosome dissociation, an initial and necessary step for growth factor-induced epithelial-mesenchymal transition.
Savagner P, etal., J Cell Biol 1997 Jun 16;137(6):1403-19.
30.
A novel type of adhering junction in an epithelioid tumorigenic rat cell culture line.
Schmelz M, etal., Cell Tissue Res. 1998 Oct;294(1):11-25.
31.
Complexus adhaerentes, a new group of desmoplakin-containing junctions in endothelial cells: II. Different types of lymphatic vessels.
Schmelz M, etal., Differentiation. 1994 Aug;57(2):97-117.
32.
Altered patterns of cardiac intercellular junction distribution in hypertrophic cardiomyopathy.
Sepp R, etal., Heart. 1996 Nov;76(5):412-7.
33.
Cytoplasmic desmosomes and intermediate filament disturbance following acrylamide treatment in cultured rat keratinocytes.
Shabana AH, etal., Tissue Cell. 1994 Feb;26(1):43-55.
34.
The cytoplasmic domain of CEACAM1-L controls its lateral localization and the organization of desmosomes in polarized epithelial cells.
Sundberg U, etal., J Cell Sci. 2004 Mar 1;117(Pt 7):1091-104. Epub 2004 Feb 17.
35.
Protein phosphatases maintain the organization and structural interactions of hepatic keratin intermediate filaments.
Toivola DM, etal., J Cell Sci. 1997 Jan;110 ( Pt 1):23-33.
36.
Contributions of cytoplasmic domains of desmosomal cadherins to desmosome assembly and intermediate filament anchorage.
Troyanovsky SM, etal., Cell. 1993 Feb 26;72(4):561-74.
37.
Isolation of cell-to-cell adherens junctions from rat liver.
Tsukita S and Tsukita S, J Cell Biol. 1989 Jan;108(1):31-41.
38.
Remodeling of gap junctional coupling in hypertrophied right ventricles of rats with monocrotaline-induced pulmonary hypertension.
Uzzaman M, etal., Circ Res. 2000 Apr 28;86(8):871-8.
39.
Blood-testis barrier dynamics are regulated by an engagement/disengagement mechanism between tight and adherens junctions via peripheral adaptors.
Yan HH and Cheng CY, Proc Natl Acad Sci U S A. 2005 Aug 16;102(33):11722-7. Epub 2005 Aug 5.
40.
Localization of Na+ channel isoforms at the atrioventricular junction and atrioventricular node in the rat.
Yoo S, etal., Circulation. 2006 Sep 26;114(13):1360-71. Epub 2006 Sep 11.
Dsp Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 17 26,829,153 - 26,877,419 (-) NCBI GRCr8 mRatBN7.2 17 26,623,602 - 26,671,692 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 17 26,623,588 - 26,671,800 (-) Ensembl mRatBN7.2 Ensembl Rnor_6.0 17 27,286,811 - 27,334,453 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 17 27,286,796 - 27,334,379 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 17 29,201,872 - 29,249,490 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 17 32,848,313 - 32,896,044 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 17 32,851,800 - 32,898,885 (-) NCBI Celera 17 26,257,726 - 26,305,766 (-) NCBI Celera Cytogenetic Map 17 p12 NCBI
DSP Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 6 7,541,671 - 7,586,714 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 6 7,541,326 - 7,586,717 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 6 7,541,904 - 7,586,947 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 6 7,486,869 - 7,531,945 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 6 7,486,868 - 7,531,945 NCBI Celera 6 8,771,623 - 8,816,711 (+) NCBI Celera Cytogenetic Map 6 p24.3 NCBI HuRef 6 7,419,476 - 7,464,417 (+) NCBI HuRef CHM1_1 6 7,544,023 - 7,589,106 (+) NCBI CHM1_1 T2T-CHM13v2.0 6 7,410,711 - 7,455,759 (+) NCBI T2T-CHM13v2.0
Dsp Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 13 38,335,357 - 38,382,553 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 13 38,335,270 - 38,382,553 (+) Ensembl GRCm39 Ensembl GRCm38 13 38,151,294 - 38,198,577 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 13 38,151,294 - 38,198,577 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 13 38,243,163 - 38,290,446 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 13 38,158,760 - 38,206,043 (+) NCBI MGSCv36 mm8 Celera 13 39,265,897 - 39,313,259 (+) NCBI Celera Cytogenetic Map 13 A3.3 NCBI cM Map 13 18.0 NCBI
Dsp Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955465 6,356,863 - 6,392,207 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955465 6,356,970 - 6,391,206 (-) NCBI ChiLan1.0 ChiLan1.0
DSP Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 5 22,183,206 - 22,228,587 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 6 18,180,000 - 18,225,467 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 6 7,381,046 - 7,426,408 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 6 7,664,399 - 7,709,391 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 6 7,664,211 - 7,709,391 (+) Ensembl panpan1.1 panPan2
DSP Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 35 7,479,628 - 7,524,732 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 35 7,479,643 - 7,524,044 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 35 7,483,107 - 7,528,345 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 35 7,562,265 - 7,607,463 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 35 7,562,020 - 7,607,463 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 35 7,415,316 - 7,460,024 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 35 7,441,523 - 7,486,395 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 35 8,773,585 - 8,819,012 (+) NCBI UU_Cfam_GSD_1.0
Dsp Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404946 16,760,022 - 16,807,481 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936534 5,028,911 - 5,077,199 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936534 5,029,008 - 5,076,467 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
DSP Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 7 4,862,649 - 4,915,623 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 7 4,862,649 - 4,915,626 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 7 4,968,344 - 5,021,222 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
DSP Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 17 64,611,243 - 64,656,297 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 17 64,611,103 - 64,656,366 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666044 7,495,774 - 7,541,054 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Dsp
.
Predicted Target Of
Count of predictions: 16 Count of miRNA genes: 16 Interacting mature miRNAs: 16 Transcripts: ENSRNOT00000018649 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
1354581 Bp247 Blood pressure QTL 247 4.5 arterial blood pressure trait (VT:2000000) pulse pressure (CMO:0000292) 17 1 69599340 Rat 2300002 Iddm36 Insulin dependent diabetes mellitus QTL 36 1.98 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 17 9991286 40540197 Rat 631499 Stl1 Serum triglyceride level QTL 1 3.6 blood triglyceride amount (VT:0002644) blood triglyceride level (CMO:0000118) 17 3271398 27389946 Rat 2293664 Bmd28 Bone mineral density QTL 28 5.1 0.0001 femur mineral mass (VT:0010011) trabecular volumetric bone mineral density (CMO:0001729) 17 4354487 27028127 Rat 1354640 Scl32 Serum cholesterol level QTL 32 5.4 blood HDL cholesterol amount (VT:0000184) blood high density lipoprotein cholesterol level (CMO:0000052) 17 15781592 60781592 Rat 152023626 Bp403 Blood pressure QTL 403 3.86 arterial blood pressure trait (VT:2000000) 17 23930421 79524188 Rat 1300123 Bp194 Blood pressure QTL 194 2.82 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 17 2115149 34551001 Rat 70157 Niddm32 Non-insulin dependent diabetes mellitus QTL 32 4.34 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 17 22454924 50909196 Rat 1354651 Lmblg2 Limb length QTL 2 6 tibia length (VT:0004357) tibia length (CMO:0000450) 17 4299130 69599340 Rat 1354628 Stl13 Serum triglyceride level QTL 13 3.8 blood triglyceride amount (VT:0002644) blood triglyceride level (CMO:0000118) 17 21293039 60781592 Rat 10401807 Kidm52 Kidney mass QTL 52 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 17 1 31701463 Rat 10054088 Scort28 Serum corticosterone level QTL 28 2.04 0.0102 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 17 4528038 49528038 Rat 1354630 Cm34 Cardiac mass QTL 34 8.7 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 17 4299130 69599340 Rat 61394 Bp8 Blood pressure QTL 8 2.2 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 17 23080567 59555013 Rat 1559055 Bp278 Blood pressure QTL 278 0.04 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 17 23653184 68653184 Rat 152025238 Slep14 Serum leptin concentration QTL 14 4.62 blood leptin amount (VT:0005667) 17 24184890 79524188 Rat 1354638 Insul1 Insulin level QTL 1 4.8 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 17 4299130 69599340 Rat 1354613 Kidm14 Kidney mass QTL 14 6.2 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 17 4299130 35837242 Rat 1331765 Hrtrt15 Heart rate QTL 15 4.094 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 17 15330613 55836425 Rat 2303627 Vencon8 Ventilatory control QTL 8 0.001 respiration trait (VT:0001943) tidal volume (CMO:0000222) 17 4528038 49528038 Rat 12903980 Cm120 Cardiac mass QTL 120 0.002 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 17 23653184 68653184 Rat 70184 BpQTLcluster14 Blood pressure QTL cluster 14 3.38 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 17 1 31990913 Rat 12903981 Am17 Aortic mass QTL 17 0.001 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 17 23653184 68653184 Rat 2303561 Bw91 Body weight QTL 91 2 body mass (VT:0001259) body weight (CMO:0000012) 17 8868462 53868462 Rat 12903982 Kidm70 Kidney mass QTL 70 0.001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 17 23653184 70974005 Rat 631207 Niddm41 Non-insulin dependent diabetes mellitus QTL 41 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 17 1 37830672 Rat 12903978 Cm118 Cardiac mass QTL 118 0.001 heart mass (VT:0007028) heart wet weight to body weight ratio (CMO:0002408) 17 23653184 68653184 Rat 12903979 Cm119 Cardiac mass QTL 119 0.001 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 17 23653184 68653184 Rat 1354619 Bp242 Blood pressure QTL 242 6.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 17 24599340 69599340 Rat 1354596 Bw32 Body weight QTL 32 4.5 body mass (VT:0001259) body weight (CMO:0000012) 17 4299130 60781592 Rat 1354662 Rf49 Renal function QTL 49 2.9 blood creatinine amount (VT:0005328) plasma creatinine level (CMO:0000537) 17 1 69599340 Rat 2293648 Bmd31 Bone mineral density QTL 31 4.5 0.0001 femur size trait (VT:1000369) femoral neck cortical cross-sectional area (CMO:0001702) 17 4354487 27028127 Rat 152023740 Bp406 Blood pressure QTL 406 6.06 arterial blood pressure trait (VT:2000000) 17 23930421 79524188 Rat 7488966 Bp370 Blood pressure QTL 370 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 17 23653184 57246843 Rat 1354658 Spl8 Serum phospholipid level QTL 8 3.8 blood VLDL phospholipid amount (VT:0010507) blood very low density lipoprotein phospholipid level (CMO:0001571) 17 1 60781592 Rat 152023737 Bp405 Blood pressure QTL 405 5.06 arterial blood pressure trait (VT:2000000) 23930421 79524188 Rat 1354659 Scl68 Serum cholesterol level QTL 68 3.9 blood VLDL cholesterol amount (VT:0005144) blood very low density lipoprotein cholesterol level (CMO:0000648) 17 15781592 60781592 Rat 152023736 Bp404 Blood pressure QTL 404 3.78 arterial blood pressure trait (VT:2000000) 17 23930421 79524188 Rat
RH130644
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 17 26,623,710 - 26,623,906 (+) MAPPER mRatBN7.2 Rnor_6.0 17 27,286,920 - 27,287,115 NCBI Rnor6.0 Rnor_5.0 17 29,201,981 - 29,202,176 UniSTS Rnor5.0 RGSC_v3.4 17 32,848,422 - 32,848,617 UniSTS RGSC3.4 Celera 17 26,257,835 - 26,258,030 UniSTS RH 3.4 Map 17 341.4 UniSTS Cytogenetic Map 17 p12 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000018649 ⟹ ENSRNOP00000018649
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 17 26,623,588 - 26,671,800 (-) Ensembl Rnor_6.0 Ensembl 17 27,286,796 - 27,334,379 (-) Ensembl
RefSeq Acc Id:
NM_001419598 ⟹ NP_001406527
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 17 26,829,153 - 26,877,121 (-) NCBI mRatBN7.2 17 26,623,602 - 26,671,566 (-) NCBI
RefSeq Acc Id:
XM_017600713 ⟹ XP_017456202
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 17 26,829,153 - 26,877,419 (-) NCBI mRatBN7.2 17 26,623,602 - 26,671,692 (-) NCBI Rnor_6.0 17 27,286,811 - 27,334,452 (-) NCBI
Sequence:
GGGGCGGGGGAGGCGAAGCGGCCGCACCTCGCCCTGGGAAGAAGCGGGCCAGGTGTGGCCTGCGCGCCTGGTGCCAGCGGGGAGGAGACTAGCGCCGCCTCGACCAACACCAACACCCAGGCGCGACG
hide sequence
RefSeq Acc Id:
XP_017456202 ⟸ XM_017600713
- Peptide Label:
isoform X1
- Sequence:
MSCNGGSHPRINTLGRMTRAESGPDLRYEMTYSGGGGGGGGGGGGTSRMYYSRRCTVNDQNSDGYCQTGTMSRHQNQNTIQELLQNCADCLMRAELIAQPELKFGEGIQLAWNRELDEYFTQANDQME
hide sequence
Ensembl Acc Id:
ENSRNOP00000018649 ⟸ ENSRNOT00000018649
RefSeq Acc Id:
NP_001406527 ⟸ NM_001419598
- UniProtKB:
F1LMV6 (UniProtKB/Swiss-Prot), Q4QQR7 (UniProtKB/Swiss-Prot), A6J7B0 (UniProtKB/TrEMBL)
RGD ID: 13700401 Promoter ID: EPDNEW_R10917 Type: initiation region Name: Dsp_1 Description: desmoplakin SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 17 27,334,318 - 27,334,378 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2005-12-06
Dsp
desmoplakin
Dsp_predicted
desmoplakin (predicted)
Symbol and Name updated
1559027 APPROVED
2005-01-12
Dsp_predicted
desmoplakin (predicted)
Symbol and Name status set to approved
70820 APPROVED
